* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download 3D structures of RNA
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genetic code wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Genomic library wikipedia , lookup
Messenger RNA wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Metagenomics wikipedia , lookup
Genome evolution wikipedia , lookup
Human genome wikipedia , lookup
Molecular cloning wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Designer baby wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
RNA silencing wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Microevolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Epitranscriptome wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Introduction to bioinformatics Lecture 2 Genes and Genomes Organisational • Course website: http://ibi.vu.nl/teaching/mnw_2year/mnw2_2007.php or click on http://ibi.vu.nl (>teaching >Introduction to Bioinformatics) • Course book: Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN (Pbk) 1-4051-0683-2 • Lots of information about Bioinformatics can be found on the web. DNA sequence .....acctc tcccagatgg ggcccaggac ttggtgacac caaatcttgt gagcccaaat gcccagagcc ccggtgccca ttcctcttcc cccggacccc ccacgaagac ggcgtggagg agcagtacaa cgtcctgcac tgcaaggtct cctggtcaaa tgggagagca cgcctcccat cagcaagctc aacatcttct accgctacac ctgtgcaaga gtcctgtccc tggggaagcc aactcacaca gacacacctc cttgtgacac caaatcttgt gcacctgaac ccccaaaacc tgaggtcacg ccnnnngtcc tgcataatgc cagcacgttc caggactggc ccaacaaagc ggcttctacc atgggcagcc gctggactcc accgtggaca catgctccgt gcagaagagc acatgaaaca aggtgcacct tccagagctc tgcccacggt ccccgtgccc acctccccca gacacacctc tcttgggagg caaggatacc tgcgtggtgg agttcaagtg caagacaaag cgtgtggtca tgaacggcaa aaccaagtca ccagcgacat ggagaacaac gacggctcct agagcaggtg gatgcatgag ctctc..... nctgtggttc gcaggagtcg aaaaccccac gcccagagcc acggtgccca tgcccacggt ccccgtgccc accgtcagtc cttatgattt tggacgtgag gtacgtggac ctgcgggagg gcgtcctcac ggagtacaag gcctgacctg cgccgtggag tacaacacca tcttcctcta gcagcagggg gctctgcaca Genome size Organism Number of base pairs X-174 virus 5,386 Epstein Bar Virus 172,282 Mycoplasma genitalium 580,000 Hemophilus Influenza 1.8 106 Yeast (S. Cerevisiae) 12.1 106 Human 3.2 109 Wheat 16 109 Lilium longiflorum 90 109 Salamander 100 109 Amoeba dubia 670 109 Four DNA nucleotide building blocks G-C is more strongly hydrogen-bonded than A-T A gene codes for a protein DNA CCTGAGCCAACTATTGATGAA transcription mRNA CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE Central Dogma of Molecular Biology Replication DNA Transcription mRNA Translation Protein Transcription is carried out by RNA polymerase (II) Translation is performed on ribosomes Replication is carried out by DNA polymerase Reverse transcriptase copies RNA into DNA Transcription + Translation = Expression But DNA can also be transcribed into non-coding RNA … tRNA (transfer): transfer of amino acids to the ribosome during protein synthesis. rRNA (ribosomal): essential component of the ribosomes (complex with rProteins). snRNA (small nuclear): mainly involved in RNA-splicing (removal of introns). snRNPs. snoRNA (small nucleolar): involved in chemical modifi-cations of ribosomal RNAs and other RNA genes. snoRNPs. SRP RNA (signal recognition particle): form RNA-protein complex involved in mRNA secretion. Further: microRNA, eRNA, gRNA, tmRNA etc. Eukaryotes have spliced genes … Promoter: involved in transcription initiation (TF/RNApol-binding sites) TSS: transcription start site UTRs: un-translated regions (important for translational control) Exons will be spliced together by removal of the Introns Poly-adenylation site important for transcription termination (but also: mRNA stability, export mRNA from nucleus etc.) DNA makes mRNA makes Protein DNA makes RNA makes Protein … yet another picture to appreciate the above statement Some facts about human genes There are about 20.000 – 25.000 genes in the human genome (~ 3% of the genome) Average gene length is ~ 8.000 bp Average of 5-6 exons per gene Average exon length is ~ 200 bp Average intron length is ~ 2000 bp 8% of the genes have a single exon Some exons can be as small as 1 or 3 bp DMD: the largest known human gene The largest known human gene is DMD, the gene that encodes dystrophin: ~ 2.4 milion bp over 79 exons X-linked recessive disease (affects boys) Two variants: Duchenne-type (DMD) and becker-type (BMD) Duchenne-type: more severe, frameshift-mutations Becker-type: milder phenotype, “in frame”- mutations Posture changes during progression of Duchenne muscular dystrophy Nucleic acid basics Nucleic acids are polymers nucleotide nucleoside Each monomer consists of 3 moieties Nucleic acid basics (2) A base can be of 5 rings Purines and Pyrimidines can base-pair (WatsonCrick pairs) Watson and Crick, 1953 Nucleic acid as hetero-polymers Nucleosides, nucleotides (Ribose sugar, RNA precursor) DNA and RNA strands (2’-deoxy ribose sugar, DNA precursor) REMEMBER: (2’-deoxy thymidine triphosphate, nucleotide) DNA = deoxyribonucleotides; RNA = ribonucleotides (OH-groups at the 2’ position) Note the directionality of DNA (5’-3’ & 3’-5’) or RNA (5’-3’) DNA = A, G, C, T ; RNA = A, G, C, U So … DNA RNA Stability of base-pairing C-G base pairing is more stable than A-T (A-U) base pairing (why?) 3rd codon position has freedom to evolve (synonymous mutations) Species can therefore optimise their G-C content (e.g. thermophiles are GC rich) (consequences for codon use?) Thermocrinis ruber, heat-loving bacteria Amino Acid Single Letter Code DNA codons Isoleucine I ATT, ATC, ATA Leucine L CTT, CTC, CTA, CTG, TTA, TTG Valine V GTT, GTC, GTA, GTG Phenylalanine F TTT, TTC Methionine M, Start ATG Cysteine c TGT, TGC Alanine A GCT, GCC, GCA, GCG Glycine G GGT, GGC, GGA, GGG Proline P CCT, CCC, CCA, CCG Threonine T ACT, ACC, ACA, ACG Serine S TCT, TCC, TCA, TCG, AGT, AGC Tyrosine Y TAT, TAC Tryptophan W TGG Glutamine Q CAA, CAG Asparagine N AAT, AAC Histidine H CAT, CAC Glutamic acid E GAA, GAG Aspartic acid D GAT, GAC Lysine K AAA, AAG Arginine R CGT, CGC, CGA, CGG, AGA, AGG Stop codons Stop TAA, TAG, TGA DNA compositional biases Base compositions of genomes: G+C (and therefore also A+T) content varies between different genomes The GC-content is sometimes used to classify organism in taxonomy High G+C content bacteria: Actinobacteria e.g. in Streptomyces coelicolor it is 72% Low G+C content: Plasmodium falciparum (~20%) Other examples: Saccharomyces cerevisiae (yeast) 38% Arabidopsis thaliana (plant) 36% Escherichia coli (bacteria) 50% Genetic diseases: cystic fibrosis Known since very early on (“Celtic gene”) Autosomal, recessive, hereditary disease (Chr. 7) Symptoms: Exocrine glands (which produce sweat and mucus) Abnormal secretions Respiratory problems Reduced fertility and (male) anatomical anomalies 3,000 30,000 20,000 cystic fibrosis (2) Gene product: CFTR (cystic fibrosis transmembrane conductance regulator) CFTR is an ABC (ATP-binding cassette) transporter or traffic ATPase. These proteins transport molecules such as sugars, peptides, inorganic phosphate, chloride, and metal cations across the cellular membrane. CFTR transports chloride ions (Cl-) ions across the membranes of cells in the lungs, liver, pancreas, digestive tract, reproductive tract, and skin. cystic fibrosis (3) CF gene CFTR has 3-bp deletion leading to Del508 (Phe) in 1480 aa protein (epithelial Cl- channel) Protein degraded in Endoplasmatic Reticulum (ER) instead of inserted into cell membrane Diagram depicting the five domains of the CFTR membrane protein (Sheppard 1999). Theoretical Model of NBD1. PDB identifier 1NBD as viewed in Protein Explorer http://proteinexplorer.org Let’s return to DNA and RNA structure … Unlike three dimensional structures of proteins, DNA molecules assume simple double helical structures independent of their sequences. There are three kinds of double helices that have been observed in DNA: type A, type B, and type Z, which differ in their geometries. RNA on the other hand, can have as diverse structures as proteins, as well as simple double helix of type A. The ability of being both informational and diverse in structure suggests that RNA was the prebiotic molecule that could function in both replication and catalysis (The RNA World Hypothesis). In fact, some viruses encode their genetic materials by RNA (retrovirus) Three dimensional structures of double helices Side view: A-DNA, B-DNA, Z-DNA Space-filling models of A, B and Z- DNA Top view: A-DNA, B-DNA, Z-DNA Major and minor grooves Forces that stabilize nucleic acid double helix There are two major forces that contribute to stability of helix formation: Hydrogen bonding in base-pairing Hydrophobic interactions in base stacking 5’ 3’ 3’ 5’ Same strand stacking cross-strand stacking Types of DNA double helix Type A Type B Type Z major conformation RNA minor conformation DNA major conformation DNA minor conformation DNA Right-handed helix Short and broad Right-handed helix Long and thin Left-handed helix Longer and thinner Secondary structures of Nucleic acids DNA is primarily in duplex form RNA is normally single stranded which can have a diverse form of secondary structures other than duplex. Non B-DNA Secondary structures Cruciform DNA Slipped DNA Triple helical DNA Hoogsteen basepairs Source: Van Dongen et al. (1999) , Nature Structural Biology 6, 854 - 859 More Secondary structures RNA pseudoknots Cloverleaf rRNA structure 16S rRNA Secondary Structure Based on Phylogenetic Data Source: Cornelis W. A. Pleij in Gesteland, R. F. and Atkins, J. F. (1993) THE RNA WORLD. Cold Spring Harbor Laboratory Press. 3D structures of RNA : transfer-RNA structures Secondary structure of tRNA (cloverleaf) Tertiary structure of tRNA 3D structures of RNA : ribosomal-RNA structures Secondary structure of large rRNA (16S) Tertiary structure of large rRNA subunit Ban et al., Science 289 (905-920), 2000 3D structures of RNA : Catalytic RNA Secondary structure of self-splicing RNA Tertiary structure of self-splicing RNA Some structural rules … Base-pairing is stabilizing Un-paired sections (loops) destabilize 3D conformation with interactions makes up for this Three main principles • DNA makes RNA makes Protein • Structure more conserved than sequence • Sequence Structure Function How to go from DNA to protein sequence A piece of double stranded DNA: 5’ attcgttggcaaatcgcccctatccggc 3’ 3’ taagcaaccgtttagcggggataggccg 5’ DNA direction is from 5’ to 3’ How to go from DNA to protein sequence 6-frame conceptual translation using the codon table: 5’ attcgttggcaaatcgcccctatccggc 3’ 3’ taagcaaccgtttagcggggataggccg 5’ So, there are six possibilities to make a protein from an unknown piece of DNA, only one of which might be a natural protein Remark • Identifying (annotating) human genes, i.e. finding what they are and what they do, is a difficult problem – First, the gene should be delineated on the genome • Gene finding methods should be able to tell a gene region from a nongene region • Start, stop codons, further compositional differences – Then, a putative function should be found for the gene located Evolution and three-dimensional protein structure information Isocitrate dehydrogenase: The distance from the active site (in yellow) determines the rate of evolution (red = fast evolution, blue = slow evolution) Dean, A. M. and G. B. Golding: Pacific Symposium on Bioinformatics 2000 Genomic Data Sources • DNA/protein sequence • Expression (microarray) • Proteome (xray, NMR, mass spectrometry) • Metabolome • Physiome (spatial, temporal) Integrative bioinformatics Genomic Data Sources Vertical Genomics genome transcriptome proteome metabolome physiome Dinner discussion: Integrative Bioinformatics & Genomics VU DNA makes RNA makes Protein (reminder) DNA makes RNA makes Protein: Expression data • More copies of mRNA for a gene leads to more protein • mRNA can now be measured for all the genes in a cell at ones through microarray technology • Can have 60,000 spots (genes) on a single gene chip • Colour change gives intensity of gene expression (over- or under-expression) Proteomics • Elucidating all 3D structures of proteins in the cell • This is also called Structural Genomics • Finding out what these proteins do • This is also called Functional Genomics Protein-protein interaction networks Metabolic networks Glycolysis and Gluconeogenesis Kegg database (Japan) High-throughput Biological Data • Enormous amounts of biological data are being generated by high-throughput capabilities; even more are coming – genomic sequences – arrayCGH (Comparative Genomic Hybridization) data, gene expression data – mass spectrometry data – protein-protein interaction data – protein structures – ...... Protein structural data explosion Protein Data Bank (PDB): 14500 Structures (6 March 2001) 10900 x-ray crystallography, 1810 NMR, 278 theoretical models, others... Dickerson’s formula: equivalent to Moore’s law n = e0.19(y-1960) with y the year. On 27 March 2001 there were 12,123 3D protein structures in the PDB: Dickerson’s formula predicts 12,066 (within 0.5%)! Sequence versus structural data • Structural genomics initiatives are now in full swing and growth is still exponential. • However, growth of sequence data is even more rapidly. There are now more than 500 completely sequenced genomes publicly available. Increasing gap between structural and sequence data (“Mind the gap”) Bioinformatics Large - external (integrative) Science Planetary Science Population Biology Sociobiology Systems Biology Biology Human Cultural Anthropology Sociology Psychology Medicine Molecular Biology Chemistry Physics Small – internal (individual) Bioinformatics • Offers an ever more essential input to – – – – – – – – Molecular Biology Pharmacology (drug design) Agriculture Biotechnology Clinical medicine Anthropology Forensic science Chemical industries (detergent industries, etc.)