* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Dr Ishtiaq Lecture at GC Faisalabad
DNA damage theory of aging wikipedia , lookup
History of RNA biology wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Protein moonlighting wikipedia , lookup
Metagenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Cancer epigenetics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Genomic library wikipedia , lookup
Human genome wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA vaccination wikipedia , lookup
Primary transcript wikipedia , lookup
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
History of genetic engineering wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Chemistry and Biology of DNA in the Age of Personalized Medicines Dr. Ishtiaq Ahmad Khan Assistant Professor Dr. Panjwani Center for Molecular Medicine and Drug Research International Center for Chemical and Biological Sciences, University of Karachi. DNA in every organism DNA – The molecule of Life The building blocks of DNA are nucleotides. each nucleotide composed of: – a nitrogenous base (adenine, thymine, guanine, cytosine abbreviated as A, T, G, C) – a 5-carbon sugar called deoxyribose – a phosphate group (PO4) Nucleotides ester linkage Nitrogenous base (adenine) Phosphate group 5-carbon Ribose sugar DNA Structure Nucleotides are connected to each other by phosphodiester bonds to form a long chain Double helical Structure of DNA – 2 sugar-phosphate backbones – nitrogenous bases toward the interior of the molecule – bases form hydrogen bonds with complementary bases on the opposite sugar-phosphate backbone • A pairs with T (2 H bonds) • C pairs with G (3 H Bonds) Noble Prizes in DNA Chemistry Watson, Crick, and Wilkins (1962): Discovery of structure of DNA H. Gobind Khorana (1973) Chemical synthesis of oligonucleotide Berg, Gilbert, and Sanger (1980): The determination of base sequences in nucleic acids Mullis and Smith (1993): Contributions to the developments of methods within DNA-based chemistry. Invention of PCR Sequencing the DNA In the 1970’s, Sanger’s group discovered a method of 'reading' the linear DNA sequence using special nucleotide bases called chain terminators or di-deoxy nucleotides. This method is still in use today. Frederick Sanger Died on November 19, 2013 Dideoxy Nucleotide Next Generation DNA Sequencing Massively parallel sequencing, Shotgun Genome Sequencing: for sequencing the whole genome and whole exome Complete genome copies Next Generation DNA Sequencing Fragmented genome chunks NOT REALLY DONE BY DUCK HUNTERS ! Hydroshearing, sonication, enzymatic shearing Major NGS Platforms • 454 FLX Genome Sequencer (Roche) Pyrosequencing method • Hiseq2000, Solexa Genome Analyzer (Illumina) Sequencing by seynthesis • SOLiD ( Applied Biosystems) Sequencing by ligation chemistry • Ion-torrent (Life technologies) An integrated semiconductor device enabling non-optical genome sequencing • Heliscope (Heliscope Biosciences) Single molecule sequencing by synthesis 24 Assembly of short reads 17 bp ATTGTTCCCACAGACCG CGGCGAAGCATTGTTCC ACCGTGTTTTCCGACCG AGCTCGATGCCGGCGAAG TTGTTCCCACAGACCGTG TTTCCGACCGAAATGGC ATGCCGGCGAAGCATTGT ACAGACCGTGTTTCCCGA TAATGCGACCTCGATGCC AAGCATTGTTCCCACAG TGTTTTCCGACCGAAAT TGCCGGCGAAGCCTTGT CCGACCGAAATGGCTCC 66 bp Consensus sequence: TAATGCGACCTCGATGCCGGCGAAGCATTGTTCCCACAGACCGTGTTTTCCGACCGAAATGGCTCC Overview of DNA to RNA to Protein • A gene is expressed in two steps – Transcription: RNA synthesis – Translation: Protein synthesis The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. RNA The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. RNA Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Codon 1 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Codon 1 Codon 2 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Codon 1 Codon 2 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Amino acid 1 Amino acid 2 The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Codon 1 Codon 2 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Amino acid 1 Amino acid 2 Protein! A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT A small change in the gene sequence can result in a very different protein DNA: ATG Amino Acids/Protein: Met GTG CTG TCT CCT A small change in the gene sequence can result in a very different protein DNA: ATG GTG Amino Acids/Protein: Met Val CTG TCT CCT A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG Amino Acids/Protein: Met Val Leu TCT CCT A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT Amino Acids/Protein: Met Val Leu Ser CCT A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT Amino Acids/Protein: Met Val Leu Ser CCT Pro A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT Amino Acids/Protein: Met Val Leu Ser CCT Pro A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro DNA: ATG GTG CTG TCT ACT A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro DNA: ATG GTG CTG TCT ACT Amino Acids/Protein: Met Val Leu Ser Thr A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro Words: Tom and Sam are bad DNA: ATG GTG CTG TCT ACT Amino Acids/Protein: Met Val Leu Ser Thr A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro Words: Tom and Sam are bad DNA: ATG GTG CTG TCT ACT Amino Acids/Protein: Met Val Leu Ser Thr Words: Tom and Sam are sad A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro Words: Tom and Sam are bad DNA: ATG GTG CTG TCT ACT Amino Acids/Protein: Met Val Leu Ser Thr Words: Tom and Sam are sad Changes in DNA are called variations or mutations Variations in the DNA (genotype) can cause observable changes (phenotype) in individuals Human Genome Research • Human Genome Project in 2003 •Finishing the euchromatic sequence of the human genome. •Nature 2004; 431 (7011): 931-945. • Phase I HapMap project in 2005 •A haplotype map of the human genome. •Nature 2005: 437(7063):1299-1320 • Encyclopedia of DNA Elements (ENCODE) project in 2007 •Identification and analysis of functional elements in 1% •of the human genome by the ENCODE pilot project. •Nature 2007; 447(7146):799-816 • 1000 Genomes Project in 2008 •DNA sequences. A plan to capture human diversity in 1000 genomes. •Science 2008; 319(5863):395 Genotypes and Human Disease Do all humans have the same DNA? • Single nucleotide polymorphisms or SNPs. • We can associate SNPs with medical histories of individuals and achieve statistically significant correlations. • Pharmacogenetics (PGx) is the science of how an individual’s genotype affects their body’s response to drugs. Variations in our DNA make us UNIQUE! Genomics in Drug Discovery Personalized Medicines Personalized medicine is the use of information from a patient's genotype to: • Initiate a preventative measure against the development of a disease or condition, or • Select the most appropriate therapy for a disease or condition that is particularly suited to that patient. Why does it matter? In treating all people with a certain lung cancer without having a genetic test , 10 % of people might respond. In treating people who have a genetic test and are found to have a tumour mutation , 85% of people treated for that mutation might respond. The best drug for a specific disease in a particular person. Is Personalized medicine only for sick people? Definitely not. Because an individual's genome influences his or her likelihood of developing (or not developing) a broad range of medical conditions, personalized medicine focuses strongly on wellness and disease prevention. If a person's genomic information indicates a higher-thanaverage risk of developing diabetes or a particular form of cancer, that person may choose a lifestyle, or sometimes be prescribed medications. Examples of SNPs Linked to Drug Response Case Study: Warfarin • Most widely prescribed oral anticoagulant for preventing thrombolytic events, despite its narrow therapeutic range. • Problematic dosing due to patient’s diet, age, and other medications. •CYP2D9/VKORC1 genes analysis predicts its prescription. (Mol Interv. 2006, 6(4): 223-277) Case Study: Irinotecan • Irinotecan is used as chemotherapeutic agent for the treatment of metastatic colorectal cancer. • It produces adverse drug reactions in some patients. • genotyping assay is carried out to mutations in UGT1A1 gene for irinotecan prescribing. (Personalized Medicine 2006, 3(4): 415-419) Case Study: Abacavir • Abacavir is a nucleoside analog reverse transcriptase inhibitor used to treat human immunodeficiency virus (HIV) . • Its main side effect is hypersensitivity reaction (HSR). • HSR is associated with ethnicity. A significantly increased risk of abacavir-induced HSR in human leukocyte antigen (HLA)B*57:01-carrying patients. Sci China Life Sci. 2013, 56(2):119-24 Interferon Therapy • Standard approved therapy for Hepatitis C • Differential response • Interleukin 28B gene (IL28B) variants which are associated with decreased HCV clearance • Interleukin 28B gene (IL28B) variants are considered as key players in deferential therapeutic responses. Malignant Melanoma 2007 Melanoma 2013 Targeting treatment to a specific variant in the Melanoma gene. Structure of Vemurafenib (marketed as Zelboraf) Beta-thalassemias (β-thalassemias) are a group of inherited blood disorders caused by problems in the production of hemoglobin, the oxygen-carrying protein in red blood cells. Cause is the mutations in beta-chain, 200 SNPs and several deletion 61 Hummmm…… 62 Genomics at International Center for Chemical and Biological Current Research Projects • Five human genome project • Integrated analysis of HCV genome and Exome of Hepatitis C patients to Study genetics of differential response to interferon therapy • Assessment of genetic factors for Ventricular Septal Defect • Genomics of Diabetic patients 74 Memorable Moments Red Fort (Lal Qila) Delhi India Education complex of Islamic era at Qutab complex Delhi Qutab Minar Delhi India