* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The Cell Cycle
DNA polymerase wikipedia , lookup
Polyadenylation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Human genome wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genetic code wikipedia , lookup
RNA silencing wikipedia , lookup
Messenger RNA wikipedia , lookup
Minimal genome wikipedia , lookup
Transfer RNA wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA vaccination wikipedia , lookup
Oncogenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Genome (book) wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genome evolution wikipedia , lookup
Genomic library wikipedia , lookup
Genetic engineering wikipedia , lookup
Molecular cloning wikipedia , lookup
History of RNA biology wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Genome editing wikipedia , lookup
Point mutation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Epitranscriptome wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
UNIT 5 Chapter 17: From Gene to Protein Chapter 18: Microbial Models Chapter 19: The Organization & Control of Eukaryotic Genomes Chapter 20: DNA Technology Introduction The Central Dogma is the molecular “chain of command” in a cell DNA RNA proteins Transcription: DNA used to make mRNA Translation: mRNA used to make protein/polypeptide Transcription: RNA Synthesis RNA polymerase uses a template strand of DNA to base pair with Transcription includes: initiation, elongation, termination Initiation: RNA polymerase identifies template strand by presence of promoter TATA box Transcription factors RNA polymerase base pairs RNA nucleotides with the template strand Uracil is used in RNA rather than thymine Elongation: double helix unwinds as RNA polymerase adds nucleotides New RNA “peels off” of the DNA as it reforms the helix A single gene can be transcribed by many RNA polymerase molecules at once Termination: elongation proceeds until a terminator is encountered Primary transcript is released In eukaryotes, the transcript is to be modified RNA Processing Before translation, the primary transcript undergoes processing 5’ cap: added to the 5’ end to prevent digestion by enzymes, also includes attachment site for ribosomes Poly-A tail: added to the 3’ end to prevent digestion by enzymes, also helps with exportation from nucleus RNA splicing: non-coding sequences, introns, are removed, leaving only exons Spliceosomes made up of snRNPs facilitate splicing of the exons Translation: Polypeptide Synthesis The newly created mRNA (messenger RNA) enters the cytoplasm and is attached to a ribosome Codons indicate which tRNA is complimentary tRNA (transfer RNA) carries amino acids to the ribosome Anti-codons correspond to codons Most codons correlate with a specific amino acid Genetic code is redundant but not ambiguous Start and stop codons The genetic code is very old and connects to our scientific understanding of evolution It is almost universal Foreign genes can be expressed by organisms There are 61 codons, but only 45 types of tRNA (anticodons) Base pairing rules are “relaxed” in the third position of the codon/anti-codon Called wobble: U can base pair with A or G The ribosome is the site of translation P site: holds tRNA with growing polypeptide A site: arrival site for next tRNA E site: site for discharging tRNAs Translation includes: initiation, elongation, termination Initiation and elongation require energy: GTP Initiation: brings together mRNA, first amino acid and two ribosomal subunits First – small ribosomal subunit locates and attaches at start codon Second – tRNA carrying appropriate anti-codon (and methionine) arrives and attaches to mRNA Third – large ribosomal subunit arrives and covers the tRNA at the P site (GTP required) Initiation is now complete P A E met UAC 5’ CGCCAUGCCUAGCACAUGACCUA 3’ Elongation: brings together remaining tRNAs in order First – the next tRNA will arrive and base pair with the codon at the A site Second – using GTP, a peptide bond is formed between the new amino acid and the growing polypeptide Third – using GTP, the mRNA and tRNA are moved in the 5’ 3’ direction exactly three nucleotides (translocation) P A E met met pro UACGGA 5’ CGCCAUGCCUAGCACAUGACCUA 3’ P A E met met pro pro UACGGA UACGGA GCCAUGCCUAGCACAUGACCUA 5’ CGCCAUGCCUAGCACAUGACCUA 3’ 3’ P A E met pro met pro ser GGAUCG GCCAUGCCUAGCACAUGACCUA 3’ Summary of elongation Termination: ribosome encounters a stop codon A release factor will base pair with the stop codon and hydrolyze the polypeptide from the last tRNA (Avg. protein translation: ~1 min) Ribosomes There are bound (on the rough endoplasmic reticulum) and free (in the cytoplasm) ribosomes Bound: used to make proteins that will be secreted from the cell Free: used to make proteins that will stay in the cytoplasm Same mRNA can be translated by multiple ribosomes – polyribosomes Prokaryotes Two major differences between eukaryotes and prokaryotes There is no RNA processing What is transcribed IS the mRNA Transcription and translation are coupled END Bacterial Genetic Material Bacteria possess a single chromosome Double-stranded, circular 4-6 million base pairs on average Some bacteria carry plasmids with “non-crucial” genes Separate from chromosome, also circular Variation in Bacterial Genetics Bacteria can acquire new genes by one of three methods: transformation, transduction, conjugation Transformation: bacteria take up foreign DNA and incorporate it into their chromosome Can also be plasmids Transduction: phages act as vectors for bacterial DNA Accidental and rare Conjugation: bacterial “sex” is the direct transfer of genetic material between two bacteria Requires an F factor (fertility) – gene that allows for construction of a sex pilus Hollow tube for transfer of plasmids Most common type of shared plasmids = antibiotic resistance Regulation of Bacterial Genes Bacteria have relatively simple control systems for their genes called operons Method for bacteria to turn on genes when needed and off when not Operons have three components: a promoter, an operator, the gene(s) it controls Promoter: site to which RNA poylmerase binds Operator: site to which repressor protein binds Repressor protein is always present in the cell The lac operon is an example found in E. coli Genes produce proteins/enzymes to digest lactose No lactose: Lactose: Lactose binds Repressor canto bind repressor, to operator changing its conformation so it cannot bind to operator Prevents RNA polymerase from transcribing genes lacZ, lacY, polymerase RNA lacA can transcribe genes lacZ, lacY, lacA and digest the lactose END Introduction • Eukaryotic DNA is much more complex than that of prokaryotes • Little is known about expression • Highly active area of research • Genome is typically larger • Cell specialization limits expression of genes • Human genome possesses ~20K to 30K genes • >97% of the genome is non-coding • DNA is associated with MANY proteins • Complex packaging can influence transcription • Loose packing = frequent transcription; tight packing = infrequent transcription Gene Expression Controls • Only a small portion of a multicellular organism’s DNA is actively transcribed in any given cell • Cellular differentiation makes long-term control necessary • 200 cell types, 1 genome • Many levels of control exist to regulate expression in eukaryotes Molecular Basis of Cancer • Oncogenes are cancer-causing genes • Arise from changes in a cell’s DNA (mutations) • Chemical agents (carcinogens) or physical mutagens can alter proto-oncogene function • Mutations in tumor-suppressor genes can also cause cancer • Control adhesion of cells, inhibit cell cycle, repair damaged DNA, initiate apoptosis • Example of proto-oncogene includes p53 • Mutations to gene occur in 50% of all cancers • Nicknamed the “guardian angel of the genome” • Damage to a cell’s DNA stimulates p53 expression • Acts as a transcription factor for several other genes • Activates p21 gene which halts cell cycle • Turns on genes involved in DNA repair • If damage is irreparable, it turns on “suicide genes” which causes cell death – apoptosis Development of Cancer • Usually, many mutations must occur for cancer to develop • Cancer is caused by the accumulation of mutations & mutations occur throughout life the longer we live, the more chance of cancer • Many malignant tumors have an active telomerase gene • Viruses (esp. retroviruses) account for 15% of cancers • They may donate oncogenes or disrupt tumorsuppressor genes or convert a proto-oncogene END Restriction Enzymes • In nature, bacteria use restriction enzymes to cut foreign DNA • Restriction enzymes cut DNA at specific sites • Enzymes identify a restriction site to cut at • Restriction sites usually occur at many places in a sequence of DNA • Restriction sites may occur at many locations, so the enzyme will make many cuts • Often times, a staggered cut is made, producing sticky ends that can base pair with its compliment DNA Cloning Vectors • Bacterial plasmids are used as cloning vectors • DNA molecule that carries foreign DNA into a cell • Bacteria can pass on their plasmids to daughter cells • Less complex than eukaryotes, reproduce faster • Cloning a human gene in bacteria steps • Isolation of vector and gene of interest • The vector is a plasmid • Plasmid engineered to carry a gene for resistance to an antibiotic • Insertion of gene of interest into vector • Restriction enzymes used on both plasmid and gene of interest to produce compatible sticky ends • Gene and plasmid fragments mixed and DNA ligase joins them together • Introduction of recombinant vector into cells • Bacteria are transformed by taking up plasmid • Both recombinant and non-recombinant bacteria are created • Cloning of cells (and gene of interest) • Bacteria are spread onto agar plates containing an antibiotic • Antibiotic ensures that only bacteria with the plasmid will grow • Transformed bacteria display “extra” trait Complimentary DNA - cDNA • RNA processing doesn’t occur in prokaryotes, so it can be difficult to get them to express eukaryotic DNA • A fully processed mRNA is needed since its lacking introns • mRNA acts as a template for making DNA • Reverse transcriptase used to make DNA from RNA • Reverse transcriptase isolated from retroviruses • Product is a cDNA molecule, DNA with no introns compatible with bacterial DNA • Creation of cDNA PCR • The Polymerase Chain Reaction (PCR) can be used to create billions of copies of a segment of DNA in a few hours • No cells are needed • Nucleotides, primers, DNA polymerase added into a test tube with our DNA to be copied • PCR • Special DNA Polymerase is used • Since 1985, PCR has had a huge impact on biotechnology and DNA from a variety of sources has been amplified • A 40,000 year old frozen wooly mammoth • TINY amounts of blood or semen (or other DNA evidence) from crime scenes • Embryonic cells for rapid diagnosis of genetic disorders • Viral genes from difficult-to-detect viruses like HIV END