Download Plastid genes transcribed by the nucleus

Journal of Experimental Botany, Vol. 53, No. 379, pp. 2341±2349, December 2002
DOI: 10.1093/jxb/erf108
Plastid genes transcribed by the nucleus-encoded plastid
RNA polymerase show increased transcript accumulation
in transgenic plants expressing a chloroplast-localized
phage T7 RNA polymerase
Alan M. Magee and Tony A. Kavanagh1
Plant Molecular Biology Laboratory, Smur®t Institute of Genetics, Trinity College, Dublin 2, Ireland
Received 31 May 2002; Accepted 2 August 2002
Abstract
A gene fusion encoding a plastid-targeted bacteriophage T7 RNA polymerase (T7RNAP) under the
transcriptional control of the light-regulated promoter
and the plastid-targeting signals of a ribulose-bisphosphate carboxylase/oxygenase (Rubisco) small-subunit (SSU) gene was introduced into the nuclear
genome of Nicotiana tabacum (tobacco). Immunoblot
analysis, in vitro transcription assays and protease
treatment of isolated chloroplasts revealed that
T7RNAP activity was localized within chloroplasts.
RNA gel blot analyses showed a substantial increase
in transcript abundance for several plastid genes that
are normally transcribed by the nucleus-encoded
plastid RNA polymerase (NEP) including rpoC1,
rpl33, rps18, rps12, and clpP. By contrast, no signi®cant changes were observed in the levels of psbD,
16SrDNA, and ndhA transcripts. These results suggest a possible direct or indirect T7RNAP-mediated
enhancement of transcription of a subset of plastid
genes that contain NEP promoters. Despite these
alterations in plastid transcript levels, the plants
showed no visible abberant phenotype.
Key words: Chloroplast, NEP, PEP, plastid transcripts, T7
RNA polymerase.
Introduction
The plastid genome of higher plants contains approximately 120 genes that primarily encode components of the
plastid genetic system and the photosynthetic apparatus.
1
Most plastid genes are organized into operons that are
transcribed by at least two distinct RNA polymerase
activities: the plastid-encoded plastid RNA polymerase
(PEP) and NEP.
PEP is a multisubunit eubacterial-like RNA polymerase
whose core subunits are encoded by the plastid rpoA, rpoB,
rpoC1, and rpoC2 genes. It is responsible for the
transcription of the photosynthesis genes and is the
predominant transcriptional activity found in mature
chloroplasts. PEP recognizes E. coli s70-type promoters
containing TTGACA (±35) and TATAAT (±10) consensus
elements, which are found upstream of most plastid
transcription units. The recent identi®cation of nuclear
genes encoding plastid-targeted sigma-like factors (SLFs)
in Arabidopsis thaliana (Tanaka et al., 1997; Isono et al.,
1997; Kanamura et al., 1999) and in a number of other
higher plants (reviewed in Allison, 2000) suggests that
promoter selection by PEP is controlled in a manner
similar to that of the RNA polymerase of Escherichia coli.
The differential expression patterns of genes coding for
SLFs in tobacco (Oikawa et al., 2000) and maize
(Sushmita et al., 2000) is indicative of their importance
in regulating PEP-mediated gene expression.
The existence of NEP was established by the detection
of transcription from non-PEP-type promoters in DrpoB
plants (non-photosynthetic plants containing a plastid rpoB
deletion) (Allison et al., 1996), non-photosynthetic
tobacco suspension cultures (Vera and Sugiura, 1995)
and the non-green tissues of the barley albostrians (Hess
et al., 1993) and maize iojap (Han et al., 1993) mutants, all
of which lack PEP activity. The cloning and sequencing of
nuclear genes from A. thaliana (Hedtke et al., 1997), maize
(Chang et al., 1999), and wheat (Ikeda and Gray, 1999)
To whom correspondence should be addressed. Fax: +353 1 6798558. E-mail: [email protected]
ã Society for Experimental Biology 2002
2342 Magee and Kavanagh
encoding a plastid-targeted RNA polymerase has established that NEP is a single subunit enzyme sharing
homology with the RNA polymerases of phage T3 and
T7. Signi®cant conservation of functional domains and
important catalytic residues between T7RNAP and the
maize NEP has been described (Chang et al., 1999).
Moreover, NEP but not PEP has been shown to be capable
of initiating transcription in vitro from a phage T7
promoter fragment and antibodies that recognize and
inhibit NEP activity also recognize and inhibit T7RNAP
(Bligny et al., 2000).
Transcriptional patterns and transcript mapping in
PEP-de®cient plants has revealed that plastid genes and
operons can be assigned to three classes, those that
contain (1) PEP promoters only, (2) both PEP and
NEP promoters and (3) NEP promoters only. These
studies have revealed that the photosystem genes are
transcribed from PEP promoters and that genetic
system genes are transcribed from both PEP and
NEP promoters. This has led to the proposal that
NEP is primarily responsible for the initiation and
maintenance of the genetic system during plastid
development (and in non-green tissues), and is largely
replaced by PEP in mature chloroplasts. NEP, nevertheless, plays a crucial role in chloroplasts because it is
exclusively responsible for transcription of the rpoB
operon (Hess et al., 1993; Silhavy and Maliga, 1998)
and accD (Hajdukiewicz et al., 1997). Thus, NEP
ultimately controls the production of PEP and, in
consequence, other components required for normal
plastid functions.
Sequence alignments around NEP transcription initiation sites (Hajdukiewicz et al., 1997; HuÈbschmann and
Borner, 1998) have identi®ed conserved elements in NEP
promoters and their functionality has been con®rmed by
assaying NEP promoter mutants in NEP-containing in vitro
transcription reactions (Liere and Maliga, 1999; Kapoor
and Sugiura, 1999). NEP promoters consist of a conserved
sequence block of about 15 nucleotides that contains a
critical YRT motif located just upstream of the transcription initiation site. In addition, many NEP promoters
contain a second conserved element of about 10 nucleotides located 10±20 nucleotides upstream of the YRT box.
Non-consensus (exceptional) NEP promoters have also
been identi®ed, for example, associated with clpP in
tobacco (Sriraman et al., 1998) and the ribosomal RNA
operon (rrn) in spinach (reviewed in Lerbs-Mache, 2000).
It is possible that these promoters require speci®c activating factors or they may be recognized by a second NEP
activity. Evidence for the existence of an additional NEP
activity derives from the isolation of functionally distinct
NEP activities in spinach chloroplasts (Bligny et al., 2000)
and the identi®cation of two genes coding for plastidtargeted NEP-like isozymes in A. thaliana (Hedtke et al.,
2000).
There is increasing biotechnological interest in developing strategies to direct high-level speci®c expression of
transgenes within plastids. One such strategy involves
placing the transgene under the transcriptional control of a
non-plastid (e.g. phage) promoter and its cognate RNA
polymerase. For example, constitutive expression of a
nucleus-encoded, plastid-targeted T7RNAP has been
reported to direct the speci®c expression of a T7
promoter±GUS transgene located in the tobacco plastid
genome (McBride et al., 1994). However, it was not
determined whether the accumulation of T7RNAP, a NEPlike RNA polymerase, within plastids affected transcription of the native plastid genes. Given the similarities
between NEP and T7RNAP (discussed above), the possibility of transcriptional interference as a direct or indirect
consequence of the presence of T7RNAP within plastids
merits investigation.
In the present report, the aim was to determine whether
the accumulation of T7RNAP in chloroplasts affected
wild-type patterns of plastid gene transcription. Transgenic
tobacco plants were generated which expressed a chimeric
gene coding for a plastid-targeted T7RNAP under the
control of a light-regulated promoter (hereafter referred to
as SSU-T7 plants). RNA transcript levels were then
compared for a number of genetic system genes (rpoC1,
16S rDNA, rpl33, rps18, and rps12), a photosystem gene
(psbD) and the gene encoding the proteolytic subunit of the
Clp ATP-dependent protease (clpP) in wild-type and SSUT7 plants.
Fully expanded leaves of SSU-T7 plants contained
increased levels of RNA transcripts for rpoC1, rpl33,
rps18, rps12, and clpP when compared with wild-type
plants whereas transcript levels for psbD, 16S rDNA and
ndhA were largely unchanged. All of the genes showing
increased transcript levels contain NEP promoters, suggesting that increased accumulation of transcripts was
caused either by T7RNAP-mediated transcription from
NEP promoters or by increased NEP activity in SSU-T7
plants.
Materials and methods
Plasmid construction
The Agrobacterium tumefaciens binary vector pBinTGS25 which
contains the SSU-T7 RNA polymerase translational fusion was
constructed as follows. The SSU promoter and adjacent sequences
encoding the transit peptide and 25 amino acids of the mature SSU
(Mazur and Chui, 1985) was excised as a HindIII/MfeI restriction
fragment from plasmid pCAR2 (unpublished plasmid) and ligated
into the HindIII/EcoRI digested plasmid pAR3132 (Dunn et al.,
1988). This resulted in the creation of an in-frame fusion of codon 25
of mature SSU with codon 11 of the T7RNAP gene. This gene fusion
(ST25) was excised as a HindIII/BamHI fragment and ligated
upstream of the nopaline synthase (nos) terminator region (Jefferson
et al., 1987) in plasmid pRok2, a derivative of plasmid pBin19
(Bevan, 1984).
Plastid transcripts in tobacco 2343
A GUS expression cassette was cloned downstream of the ST25
gene fusion in pBinTGS25 and was constructed as follows. The
CaMV 35S promoter (Odell et al., 1985) was excised by EcoRI/
BamHI digestion from plasmid pRok1 (Baulcombe et al., 1986) and
was ligated with a BamHI/EcoRI restriction fragment containing the
GUS gene (uidA locus of E. coli) and the nos terminator. Both
fragments were ligated into the EcoRI site immediately downstream
of ST25 to give pBinTGS25.
Transformation of tobacco
Nuclear transformation was carried out by cocultivation of wounded
tobacco leaf tissue with A. tumefaciens LBA4404 and the regeneration of kanamycin-resistant plants as described by Horsch et al.
(1985).
RNA gel-blot analyses
Total leaf RNA was prepared from fully expanded leaves using the
method described by Kristel et al. (1996) except that liquid nitrogen
was used for sample homogenization. RNA was electrophoresed on
1% agarose±formaldehyde gels and blotted onto Hybond-N membranes (Amersham) by capillary transfer (Sambrook et al., 1989).
Double-stranded DNA probes were prepared by random-primed 32Plabelling of PCR-generated fragments. The sequence of the PCR
primers and their positions in tobacco plastid DNA (Shinozaki et al.,
1986) are shown in Table 1.
RNA gel-blot hybridizations with 32P-labelled probes and subsequent membrane washing was carried out as described in Maniatis
et al. (1982). Signal detection was carried out by autoradiography
using X-ray ®lm (AGFA) and Hyperscreen intensifying screens
(Amersham).
In vitro T7RNAP transcription assay
T7RNAP activity was assayed by the incorporation of [a-32P]
UTP (Amersham) into phage T7 DNA transcripts from 5 ml of
total leaf or puri®ed chloroplast proteins. Reactions were carried
out in 30 ml ®nal volume transcription assay mixture (40 mM
TRIS±HCl, pH 8, 6 mM MgCl2, 10 mM dithiothreitol, 2 mM
spermidine. 0.2 mM A/C/GTP, 0.1 mM UTP, and 1 mCi of [a32
P] UTP) that was incubated at 37 °C for 30 min. Bovine
serum albumin (0.5 mg ml±1) and tRNA (1 mg ml±1) was added
and transcripts were precipitated by the addition of trichloroacetic acid (10%) and incubation on ice for 30 min. Transcripts
were recovered by microfugation and count per minute (cpm)
values were determined for the radioactive pellet using the
Packard Tri-CarbR 1500 liquid scintillation analyser.
Protein preparation and quantitation
Total soluble leaf and root proteins were prepared by homogenization of tissue in 50 mM sodium phosphate, pH 7, 10 mM bmercaptoethanol, and 1% Triton X-100 with a mortar and pestle in a
2:1 buffer to tissue ratio. Following a brief centrifugation protein
concentration was determined using the Bradford assay (Bradford,
1976).
Immunoblotting
Proteins were resolved in 6.75% denaturing sodium dodecyl
sulphate polyacrylamide gel electrophoresis (SDS±PAGE) as
described by Sambrook et al. (1989). Protein samples were prepared
for SDS±PAGE as described by Laemmli (1970). Protein was
transferred to nitrocellulose membranes (Schleicher & Schuell) in a
BioRad TransblotÔ apparatus at 120 mA overnight. The membrane
was blocked with non-fat dried milk and incubated with polyclonal
anti-T7RNAP antibodies. Signal detection was carried out by
chemiluminescence using 5-bromo-4-chloro-3-indolyl phosphate
(40 mg ml±1) and nitro blue tetrazolium (80 mg ml±1).
Chloroplast isolation
Green leaves (2±3 g) were gently disrupted by a few short bursts
using a Moulinex blender in ice-cold GR buffer as described by
Bartlett et al. (1982). The homogenate was ®ltered through two
layers of miracloth and centrifuged at 1500 rpm for 10 min at 4 °C.
Crude chloroplast pellets were resuspended in 2 ml of GR buffer and
intact chloroplasts were isolated by sedimentation in Percoll density
gradients (Bartlett et al., 1982). Intact chloroplasts were washed free
of Percoll and resuspended in 330 mM sorbitol, 50 mM HEPES, pH
7.5 (SH buffer) at a chlorophyll concentration of 0.5 mg ml±1.
Chlorophyll concentration was determined as described by Arnon
(1949).
Protease protection experiments
Intact chloroplasts were incubated on ice for 30 min with
thermolysin protease Type X (Sigma) at a concentration of 250 mg
thermolysin mg±1 of chlorophyll. Intact chloroplasts were lysed by
the addition of Triton X-100 to 0.1%. Thermolysin activity was
inhibited by the addition of EGTA (ethylene glycol-bis(baminoethyl ether) N,N,N¢,N¢-tetraacetic acid (Sigma)) to a ®nal
concentration of 20 mM.
Table 1. The sequence of the PCR primers and their positions in tobacco plastid DNA (Shinozaki et al., 1986)
C denotes that the identifying nucleotide is complementary to the nucleotide at that position in plastid DNA.
Gene
Plastid genome location
Primer sequence
rpoC1
22028
22549(C)
70339
70998(C)
100088/142424(C)
100647(C)/141649
73086
3665(C)
34463
35072(C)
103121/139430(C)
103750(C)/138779
122101
122800(C)
GGTACATGAACAGCCATTTG
ATTAGTACAAGAAGCCGTGG
TGTGTCTTACCCTTTCAAGG
AATGAACTCCGGGAAGGTAGAGTAG
GGTGGATCTCGAAAGATATG
GTAAAGGATCGTCAACAAGG
GTTAAGAACTCTCCGGCATG
CGCATGTACGGTTCCTAAGG
TGACTATAGCCCTTGGTAAG
CCGGCAACTCCCATCATATG
GCAATGCCGCGTGGAGGTAG
GTGTCCGCGTGCCCGAAGGC
CGCTTCCACTATATCAACTG
ATCAAGAAGTACTCCCCATG
rpl33/rps18
3¢-rps12
clpP
psbD
16S rDNA
ndhA
2344 Magee and Kavanagh
Fig. 1. Structure of the ST25 and linked GUS transgenes. (A)
Diagram showing the ST25 (SSU-T7RNAP gene fusion) and the linked
GUS expression cassettes in the binary transformation vector
pBinTGS25. The ST25 transgene was placed under the transcriptional
control of the light-inducible SSU promoter while GUS expression was
under the control of the constitutive CaMV 35S promoter. Both
cassettes contain the nos transcriptional terminator. (B) Nucleotide and
deduced amino acid sequence at the SSU±T7RNAP junction. Codon
25 of mature SSU sequence was fused in-frame with codon 11 of
T7RNAP.
Results
Generation and analysis of transgenic tobacco lines
expressing a plastid-targeted T7RNAP (SSU-T7
plants)
In order to generate transgenic plants with the potential
to express T7 promoter-controlled transgenes located
on the chloroplast genome, N. tabacum was transformed with a nuclear transgene coding for a plastidtargeted T7RNAP. To achieve this, a binary vector,
pBinTGS25, was constructed which contained a gene
fusion (ST25) consisting of the SSU promoter and
adjacent sequences encoding the transit peptide and the
N-terminal 25 amino acids of the mature SSU protein,
fused in-frame with the gene coding for T7RNAP
(Fig. 1). The SSU promoter was chosen to control
ST25 expression in order speci®cally to direct highlevel expression in green tissues (Jefferson et al., 1987)
and, therefore, avoid the potentially deleterious effects
of constitutive expression of T7RNAP during embryo
and seed development. The SSU transit peptide has
been shown to confer ef®cient accumulation of fusion
proteins in plastids (Comai et al., 1988).
In addition, pBinTGS25 contained the GUS gene cloned
downstream of ST25, and placed under the control of the
constitutive CaMV 35S promoter and the nos terminator
region. Kanamycin-resistant SSU-T7 plant lines were
regenerated following A. tumefaciens-mediated transformation. GUS expression was used as a simple biochemical
marker of transformation and was used to follow the
segregation of ST25 in the progeny of transgenic plants
(results not shown). Plant lines segregating 3:1 for the
Fig. 2. Expression and chloroplast localization of the ST25 fusion
protein in SSU-T7 plants. (A) Detection of ST25 in total soluble leaf
protein extracts from SSU-T7 plant lines (Nos 19, 20, 35, 33, 29, 27,
23, and 15) by immunoblotting with anti-T7 RNA polymerase
antibodies. Each lane contained approximately 50 mg of total leaf
protein. T7 denotes 10 units of puri®ed commercial T7 RNA
polymerase. Wt denotes wild-type plants. (B) Detection of ST25 in
leaf tissue (L), but not in roots (R), of an SSU-T7 plant. Each lane
contained approximately 20 mg of total leaf and root protein,
respectively. (C) Chloroplast localization of the ST25 fusion protein.
ST25 detection in total soluble leaf protein (L), and isolated
chloroplasts that were either untreated (UN), or treated with
thermolysin (T), or lysed with Triton X-100 followed by thermolysin
treatment (TT) (upper panel). The level of Rubisco-LSU in each
sample was determined by staining a duplicate protein gel with
Coomassie Blue (bottom panel).
kanamycin resistance gene (and presumably the linked
ST25 gene) were identi®ed by germinating seeds from selfpollinated primary transformants in the presence of
kanamycin.
The ST25 fusion protein shows leaf-speci®c
expression and accumulation in chloroplasts
ST25 expression was detected by immunoblot analysis of
total leaf protein preparations from SSU-T7 plants using
anti-T7RNAP antibodies (Fig. 2A). ST25 was detected as a
single band with the expected molecular mass of about 100
kDa which was absent in wild-type plants. As expected for
nuclear transformed plants, the levels of ST25 varied
between SSU-T7 lines, with some plants containing barely
detectable levels while others contained levels several-fold
higher than the level corresponding to 10 units of puri®ed
commercial T7RNAP that was loaded as a positive control.
Leaf-speci®c expression was demonstrated by showing
Plastid transcripts in tobacco 2345
ef®ciency with which ST25 is targeted into chloroplasts
was obtained by comparing the levels of ST25 in a total
leaf protein extract and in intact chloroplasts. Since each of
the protein samples analysed contained similar levels of
ST25 and similar levels of the Rubisco large subunit
(LSU), a marker of chloroplast stromal protein content, it
can be concluded that ST25 is ef®ciently targeted to
chloroplasts in SSU-T7 plants (Fig. 2C).
Plants expressing the ST25 fusion protein possess a
very stable T7RNAP activity
Fig. 3. Expression and stability of T7RNAP activity in SSU-T7
plants. (A) T7RNAP activity was determined in units mg±1 of total
soluble leaf protein in a single plant from each of seven SSU-T7
transgenic lines (Nos 15, 23, 24, 28, 29, 33, and 35). Wt denotes wildtype non-transgenic plant. One unit of T7RNAP is the enzyme activity
that incorporates 1 nmol of UMP into acid-precipitable RNA products
in 60 min at 37 °C. Unit values for T7RNAP activity in SSU-T7
plants were derived by comparison with a puri®ed commercial
enzyme preparation. (B) Stability of T7RNAP activity in vivo. SSU-T7
seedlings were placed in total darkness and T7RNAP activity was
determined at ®ve time points: days 0, 1, 5, 9, and 16 following exposure
to total darkness. The activity present at day 0 was set at 100%.
that ST25 was not detected in a total root protein extract
from a high expressing line (Fig. 2B).
In order to determine the subcellular location of ST25 in
the leaves of SSU-T7 plants, puri®ed intact chloroplasts
were isolated, treated with the protease thermolysin which
degrades externally-associated proteins and analysed for
the presence of ST25 by immunoblotting (Fig. 2C). ST25
was shown to be protected from proteolysis in thermolysin-treated intact chloroplasts, but was degraded when
chloroplast membranes were disrupted with Triton X-100
prior to the thermolysin treatment. An estimate of the
Following translocation into chloroplasts, the ST25 fusion
protein is predicted to comprise T7RNAP with an
N-terminal extension consisting of the ®rst 25 amino
acids of the mature form of SSU. For this reason, it was
necessary to demonstrate that ST25 retained enzymatic
activity. In order to test this, total leaf protein extracts from
a number of SSU-T7 plants were analysed for T7RNAP
activity using an in vitro transcription system and phage T7
DNA as template. The template speci®city of the in vitro
transcription system was demonstrated by showing that
transcription was observed only when phage T7 DNA was
included in the in vitro transcription assays; transcription
was not observed either in the absence of T7 DNA or when
phage lambda DNA was used as a substitute template
(results not shown). Using this system, T7RNAP activity
was shown to be present in the leaves of seven SSU-T7
plant lines whereas wild-type plant leaves contained
negligible activity (Fig. 3A). The activity values for the
group of plants analysed ranged between 0.4 and 1.4 units
mg±1 of total leaf protein. In addition, it was shown that the
T7RNAP activity, like the ST25 fusion protein, was
localized within chloroplasts by performing in vitro transcription assays on isolated intact chloroplasts that had
been treated with thermolysin (data not shown).
Transcription directed by the SSU promoter is rapidly
down-regulated when plants are placed in continuous
darkness (Giuliano et al., 1988; Fritz et al., 1991). On the
assumption that this would prevent further ST25 transgene
expression, an estimate of the stability of the ST25 fusion
protein in vivo can be obtained by transferring SSU-T7
seedlings to total darkness and monitoring the decline in
T7RNAP activity levels over time. ST25 was found to be
very stable in vivo. Indeed after 16 d in total darkness,
SSU-T7 seedlings still retained approximately 50% of the
T7RNAP activity present on day zero (Fig. 3B).
SSU-T7 plants show increased accumulation of
transcripts from genes containing NEP promoters
In order to investigate the potential transcriptional consequences of T7RNAP accumulation within chloroplasts,
transcript levels for several plastid genes were examined
by RNA gel-blot analysis of total leaf RNA extracted from
an SSU-T7 plant expressing a high level of T7 RNAP
activity (Fig. 4). Two groups of plastid genes were
2346 Magee and Kavanagh
Fig. 4. RNA gel-blot analysis of chloroplast mRNA levels in the leaves of wild-type and an SSU-T7 plant expressing a high level of T7 RNAP
activity. Equal quantities of total leaf RNA from wild-type (wt) and the SSU-T7 plant (T7) were analysed by denaturing gel electrophoresis. The
ethidium bromide-stained gel images are shown for each pair of samples (bottom panels). RNA blots were hybridized with the various named
plastid gene probes and the hybridizing bands detected by autoradiography (upper panels). (A) Plastid genes showing increased mRNA levels in
SSU-T7 plants. Size markers are given in kb. (B) Plastid genes showing approximately equivalent mRNA levels in the leaves of wild-type and
SSU-T7 plants.
identi®ed based on a comparison of transcript levels in
fully expanded leaves of wild-type and SSU-T7 plants.
Group I included plastid genes whose transcripts showed
signi®cantly higher levels of accumulation in SSU-T7
plants relative to wild-type plants (Fig. 4A). Genes
belonging to this group include rpoC1 which codes for
the b¢ subunit of PEP (Shinozaki et al., 1986), rpl33, rps18
and rps12 which encode plastid ribosomal proteins
(Shinozaki et al., 1986), and clpP which encodes the
proteolytic subunit of the ClpP ATP-dependent protease
(Gray et al., 1990; Maurizi et al., 1990). Group II included
plastid genes for which similar transcript levels accumulated in both wild-type and SSU-T7 plants (Fig. 4B). This
group included psbD which encodes the D2 subunit of
photosystem II (Shinozaki et al., 1986), 16S rDNA
encoding the plastid 16S rRNA (Shinozaki et al., 1986),
and ndhA which codes for a subunit of the plastid NADH
dehydrogenase complex (Matsubayashi et al., 1987).
The complex polycistronic mRNA patterns typical of
most plastid genes was essentially the same in wild-type
and SSU-T7 plants despite the considerable increase in
transcript levels for group I genes in SSU-T7 plants. One
exception to this observation relates to the third smallest
transcript (approximately 1.6 kb in size) detected in RNA
samples hybridized with the 3¢-rps12 probe (Fig. 4A). The
SSU-T7 sample showed a disproportionate increase in the
level of this transcript relative to other transcripts. This
may have been caused by unequal levels of T7RNAPmediated transcription of the rps12 `split gene' or by
increased stability of this transcript in the presence of
T7RNAP.
Discussion
The elimination of PEP activity in DrpoB plants revealed
that NEP is responsible for the transcription of genetic
Plastid transcripts in tobacco 2347
system genes and some other genes (e.g. clpP), but not the
photosystem genes (Allison et al., 1996; Hajdukiewicz
et al., 1997). In DrpoB plants, mRNAs from PEPtranscribed genes were absent whereas mRNAs from
NEP-transcribed genes showed increased accumulation
relative to the levels found in wild-type plants. Promoter
mapping studies revealed that genes which contained both
PEP and NEP promoters were transcribed from PEP
promoters in wild-type plants, but from NEP promoters in
DrpoB plants. For this reason it was proposed that the
absence of PEP may have initiated a feedback mechanism
resulting in increased NEP activity and, consequently, an
increase in the abundance of transcripts from genes
containing NEP promoters (Hajdukiewicz et al., 1997).
In the present study, transgenic plants were produced
that accumulate high levels of T7RNAP activity in
chloroplasts. These plants show a T7RNAP-dependent
increase in the steady-state mRNA levels for genes that are
transcribed by NEP. The plastid genes surveyed were
representative of the three classes of plastid genes, i.e.
genes transcribed from PEP promoters (psbD and ndhA),
from both PEP and NEP promoters (16S rDNA, rpl33,
rps18, rps12, and clpP) and from NEP promoters alone
(rpoC1). Of these increased transcript abundance was
found for rpoC1, rpl33, rps18, rps12, and clpP (designated
group I genes) in SSU-T7 plants whereas transcript levels
for psbD, 16S rDNA and ndhA (designated group II genes)
were largely unchanged. Of the group II genes, psbD and
ndhA are transcribed exclusively by PEP while the 16S
rDNA is transcribed by both PEP and NEP. This suggests
that the observed increase in transcript accumulation in the
plastids of SSU-T7 plants is speci®c for genes that contain
NEP promoters.
However, although the tobacco rrn operon contains both
a NEP and a PEP promoter (Vera and Sugiura, 1995) there
was no apparent increase in 16S rRNA levels in SSU-T7
plants. Indeed DrpoB plants were reported to accumulate
reduced levels of 16S rRNA relative to wild-type plants
despite the ®nding that two other NEP-transcribed genes
analysed (rpl16 and atpI) showed increased transcript
levels (Allison et al., 1996). It was proposed that the
reduction in 16S rRNA levels in DrpoB plants, despite the
presence of a NEP promoter, was caused by the inability of
NEP to replace the very high levels of 16S rRNA
transcribed predominantly by PEP in the chloroplasts of
wild-type plants. In the case of SSU-T7 plants, any
increase in 16S rRNA transcript levels may have been too
small to be detectable relative to the very high background
levels of this transcript.
Several hypotheses may be advanced to explain the
increased abundance of particular plastid mRNAs in SSUT7 plants. One possibility is that the increases are due to
T7RNAP-mediated transcription from NEP promoters.
This hypothesis is supported by the following observations
(a) T7RNAP shares substantial homology with NEP
(Chang et al., 1999), (b) T7RNAP activity is inhibited by
anti-NEP antibodies (Bligny et al., 2000) and (c) NEP can
initiate transcription from a T7 promoter at least in vitro
(Bligny et al., 2000). It therefore seems reasonable to
speculate that T7RNAP might also be capable of directing
transcription from NEP promoters despite the high
sequence speci®city shown by T7RNAP for its cognate
phage promoters and the fact that the speci®c amino acid
residues which confer promoter recognition in T7RNAP
(Rong et al., 1998) are not conserved in the maize NEP
enzyme (Chang et al., 1999). It may also be possible that
recognition of NEP promoters by T7RNAP is facilitated by
transcription factors present in chloroplasts. Alternatively,
the presence of T7RNAP activity in chloroplasts may have
triggered a feedback mechanism resulting in increased
NEP activity as proposed for DrpoB plants (Allison et al.,
1996) and recently supported by the observation of a more
than 2-fold increase in transcripts of one of the tobacco
NEP genes (RpoT3) in DrpoA plants (Hedtke et al., 2002).
Increased levels of NEP activity in plastids might, in
consequence, result in increased transcription of genes
containing NEP promoters. Finally, the possibility cannot
be ruled out that the observed increases in transcript
abundance might also be the result of increased mRNA
stability in SSU-T7 plants, although it is dif®cult to
account for a mechanism that would confer increased
stability on a speci®c subset of plastid transcripts.
SSU-T7 plants containing high levels of T7RNAP
activity showed no visible aberrant phenotype, despite
the increased levels of some plastid transcripts. This may
be due to the fact that T7RNAP expression was restricted
to green tissues in SSU-T7 plants. Furthermore, because of
the importance of post-transcriptional processes in determining plastid gene expression levels, increased transcript
accumulation does not necessarily result in altered levels
of the encoded proteins.
Acknowledgements
We thank Paul Fisher for the gift of rabbit anti-T7 RNA polymerase
polyclonal antibodies. We thank John Gray for valuable comments
relating to this work. This work was supported by Enterprise Ireland
Grant SC/2001/426.
References
Allison L. 2000. The role of sigma factors in chloroplast
transcription. Biochimie 82, 537±548.
Allison L, Simon L, Maliga P. 1996. Deletion of rpoB reveals a
second distinct transcription system in plastids of higher plants.
EMBO Journal 15, 2802±2809.
Arnon D. 1949. Copper enzymes in isolated chloroplasts.
Polyphenoloxidase in Beta vulgaris. Plant Physiology 41, 1±14.
Bartlett S, Grossman A, Chua N-H. 1982. In vitro synthesis and
uptake of cytoplasmically-synthesized chloroplast proteins. In:
Hallick RB, Chua N-H, eds. Methods in chloroplast molecular
biology. New York: Elsevier Press, 1081±1091.
2348 Magee and Kavanagh
Baulcombe D, Saunders G, Bevan M, Mayo M, Harrison B.
1986. Expression of a biologically active viral satellite RNA from
the nuclear genome of transformed plants. Nature 321, 446±449.
Bevan M. 1984. Binary Agrobacterium vectors for plant
transformation. Nucleic Acids Research 12, 8711±8721.
Bligny M, Courtois F, Thaminy S, Chang C-C, Lagrange T,
Baruah-Wolff J, Stern D, Lerbs-Mache S. 2000. Regulation of
plastid rDNA transcription by interaction of CDF2 with two
different RNA polymerases. EMBO Journal 19, 1851±1860.
Bradford M. 1976. A rapid and sensitive method for the
quantitation of microgram quantities of protein using the
principle of protein±dye binding. Analytical Biochemisty 72,
248±254.
Chang C-C, Sheen J, Blingy M, Niwa Y, Lerbs-Mache S, Stern
D. 1999. Functional analysis of two maize cDNAs encoding T7like RNA polymerases. The Plant Cell. 11, 911±926.
Comai L, Larson-Kelly N, Kiser J, Mau C, Pokalsky A,
Shewmaker C, McBride K, Jones A, Stalker D. 1988.
Chloroplast transport of a ribulose bisphosphate carboxylase
small subunit-5-enolpyruvyl 3-phosphoshikimate synthase
chimeric protein requires part of the mature small subunit in
addition to the transit peptide. Journal of Biological Chemistry
263, 15104±15109.
Dunn J, Krippl B, Bernstein K, Westphal H, Studier F. 1988.
Targeting bacteriophage T7 RNA polymerase to the mammalian
cell nucleus. Gene 68, 259±266.
Fritz C, Herget T, Wolter F, Schell J, Schreier P. 1991. Reduced
steady-state levels of rbcS mRNA in plants kept in the dark are
due to differential degradation. Proceedings of the National
Academy of Sciences, USA 88, 4458±4462.
Giuliano G, Hoffman N, Ko K, Scolnik P, Cashmore A. 1988. A
light-entrained circadian clock controls transcription of several
plant genes. EMBO Journal 7, 3635±3642.
Gray J, Hird S, Dyer T. 1990. Nucleotide sequence of a wheat
chloroplast gene encoding the proteolytic subunit of an ATPdependent protease. Plant Molecular Biology 15, 947±950.
Hajdukiewicz P, Allison L, Maliga P. 1997. The two RNA
polymerases encoded by the nuclear and plastid compartments
transcribe distinct groups of genes in the tobacco plastids. EMBO
Journal 13, 4041±4048.
Han C, Patrie W, Polacco M, Coe E. 1993. Aberrations in plastid
transcripts and de®ciency of plastid DNA in striped and albino
mutants in maize. Planta 191, 552±563.
Hedtke B, BoÈrner T, Weihe A. 1997. Mitochondrial and
chloroplast phage-type RNA polymerases in Arabidopsis.
Science 277, 809±811.
Hedtke B, Borner T, Weihe A. 2000. One RNA polymerase
serving two genomes. EMBO Reports 1, 435±440.
Hedtke B, Legen J, Weihe A, Herrmann R, Borner T. 2002. Six
active phage-type RNA polymerase genes in Nicotiana tabacum.
The Plant Journal 30, 625±637.
Hess W, Prombona A, Fieder B, Subramanian A, BoÈrner T.
1993. Chloroplast rps15 and the rpoB/C1/C2 gene cluster are
strongly transcribed in ribosome-de®cient plastids: evidence for a
functioning non-chloroplast-encoded RNA polymerase. EMBO
Journal 12, 563±571.
Horsch R, Fry J, Hoffman N, Eichholtz D, Rogers S, Fraley R.
1985. A simple and general method for transferring genes into
plants. Science 227, 1229±1231.
HuÈbschmann T, BoÈrner T. 1998. Characterization of transcript
initiation sites in ribosome-de®cient barley plastids. Plant
Molecular Biology 36, 493±496.
Ikeda T, Gray M. 1999. Identi®cation and characterization of T3/
T7 bacteriophage-like RNA polymerase sequences in wheat.
Plant Molecular Biology 40, 567±578.
Isono K, Shimizu M, Yoshimoto K, Niwa Y, Satoh K, Yokota A,
Kobayashi H. 1997. Leaf-speci®cally expressed genes for
polypeptides destined for chloroplasts with domains of sigma70
factors of bacterial RNA polymerases in Arabidopsis thaliana.
Proceedings of the National Academy of Sciences, USA 94,
14948±14953.
Jefferson R, Kavanagh T, Bevan M. 1987. GUS fusions: betaglucuronidase as a sensitive and versatile gene fusion marker in
higher plants. EMBO Journal 6, 3901±3907.
Kanamara K, Fujiwara M, Seki M, Katagiri T, Nakamura M,
Mochizuki N, Nagatani A, Shinozaki K, Tanaka K, Takahashi
H. 1999. Plastidic RNA polymerase sigma factors in Arabidopsis.
Plant Cell Physiology 40, 832±842.
Kapoor S, Sugiura M. 1999. Identi®cation of two essential
sequence elements in the non-consensus type II PatpB-290 plastid
promoter by using plastid transcription extracts from cultured
tobacco BY-2 cells. The Plant Cell 11, 1799±1810.
Kristel E, Inge J, Broekaert W. 1996. High-throughput RNA
extraction from plant samples based on homogenization by
reciprocal shaking in the presence of a mixture of sand and glass
beads. Plant Molecular Biology Reporter 14, 273±279.
Laemmli UK. 1970. Cleavage of structural proteins during
assembly of the head of bacteriophage T4. Nature 227, 680±685.
Lerbs-Mache S. 2000. Regulation of rDNA transcription in plastids
of higher plants. Biochimie 82, 525±535.
Liere K, Maliga P. 1999. In vitro characterization of the tobacco
rpoB promoter reveals a core sequence motif conserved between
phage-type plastid and plant mitochondrial promoters. EMBO
Journal 18, 249±257.
Maniatis T, Fritsch E, Sambrook J. 1982. Molecular cloning: a
laboratory manual. Cold Spring Harbour Laboratory Press.
Matsubayashi T, Wakasugi T, Shinozaki K, et al. 1987. Six
chloroplast genes (ndhA-F) homologous to human mitochondrial
genes encoding components of the respiratory chain NADH
dehydrogenase are actively expressed: determination of the splice
sites in ndhA and ndhB pre-mRNAs. Molecular and General
Genetics 210, 385±393.
Maurizi M, Clark W, Kim S, Gottesman S. 1990. Clp P
represents a unique family of serine proteases. Journal of
Biological Chemistry 265, 12546±12552.
Mazur B, Chui C. 1985. Sequence of a genomic DNA clone for
small subunit of ribulose bis-phosphate carboxylase-oxygenase
from tobacco. Nucleic Acids Research 13, 2373±2386.
McBride K, Schaaf D, Daley M, Stalker D. 1994. Controlled
expression of plastid transgenes in plants based on a nuclear
DNA-encoded and plastid-targeted T7 RNA polymerase.
Proceedings of the National Academy of Sciences, USA 91,
7301±7305.
Odell J, Nagy F, Chua N-H. 1985. Identi®cation of DNA
sequences required for activity of the CaMV 35S promoter.
Nature 313, 810±812.
Oikawa K, Fujiwara M, Nakazato E, Tanaka K, Takahashi H.
2000. Characterization of two plastid s factors, SigA1 and SigA2,
that mainly function in matured chloroplasts in Nicotiana
tabacum. Gene 261, 221±228.
Rong M, He B, McAllister W, Durbin R. 1998. Promoter
speci®city determinants of T7 RNA polymerase. Proceedings of
the National Academy of Sciences, USA 95, 515±519.
Sambrook J, Fritsch E, Maniatis T. 1989. Molecular cloning: a
laboratory manual. Cold Spring Harbour Laboratory Press.
Silhavy D, Maliga P. 1998. Mapping of promoters for the nucleusencoded plastid RNA polymerase (NEP) in the iojap maize
mutant. Current Genetics 33, 340±344.
Shinozaki K, Ohme M, Tanaka M, et al. 1986. The complete
nucleotide sequence of the tobacco chloroplast genome: its gene
organization and expression. EMBO Journal. 5, 2043±2049.
Sriraman P, Silhavy D, Maliga P. 1998. The phage-type PclpP-53
Plastid transcripts in tobacco 2349
plastid promoter comprises sequences downstream of the
transcription initiation site. Nucleic Acid Research 26, 4874±
4879.
Sushmita D, Lahiri S, Allison L. 2000. Complementary expression
of two plastid-localized s-like factors in maize. Plant Physiology
123, 883±894.
Tanaka K, Tozawa Y, Mochizuki N, Shinozaki K, Nagatani A,
Wakasa K, Takahashi H. 1997. Characterization of three cDNA
species encoding plastid RNA polymerase sigma factors in
Arabidopsis thaliana: evidence for the sigma factor heterogeneity
in higher plant plastids. FEBS Letters 413, 309±313.
Vera A, Sugiura M. 1995. Chloroplast rRNA transcription from
structurally different tandem promoters: an additional novel-type
promoter. Current Genetics 27, 280±284.