* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA intro review - Ms Kim`s Biology Class
Epigenetics wikipedia , lookup
Genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetic clock wikipedia , lookup
DNA methylation wikipedia , lookup
DNA paternity testing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA barcoding wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Holliday junction wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Genomic library wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Microevolution wikipedia , lookup
Primary transcript wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA profiling wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microsatellite wikipedia , lookup
DNA polymerase wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Epigenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Name _______________________________ Date _______________________ Period ______________ DNA: The Molecule of Heredity 1. A nucleotide is made of three parts: a ___________________ group, a five carbon __________________, and a ___________________________________. 2. In a single strand of DNA, the phosphate group binds to the __________________ of the next group. 3. The 5' end of a single DNA strand contains a free __________________, while the 3' end contains a free _________ on ________________________________________________________. 4. Purines have _________ rings, and pyrimidines have ____________ ring. 5. What nitrogen bases are purines? 6. What nitrogen bases are pyrimidines? 7. Chargaff's rule states that the DNA of any species contains equal amounts of __________________ & ____________ and also equal amounts of __________________ & ____________________ 8. In DNA, thymine is complementary to ________________ ; cytosine is complementary to _____________ 9. In a strand of DNA, the percentage of thymine is 30 %. What is the percentage of cytosine in the same DNA strand? _________________ 10. On the diagram: Label the 3' and 5' ends. Circle a nucleotide. Label the sugar and phosphate. Label the bases that are not already labeled 11. The two sides of the DNA helix are held together by ________________________ 12. A and T are connected by ______ hydrogen bonds and C and G are connected by ______ hydrogen bonds. 13. What makes up the backbone of the DNA? 14. What type of bond does the phosphate group and the sugar have? What is this bond called? 15. Write out the complete name for DNA: __________________________________________ 16. Write the complementary strand nitrogen bases that match up with the following template strand: 5’ TTACAGGACTACCAATAGGAGTAACG 3’ 17. Name the scientist(s) responsible for each of the following discoveries. _____________________________________ Bacterial transformation _____________________________________ The base-pair rule _____________________________________ DNA was the hereditary material (DNA is the “transformation agent”) _____________________________________ The shape of DNA was a helix (x-ray) _____________________________________ The shape of DNA was a double helix 18. In your own words, explain why the discovery that DNA was the molecule of heredity was an important discovery. 19. Draw a nucleotide and label the following: -phosphate group (P) -deoxyribose sugar -nitrogen base (Base)