* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download genetics i - Indian School Al Wadi Al Kabir
Frameshift mutation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Holliday junction wikipedia , lookup
Genetic engineering wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Designer baby wikipedia , lookup
Genomic library wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Non-coding RNA wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Messenger RNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
History of RNA biology wikipedia , lookup
Expanded genetic code wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA polymerase wikipedia , lookup
Epitranscriptome wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Point mutation wikipedia , lookup
DNA replication wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Helitron (biology) wikipedia , lookup
INDIAN SCHOOL AL WADI AL KABIR DEPARTMENT OF SCIENCE WS: 5 Date: 21/05/16 BIOLOGY GENETICS-2 1. List the salient features of double helix structure of DNA. 2. (a) In the eukaryotes the DNA molecules are organized within the nucleus. How is the DNA molecule organized in a bacterial cell in absence of a nucleus? (b) Explain the packaging of DNA in eukaryotes. 3. Why is DNA considered a better hereditary material than RNA? 4. Answer the following based on Messelson and Stahl’s experiment a) Write the name of the chemical substance used as a source of nitrogen in this experiment b) Why did they synthesize the light heavy DNA molecules in their experiment? c) How did the scientists make it possible to distinguish the heavy from light? Explain d) Write the conclusion the scientists arrived after completing the experiment 5. In a series of experiments with Streptococcus and mice, F. Griffith concluded that R- strain bacteria had been transformed. Explain. 6. Draw a schematic representation of a dinucleotide. Label the following: i) The components of a nucleotide ii) 5’ end iii) N- glycosidic linkage iv) Phosphodiester linkage Page 1/2 7. (a) How many codons code for amino acids and how many do not? (b) Explain the following with example Unambiguous and specific codon Degenerate codon Universal Initiator codon 8. Describe the structure of a RNA polynucleotide chain having four different types of nucleotides. 9. How is hnRNA processed to form mRNA? 10. Explain the process of transcription in a bacterium. 11. (a) Name the enzyme that catalyzes the transcription of hnRNA. (b) Why does the hnRNA need to undergo changes? List the changes hnRNA undergoes and where in the cell such changes take place? 12. Name the different components present in deoxy-ribose nucleoside triphosphates. Give its two roles. 13.Correlate the codons of mRNA with amino acids of polypeptide translated. 5'AUGACCUUUCACUUCGUGUAA 3’------m RNA MET-THR-PHE-HIS-PHE-VAL------- polypeptide Infer any 3 properties of genetic code with examples from the above information 14. i) Why does DNA replication occur in small replication occur in small replication forks and not in its entire length? ii) Why is DNA replication continuous and discontinuous in a replication fork? iii) Explain the importance of ‘origin of replication’ in a fork? 15. (a) Draw a schematic representation of transcription unit showing the polarity of both the strands. Label the promoter gene and the template strand (b) Mention the condition when template strand becomes coding strand. (c) Give the function of the promoter gene Page 2/2 Prepared by, Rejitha Sajith