Download Fine Mapping of Two Wheat Powdery Mildew Resistance Genes

Published April 1, 2016
o r i g i n a l r es e a r c h
Fine Mapping of Two Wheat Powdery Mildew
Resistance Genes Located at the Pm1 Cluster
Junchao Liang, Bisheng Fu, Wenbin Tang, Nasr U. Khan, Na Li, and Zhengqiang Ma*
Abstract
Core Ideas
Powdery mildew caused by Blumeria graminis (DC.) f. sp. tritici
(Bgt) is a globally devastating foliar disease of wheat (Triticum
aestivum L.). More than a dozen genes against this disease,
identified from wheat germplasms of different ploidy levels, have
been mapped to the region surrounding the Pm1 locus on the
long arm of chromosome 7A, which forms a resistance (R)-gene
cluster. Mlm2033 and Mlm80 from einkorn wheat (T. monococcum L.) were two of the R genes belonging to this cluster.
This study was initiated to fine map these two genes toward
map-based cloning. Comparative genomics study showed that
macrocolinearity exists between Brachypodium distachyon L.
chromosome 1 (Bd1) and the Mlm2033–Mlm80–Pm1a region,
which allowed us to develop markers based on the wheat
sequences orthologous to genes contained in the Bd1 region.
With these and other newly developed and published markers,
high-resolution maps were constructed for both Mlm2033 and
Mlm80 using large F2 populations. Moreover, a physical map
of Mlm2033 was constructed through chromosome walking with
bacterial artificial chromosome (BAC) clones and comparative
mapping. Eventually, Mlm2033 and Mlm80 were restricted to a
0.12- and 0.86-cM interval, respectively. Based on the closely
linked common markers, Mlm2033, Mlm80, and MlIW172 (another powdery mildew resistance gene in the Pm1 cluster) were
not allelic to one another. Severe recombination suppression and
disruption of synteny were noted in the region encompassing
Mlm2033. These results provided useful information for mapbased cloning of the R genes in the Pm1 cluster and interpretation
of their evolution.
Published in Plant Genome
Volume 9. doi: 10.3835/plantgenome2015.09.0084
© Crop Science Society of America
5585 Guilford Rd., Madison, WI 53711 USA
This is an open access article distributed under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
the pl ant genome

ju ly 2016

vol . 9, no . 2 •
High-resolution maps were constructed for both
Mlm2033 and Mlm80.
Mlm2033, Mlm80, and MlIW172 are different
powdery mildew resistance genes in the Pm1 cluster.
New markers tightly linked to Mlm2033
were developed.
•
•
P
is an important foliar wheat
disease caused by biotrophic fungus Bgt. Severe
epidemic of this disease could cause significant yield
reduction especially in the areas with cool or maritime
climates (Everts and Leath 1992). Deployment of host
R genes is the most effective and environmentally safe
approach to control this disease in agricultural production. However, R genes with large effect are often
defeated, when widely employed over a large geographical area, by rapidly evolved pathogen populations within
a short period (McDonald and Linde 2002). Thus, it is
necessary to constantly discover and use new powdery
mildew R genes in the breeding program.
To overcome powdery mildew in wheat, over 70 R
genes, mapping to 50 distinct loci of the genome, have
owdery mildew
J.C. Liang, B. Fu, W. Tang, N.U. Khan, N. Li, and Z. Ma, The Applied
Plant Genomics Laboratory of Crop Genomics and Bioinformatics Centre, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China;
B.S. Fu, current address, Crop Research Institute, Jiangsu Academy of
Agricultural Sciences, Nanjing 210014, Jiangsu, China. Received 11
Sept. 2015. Accepted 29 Nov. 2015. *Corresponding author (zqm2@
njau.edu.cn).
Abbreviations: BAC, bacterial artificial chromosome; Bd1, Brachypodium distachyon L. chromosome 1; Bgt, Blumeria graminis (DC.) f. sp.
tritici; CAPS, cleaved amplified polymorphic sequence; CC-NBS-LRR,
coiled-coil–nucleotide-binding-site–leucine-rich repeat; CDS, coding
DNA sequences; EST, expressed sequence tag; PCR, polymerase
chain reaction; R, resistance; RGA, resistance gene analog; SSR,
simple-sequence repeat; STS, sequence-tagged site.
1
of
9
been identified in common wheat and its relatives (McIntosh et al., 2013, 2014; Hao et al., 2015; Wang et al., 2015;
Ma et al., 2015). Most of these genes confer race-specific
resistance to wheat powdery mildew. Yahiaoui et al.
(2004) isolated Pm3b on chromosome 1A of common
wheat through positional cloning, which is an allele of the
R locus encoding coiled-coil–nucleotide-binding-site–
leucine-rich repeat (CC-NBS-LRR) proteins. The previously popular Pm8, originated from rye (Secale cereale L.),
is the ortholog of Pm3 (Hurni et al., 2013). An RGA gene
isolated from chromosome 6V of Haynaldia villosa (L.)
Schur, the carrier of Pm21, encodes a serine–threonine
kinase and provided powdery mildew resistance (Cao et
al., 2011). However, in consideration of the vast amount of
wheat R genes, lack of knowledge about their evolution,
products, and functions has limited our understanding of
the strategies employed by wheat to combat diseases.
Resistance-gene clusters widely exist in plants. In Arabidopsis thaliana L., two-thirds of the NBS-LRR R genes
were in clusters (Meyers et al., 2003); 74.3% R genes in rice
(Oryza sativa L.) were in clusters (Monosi et al., 2004; Luo
et al., 2012). Barley (Hordeum vulgare L.) Mla (Wei et al.,
1999), maize (Zea mays L.) Rp1 (Ramakrishna et al., 2002;
Smith et al., 2004), and lettuce (Lactuca sativa L.) RGC2
(Meyers et al., 1998) are all known R-gene clusters. The Rp1
encompassed up to >50 copies of R genes was probably the
largest R-gene cluster known so far in plants. Of the 50 loci
identified for wheat powdery mildew resistance, six, including Pm1, Pm2, Pm3, Pm4, Pm5, and Pm24, were known to
have multiple alleles according to allelic tests or mapping
results. For instance, at Pm3, 17 functional alleles have been
identified at the sequence level (Yahiaoui et al., 2004, 2006,
2009; Srichumpa et al., 2005; Bhullar et al., 2009, 2010),
which form a true allelic series. However, some of the socalled allelic relationships might result from tight linkage of
different R genes. At Pm1, apart from Pm1a to Pm1e, PmU,
Mlm2033, Mlm80, MlIM72, MIAG12, PmG16, MlIM172,
HSM1 and PmTb7A.2, were all mapped to the same chromosomal interval (Hsam et al., 1998; Singrün et al., 2003;
Qiu et al., 2005; Yao et al., 2006; Ji et al., 2008; Maxwell et
al., 2009; Ben-David et al., 2010; Ouyang et al., 2014; Li et
al., 2014; Chhuneja et al., 2012, 2015), which was subjected
to recombination suppression (Neu et al., 2002). Therefore,
Pm1 might represent a significant R-gene cluster with genes
identified in wheat accessions of different ploidy levels.
Mlm2033 and Mlm80 were two powdery mildew
R genes identified in einkorn accessions and were both
mapped to the Pm1 cluster by our group (Yao et al.,
2006). This study was initiated to fine map these two
genes and determine their physical positions.
Materials and Methods
Plant Materials
Triticum monococcum accession TA2033, possessing
powdery mildew resistance gene Mlm2033; T. boeoticum
accession M80, possessing powdery mildew resistance
gene Mlm80; and susceptible T. monococcum accessions
2
of
9
M389 and TA2725 were used in this study. Three thousand three hundred ninety-one F2 plants derived from
the cross of M389 ´ TA2033 and 1411 F2 plants derived
from TA2725 ´ M80 were used for fine mapping.
Resistance Evaluation
Powdery mildew resistance evaluation was conducted following the same procedures as previously described by
Yao et al. (2006). The seedlings were grown in rectangular
trays under controlled condition with a 22 and 18°C day
vs. night cycle. All plants were inoculated at the one-leaf
stage with isolate Bgt19 and scored 7 d after inoculation for
the resistance level, using a scale of 0 to 5, which represents
no visible symptom (0), necrosis without sporulation (1),
sparse sporulation (2), moderate sporulation (3), abundant
sporulation (4), and abundant sporulation (5) with more
than 80% of the leaf area covered with mycelia, respectively.
Polymerase Chain Reaction Amplification
DNA was extracted from young seedling tissues following the procedures described by Ma et al. (1994). Resistant and susceptible bulks were made by combination of
equal amount of DNA from six F2 plants showing resistant and susceptible phenotypes, respectively.
Polymerase chain reaction of markers was performed in a PE9600 thermal cycler (PerkinElmer) in a
volume of 10 mL containing 10 to 20 ng of template, 2
pmol of each of the primers, 2 nmol of each of the deoxynucleoside triphosphates, 15 nmol of MgCl2, 0.1 U Taq
DNA polymerase, and 1´ PCR buffer. The PCR profile
was as follows: one cycle of 94°C for 3 min, followed by
35 cycles of 94°C for 30 s, 50 to 60°C (depending on the
specific primers) for 40 s, and 72°C for 50 s, and a final
extension at 72°C for 5 min. The PCR products were separated in 8% nondenaturing polyacrylamide gels with a
19:1 or 25:1 or 39:1 acrylamide/bis-acrylamide ratio and
then silver-stained as described by Santos et al. (1993).
Marker Development and
Recombinant Screening
Wheat expressed sequence tags (ESTs) deposited in the
NCBI (http://www.ncbi.nlm.nih.gov/nucest), T. urartu
genome scaffolds (Ling et al., 2013) and survey sequence
contigs of the wheat cultivar Chinese Spring (International
Wheat Genome Sequencing Consortium, www.wheatgenome.org) that are homologous to the predicted coding
DNA sequences (CDS) in the B. distachyon chromosomal
region collinear to the Mlm2033–Mlm80 interval were
used for development of simple-sequence repeat (SSR) or
sequence-tagged site (STS) markers. Additional markers
were designed based on the tetraploid wheat BAC sequence
LDN133-865 (GI: 636536483) (Ouyang et al., 2014), courtesy of Dr. Zhiyong Liu of China Agricultural University.
Triticum urartu sequence scaffold9207 (GI: 473888380)
(Ling et al., 2013), which contains one CDS homologous to
Bradi1 g29693, was also used for marker design. Primers
of markers were designed using MacVector v12.0 software
(MacVector Inc., 2011). Some monomorphic STS markers
the pl ant genome

ju ly 2016

vol . 9, no . 2
Table 1. Markers developed in this study that detected polymorphism between the parents
Marker
name
MAG5240†
MAG5825†
MAG5827†
MAG6385
MAG6546
MAG7310
MAG7914
MAG8220
MAG8223
MAG8415
MAG8626
MAG9060
WGRC253
WGRC271
Sources
Restriction
enzyme needed
Forward primer (5¢-3¢)
Reverse primer (5¢-3¢)
BQ240837
CJ664083
CJ579028
H194P1
B89H15
H194P1
B460F16
B588P8
B270E13
B588P8
B270E13
LDN133-865
Scaffold9207
Scaffold9207
EcoRI
RsaI
–
–
–
–
–
–
TaqI
MboI
–
–
–
MnlI
GGAACATACGACCCAGATTTACGAG
GATGATAATGACTCCCTATG
CAGGGATGTCGGAGAAGA
CGCCTATGTCTCTAAGTCGTGCC
CGAAACAACGAGGATGATGACTTG
ATTCCTGTTCATCTGCCTCC
ATAAGCACTTGACGGTAGGGGC
CACACGTCTAGCCAATACTTCAC
TCGTCTTTGCTGTTCTCGGC
CCCCCGTGATTATGAGAAACG
AAGAGCACCAGAGCGACGAGAATG
GGGCTGAAAAAGGAACTGAAACTC
CGCACTCCACGACTCACG
AACTTGAATACGCCCTTCCTC
TGATGCCGACTGTCACTGCTTAC
AGAATCCCTTCTGCTGACC
GGTGACGACTCCTTTGAA
CTGGGATACACTAAAAGTAACTGCCG
GCACCAACGAGGAACAACCTATG
GATACATTCCCTCTAACCCTGAC
ATAGGGAAGGCATCAGAAGGGGAC
CTGTACCAACGAAAGAGAAAGG
GCTCCTTACGCTTCAGGGATAAATC
AAGACGACGAACAGCCAAAGTG
TGAGGCGAGCGTGTGATAGATAC
CGCGAATGTACACACAACACTG
CCACGAAAGGCAAAGGCAG
TCCAGACGCACGACGATG
† Markers corresponding to B. distachyon genes.
were converted to cleaved amplified polymorphic sequence
(CAPS) markers by digesting the amplified PCR products
with restriction enzymes following the standard protocols.
Recombinants in the Mlm2033 population were
screened with flanking markers Xmag5825 and Xmag5827,
and those in the Mlm80 population were screened with
flanking markers Xmag1757 and Xmag2185.
Bacterial Artificial Chromosome Library
Screening, Sequencing, and Sequence Analysis
A BAC library of about sixfold genome coverage, constructed
with the TA2033 genomic DNA in the authors’ lab, was used
for BAC screening. End sequences of positive BAC clones
were obtained by plasmid rescue (Woo et al., 1994); markers were subsequently designed for chromosome walking.
Bacterial artificial chromosome DNA was prepared following
the protocol described in Sambrook et al. (1989). Bacterial
artificial chromosome contigs were assembled according to
the fingerprints after single or double digestions with restriction enzymes NotI, HindIII, BamHI, PstI, and EcoRI and
band patterns from PCR amplification of BAC clones with
polymorphic markers. Insert sizes of BACs were estimated by
pulse-field gel electrophoresis of the NotI digests of BAC DNA
along with high molecular weight markers (#N0350S, New
England Biolabs). Sequencing of BAC clones was performed
in BGI-Shenzhen, Shenzhen, China.
Gene prediction was performed using the gene
predictor program FGENESH (http://www.softberry.
com) complemented with BLASTn search against dbEST,
BLASTx, and BLASTp search against the nonredundant
protein database at GenBank. A homologous search of
the predicted genes was also performed with the BLASTn
algorithms in the B. distachyon CDS (http://www.plantgdb.org/BdGDB/cgi-bin/blastGDB.pl) and the T. urartu
genome scaffolds (Ling et al., 2013). The Triticum survey
sequence databases publicly available in Unité de Recherche Génomique Info (https://urgi.versailles.inra.fr/blast/
blast.php) were similarly surveyed.
liang et al .: fine m apping of the pm1 cluster Linkage Analysis
Recombinant frequencies (r) were calculated using the
susceptible plants of segregating F2 populations with
formula: r = (2f1+f2)/2N (Liu 1998), where N is the number of total susceptible plants of each population, and f1
and f2 are the numbers of homozygous and heterozygous
recombinants of each marker, respectively. Linkage distances (d) were determined using formula: d = ln[(1+2r)/
(1–2r)]/4. Linkage maps were drawn with MapDraw Version 2.1 (Liu and Meng 2003).
Results
Macrocolinearity of the Mlm2033-Mlm80 Region
with Brachypodium distachyon Genome
The B. distachyon genome has substantial colinearity to
cereal genomes (The International Brachypodium Initiative,
2010) and could be taken advantage of to identify wheat
sequences suitable for marker development. As the first
step, the macrocolinearity of the Mlm2033–Mlm80 region
with the B. distachyon genome was determined. Thus, the
EST sequences corresponding to STS markers MAG1810,
MAG1757, MAG1759, MAG2185, MAG2166, MAG1986,
and MAG1705 that cosegregated or showed close linkage
with Mlm2033 or Mlm80 (Yao et al., 2006; Fig. 1) were used
as queries to search homologous B. distachyon sequences in
the B. distachyon genome sequence database (http://www.
brachypodium.org/) via the BLASTn algorithm. Sequences
orthologous to all these queries but MAG1705 were identified on B. distachyon chromosome 1 with an alignment
similarly to the wheat genes (Fig. 1). In addition to CDO347
(MAG2166) and PSR680 (MAG2185), restriction fragmentlength polymorphism markers C607 and PSR148 that cosegregated with Pm1a (Neu et al., 2002) also have orthologous
sequences in the Bradi1 g30190-Bradi1 g29320 interval.
These results indicated perfect macrocolinearity between
the Mlm2033–Mlm80–Pm1a region and the 750-kb B.
3
of
9
Fig. 1. Colinearity of the Mlm2033-Mlm80 region to Brachypodium distachyon chromosome 1 (Bd1) based on homology of restriction
fragment-length polymorphism (RFLP) probes and expressed sequence tags–based markers. (a) and (c) Mlm2033 and MLm80 genetic
maps reported by Yao et al. (2006). (b) Gene map of Bd1 in the region collinear to the Mlm2033-Mlm80 region in which the Pm1alinked RFLP probes homologous to the Bd1 genes are shown in brackets. The vertical arrows indicate the direction toward telomere.
distachyon region flanked by Bradi1 g30190 and Bradi1
g29320 (unpublished data, 2012).
Marker Development and Comparative
Mapping of Mlm2033 and Mlm80
To obtain more markers for Mlm2033 and Mlm80, wheat
ESTs homologous to the predicted B. distachyon CDS of the
Bradi1 g30190-Bradi1 g29320 interval were used for identification of additional markers. Three markers, including
MAG5827, MAG5240, and MAG5825, corresponding to
Bradi1 g29590, Bradi1 g29658, and Bradi1 g29690, respectively, were obtained and revealed polymorphism between
the resistant and susceptible bulks for Mlm2033 without
or with enzyme digestion (Table 1). LDN133-865 is a BAC
sequence mapping to chromosome 7A of tetraploid wheat
and has 88% sequence identity to the RGA-like PSR680
(MAG2185). Annotation of this BAC sequence revealed
another four RGA fragments and several single-copy
regions. Markers were designed for these sequence fragments, but none of the RGA-derived markers could amplify
products or detect polymorphism in the parents, and the
marker MAG9060 based on one of the single-copy regions
detected polymorphism between the Mlm2033 bulks.
In addition, SSR marker WGRC253 and CAPS marker
WGRC271 were developed based on T. urartu scaffold scaffold9207 that contains the Bradi1 g29693 homolog (Table 1);
the former detected polymorphism between the resistant
and susceptible bulks of both the Mlm2033 and Mlm80,
and the latter revealed polymorphism between the resistant
4
of
9
and susceptible bulks of Mlm80 after MnlI digestion of the
PCR products.
Since powdery mildew R gene MlIW172 was mapped
to the same chromosomal regions as Mlm2033–Mlm80
(Ouyang et al., 2014), markers linked to MlIW172 were
also surveyed for polymorphism. WGGC4659 and
WGGC4655 with HaeIII digestion detected polymorphism between the resistant and susceptible bulks of
the Mlm2033 and Mlm80. Other markers, including
WGGC4653 (with NlaIII digestion), WGGC4654 (with
AluI digestion), and WGGC4665, detected polymorphism
between the resistant and susceptible bulks of Mlm80.
Mapping using the F2 populations developed by Yao
et al. (2006) indicated that all these polymorphic markers
were either cosegregated or tightly linked to the respective R genes and were mapped between Xmag5825 and
Xmag5827 in the Mlm2033 map and between Xmag1757
and Xmag2185 in the Mlm80 map.
Fine Mapping of Mlm2033 and Mlm80
To construct a high-resolution genetic map of Mlm2033,
an F2 population of 3391 plants from the cross of M389 ´
TA2033 were evaluated for powdery mildew resistance. Of
these plants, 832 had a score of 4 or 5 and all others had
scores from 0 to 1, indicating, as expected, a single dominant gene controlled the resistance (c23:1 = 0.39). Similarly,
to fine map Mlm80, 1411 F2 plants derived from M80 ´
TA2725 was surveyed. In this population, 350 F2 plants
had a score from of 4 or 5 and the others had scores from
the pl ant genome

ju ly 2016

vol . 9, no . 2
Fig. 3. The physical maps of Mlm2033. The marker loci cosegregating with Mlm2033 were put proportionally to their physical
positions. The arrow indicates the direction toward telomere.
Fig. 2. High-resolution maps of (a) Mlm2033 and (b) Mlm80 constructed using 832 susceptible F2 plants from TA2033 ´ M389
and 350 susceptible F2 plants derived from M80 ´ TA2725,
respectively. The vertical arrows indicate the direction toward
telomere. Common markers are connected with dotted lines.
Markers in boxes were developed based on bacterial artificial
chromosome sequences.
0 to 1. The resistance segregation again fit the expected 3:1
ratio (c 23:1 = 0.02). The susceptible plants in both populations were used for recombinant identification between
the flanking markers to reduce workload. Thirty-eight
recombinants were obtained between Xmag5825 and
Xmag5827 in the first population, and 20 were obtained
between Xmag1757 and Xmag2185 in the second one.
To avoid any phenotyping and genotyping errors, these
recombinants and their progenies were re-evaluated phenotypically and double checked with markers mapped
between the flanking markers. Finally, high-resolution
maps were constructed for Mlm2033 (Fig. 2a) and for
Mlm80 (Fig. 2b). The common markers in these two maps,
Xwggc4655, Xwgrc253, Xwggc4659, and Xmag2185, showed
perfect synteny. Mlm80 was flanked by Xwggc4655 and
Xwgrc253; while Mlm2033 were flanked by Xwggc4659 and
Xgwm344, both distal to Xwggc4655 and Xwgrc253. Since
WGGC4655, WGRC253, and WGRC271 were single-copy
sequence–based markers, it was concluded that Mlm2033
and Mlm80 might be two genes at different loci.
Physical Mapping of Mlm2033
To construct the physical map for Mlm2033, TA2033
BAC clones were first screened with MAG2185 and
MAG9060. Three positive BAC clones, H138G2, H194P1,
and H130P6, were obtained using MAG2185 and
assembled into a contig based on fingerprinting with
single-enzyme digestion of HindIII, BamHI, and EcoRI,
respectively, and double-enzyme digestion of NotI and
PstI. MAG6385 and MAG7310 were two markers designed
based on the overhanging end sequences of BAC H194P1
liang et al .: fine m apping of the pm1 cluster and H138G2. Walking using MAG6385 identified a
60-kb BAC (B89H15). Unable to design specific markers
because of repetitive end sequences of this BAC, low-pass
sequencing was performed, which allowed us to design
the repetitive junction marker MAG6546 located ~9 kb
apart from one of its ends and consequently identify the
BAC clone B588P8. All the three markers cosegregated
with Mlm2033. MAG8220, designed based on one end
sequence of B588P8, detected polymorphism between the
parents and a recombination event between Xmag6546
and Xmag8220 in one of the recombinants. These five
BAC clones were therefore ordered and oriented as in
Fig. 3. Sequencing B588P8 revealed a hypothetical gene
contained nodulin-like domain, which cosegregated with
Xmag8220 when converted to the marker MAG8415.
Screening of the BAC library using MAG9060 yielded
BAC clones B270E13 and B460F16. These two BACs overlap
with each other but not with the MAG2185-derived contig. The end-sequence-derived marker MAC8223 detected
a locus 0.06 cM proximal to Mlm2033/Xmag9060. Thus,
Mlm2033 was delineated into a 0.12-cM interval defined by
Xmag8415 and Xmag8223. To orient these two BACs, markers MAG7914 and MAG8626 were designed with the lowpass sequencing data of B460F16. Expected PCR products
were obtained with MAG8626 when either one of these two
BACs were used as template and with MAG7914 only when
B460F16 was used as template. Genotyping the recombinants with these two markers indicated that Xmag8626
cosegregated with Mlm2033, while Xmag7914 was 0.12 cM
proximal to the powdery mildew resistance gene, indicating
one end of B460F16 was further away from Mlm2033 (Fig.
3). Attempt was made, but was currently not successful, to
close the gap between the MAG2185-derived contig and the
B270E13/B460F16 contig using BACs.
All the newly developed markers based on the BAC
sequences were also applied to the Mlm80 population.
Of them, MAG8626, MAG8415, and MAG8220 detected
polymorphism between Mlm80 and TA2725. These three
marker loci all cosegregated with Xmag2185 and were
1.57 cM from Mlm80 (Fig. 2).
5
of
9
Table 2. List of the putative genes in the sequenced bacterial artificial chromosome (BAC) clones in Mlm2033 region
No.
Position (BAC)
Similarity as revealed by BLASTx (accession number)
E-value
1
2
3
4
5
6
7
8
9
10
11
12
13
B460F16
B460F16
B460F16
B460F16
B460F16
H194P1/H138G2
H194P1/H138G2
H194P1/H138G2
H194P1/H138G2
H194P1/H138G2
B588P8
B588P8
B588P8
Unknown
Putative disease resistance protein RGA3 [Aegilops tauschii] (EMT21940.1)
PREDICTED: putative disease resistance RPP13-like protein 3 [Brachypodium distachyon] (XP_003569090.1)
PREDICTED: putative disease resistance protein RGA3 [Brachypodium distachyon] (XP_010239445.1)
PREDICTED: putative disease resistance protein RGA3 [Brachypodium distachyon] (XP_010239445.1)
PREDICTED: putative disease resistance protein RGA3 [Brachypodium distachyon] (XP_010239445.1)
Disease resistance RPP8-like protein 3 [Aegilops tauschii] (EMT05779.1)
Predicted protein [Hordeum vulgare subsp. vulgare] (BAK03994.1)
PREDICTED: putative disease resistance protein RGA3 [Brachypodium distachyon] (XP_010239445.1)
PREDICTED: putative disease resistance RPP13-like protein 3 [Brachypodium distachyon] (XP_003569090.1)
Hypothetical protein F775_07944 [Aegilops tauschii] (EMT08425.1)
PREDICTED: 2’-deoxymugineic-acid 2’-dioxygenase-like [Brachypodium distachyon] (XP_003577107.1)
Unknown
–
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
5 ´ 10 −173
0.0
5 ´ 10−114
–
Fig. 4. Schematic representation of the genes in the Mlm2033-syntenic region of the bacterial artificial chromosome contigs and T.
urartu scaffold7153. Resistance gene analogs are shown in red bars; unknown genes are shown in black bars; others are in light blue
bars. Homologous genes are connected with dotted lines.
All BACs in the Mlm2033 contig were sequenced. A
total of 13 putative genes were predicted excluding those
encoding transposition-related proteins (Table 2), nine of
which were R-gene analogs. Obviously, Mlm2033 contig
contains a RGA cluster. Of particular interest were genes
4, 5, and 6; they were highly similar to each other and
shared an overall identity of 94.0 to 99.7%, suggesting
gene duplication is part of the reason of multiple RGAs.
Comparison of the Mlm2033 Region
with Brachypodium distachyon, Triticum urartu,
and LDN133-865 Sequences
Among the 13 genes, only two genes, gene 9 and gene 11,
have homologs with >80% identity in B. distachyon. Gene
9, corresponding to MAG2185, was homologous to Bradi1g29670 and Bradi1g29658, and gene 11 was homologous
to three B. distachyon genes (Bradi3g56870, Bradi1g54990,
and Bradi4g07330). However, none of these B. distachyon
genes were located in the Mlm2033-syntenic region.
6
of
9
Search of the T. urartu genome scaffold database identified
one scaffold7153 (KD005974.1; 874,486 bp) that could be
syntenic to the Mlm2033 region. The predicted genes A,
K, and L of this scaffold were homologous, with 89 to 97%
identities, to gene 1, gene 11, and gene 13 (a single-copy
gene) of the Mlm2033 contigs, respectively, and delimited
a 194-kb region containing 12 predicted genes (Fig. 4).
Two of the predicted genes, C and D, were RGAs, but only
C was similar to one RGA (gene 8) of the Mlm2033 region
with 82% identity. We also compared them with LDN133865, a sequence scaffold of the durum wheat ‘Langdon’
(T. turgidum ssp. durum [Desf.] Husn, and T. urartu). The
LDN133-865 was only similar to gene 2 and the MAG9060
region of the Mlm2033 region and to gene E, a MATE
protein, and gene D of the T. urartu scaffold. To close the
Mlm2033 contig gap, attempt was made to develop more
markers for BAC library screen using the predicted genes
in scaffold7153 but failed. It appeared that the Mlm2033
region has undergone large structural changes by insertion of the RGA clusters between gene 1 and gene 11.
the pl ant genome

ju ly 2016

vol . 9, no . 2
Mlm2033 was Located in an Interval Subjected
to Severe Recombination Suppression
The construction of genetic and physical maps of
Mlm2033 allowed us to investigate the relationship
between physical and genetic distances in this region. Of
832 susceptible F2 plants, there were two recombinant
events that occurred in the 10-kb region delimited by
Xmag7914 and Xmag8626, and one recombinant event
occurred in the 30-kb region delimited by Xmag6546 and
Xmag8415. However, between Xmag8626 and Xmag6546,
a region of at least 320 kb regardless of the gap, no
recombinant event was identified between all the markers including Mlm2033 mapping to this interval. This
result indicated that Mlm2033 was located in an interval
subjected to severe recombination suppression flanked by
regions with much higher recombination rate.
Discussion
Up to now, more than 12 powdery mildew R genes from different resistance germplasms have been mapped to the region
surrounding Pm1. However, it is not really known if these R
genes are allelic or in close physical proximity. In this study,
two of these genes, Mlm2033 and Mlm80 (Yao et al., 2006),
were precisely mapped to a 0.12-cM interval and a 0.86-cM
interval, respectively, through marker development and highresolution mapping using recombinants from large segregating populations. Moreover, a physical map for Mlm2033 was
established with BAC clones and known sequences.
In the primary mapping studies, Pm1a (Ma et al., 1994;
Neu et al., 2002), PmU (Qiu et al., 2005), MlIW72 (Ji et al.,
2008), HSM1 (Li et al., 2014), MlIW172 (Ouyang et al., 2014),
and PmTb7A.2 (Chhuneja et al., 2012, 2015) were mapped
to the same marker interval as Mlm2033 or Mlm80. We
showed, through high-resolution mapping, that Mlm2033
and Mlm80 turned out to be two different genes and genetically adjacent to each other. This was in conflict with our
previous conclusion that the two genes were allelic to each
other (Yao et al., 2006). A possible explanation is that the
target region is subjected to severe recombination suppression in the allelic test population. Indeed, the Mlm2033 was
just located in such a region. Xwggc4655, Xwggc4665, and
Xwggc4659 were three markers in common in the MlIW172,
Mlm2033, and Mlm80 maps and shared the same relative
order (Fig. 2; Ouyang et al., 2014). Based on the mapping
positions of the three resistance genes, it was clear that
MlIW172 was different from Mlm2033 and Mlm80, since
it was mapped to the interval flanked by Xwggc4665 and
Xwggc4659 distally adjacent to the Mlm80 interval flanked
by Xwggc4655 and Xwgrc253 and proximally adjacent to the
Mlm2033 interval flanked by Xwggc4659 and Xgwm344.
The mapping position of Xmag8626 in the Mlm80 map that
cosegregated with Mlm2033 also supported this conclusion. These results pointed to the possibility that the Pm1
marker interval contains a resistance cluster, which was
indirectly supported by the existence of multiple RGAs in
the incomplete Mlm2033 contig. Thus, the Pm1 locus could
be different from some R gene loci, such as Pm3 locus of
liang et al .: fine m apping of the pm1 cluster wheat (Yahiaoui et al., 2004, 2006, 2009; Srichumpa et al.,
2005; Bhullar et al., 2009, 2010) and L locus of flax (Linum
usitatissimum L.) (Lawrence et al., 1995), that contain a single R gene and have multiple alleles with functions altered,
but similar to other R gene loci, such as the M locus of flax
(Anderson et al., 1997; Lawrence et al., 2010), the Rp1 locus
of maize (Collins et al., 1999) and RGC2 family of lettuce
(Meyers et al., 1998), that consist of R-gene clusters with tandem duplication being a likely cause. It would be interesting
to find out if all the R genes mapped in the Pm1 interval
were different position-wise.
The size and complexity of wheat genome impose a great
obstacle on map-based gene isolation. To make things worse,
the recombination rates in some regions are far lower than
the average, which make fine and physically mapping genes
within them even more difficult. Mlm2033 is just located
in such a region with the recombination rate at least 10 and
64 times lower than the two adjacent regions, respectively.
Recombination suppression appears to be quite common in
R-gene-containing regions. This has been illustrated in mapping and characterization of tomato (Solanum lycopersicum
L.) root-knot nematode R gene Mi (Van Daelen et al., 1993),
barley powdery mildew R gene Mla (Wei et al., 1999), wheat
leaf rust R gene Lr10 (Stein et al., 2000), rice blast R gene Pi5
(Jeon et al., 2003) and Pi37 (Lin et al., 2007), common bean
(Phaseolus vulgaris L.) resistance I locus (Vallejos et al., 2006),
peanut (Arachis hypogaea L.) root-knot nematode R gene
Rma (Nagy et al., 2010), and so on. Factors suggested to be
responsible for recombination suppression include genetic
background, high level of sequence diversity, chromosomal
rearrangements, hemizygous state, among others (Wei et al.,
1999, Casselman et al., 2000; Goel et al., 2003; Akiyama et
al., 2005; Lin et al., 2007). Owing to the coevolution of host
resistance and pathogen virulence, it is reasonable to conceive that the host R genes and their associated regions are
subjected to fast evolution for the hosts to accommodate to
hostile environments, which leads to divergence. Indeed, the
dominant state of four (Xmag9060, Xmag7310, Xmag6385,
and Xmag6546) of the six marker loci cosegregating with
Mlm2033 implied that the Mlm2033 region is highly heterogeneous among the parents. Comparison of TA2033 BAC
contig sequences surrounding Mlm2033 with the syntenic
tetraploid wheat BAC sequence and T. urartu scaffold also
revealed substantial structural changes and a high level of
polymorphism. Transfer of this type of R-gene-containing
chromatin to wheats different in ploidy levels could lead to
more severe recombination suppression.
Comparative genomics could reveal the evolutionary
mechanisms of related genomes. In species without full
genome sequence information, it also helps development of
markers based on homology and conservation (e.g., Liu et
al., 2012; Xue et al., 2012; Gasperini et al., 2012; Saintenac
et al., 2013; Bansal et al., 2014) and even gene cloning (Yan
et al., 2006). Using this approach, perfect macrocolinearity was shown between wheat chromosome 7A and Bd1,
which allowed us to saturate the genomic region containing Mlm2033 and Mlm80 by developing more markers
detecting polymorphism. However, it was noted that the
7
of
9
perfect colinearity was disrupted in the regions approaching Mlm2033. Based on the flanking sequences or genes,
the Mlm2033 interval was corresponding to the Langdon
sequence scaffold LDN133-865, but they lack sequence similarity except for a few short sequence stretches and differ
greatly in size. Comparison of the 13 putative genes in BAC
contigs of Mlm2033 region with the genes present in the
collinear regions in B. distachyon genome and T. urartu scaffold7153 also imply disruption of synteny in the Mlm2033
region. Similar circumstances in wheat have been reported
for Lr10 (Feuillet et al., 2003), Lr34 (Bossolini et al., 2007), and
Pm3 (Yahiaoui et al., 2004). The breakdown of microcolinearity in the R-gene-containing regions between different species
could result from frequent deletions and translocations of
R genes (Leister et al., 1998; Quraishi et al., 2009, Luo et al.,
2012). The microcolinearity in the Mlm80-containing region
might have also been broken down, since this interval corresponds to a physical stretch of 30 kb from Bradi1g29693 to
Bradi1g29730 in B. distachyon that has no known R gene-like
gene sequences. Thus, even though the comparative genomics
approach is justified for fine mapping, one has to be cautious
to predict the existence of R genes based on colinearity.
The fine mapping of Mlm2033 and Mlm80 in this
study established the foundation for their map-based
cloning and interpretation of the R-gene evolution in
the Pm1 cluster. To reach these goals, we are expanding
the mapping populations to get higher mapping resolution and increasing the BAC library volume to close the
contig gap of Mlm2033. The newly developed markers
will provide great benefit for cloning and marker-assisted
selection of the linked genes.
Acknowledgments:
This project was partially supported by ‘973’ program 2009CB118300,
NSFC Funds 30025030, 30771344 and 30771165, ‘863’ program
(2012AA101105 and ‘Deep sequencing of A, D wheat genome and resistance functional genomics’).
References:
Akiyama, Y., W.W. Hanna, and P. Ozias-Akins. 2005. High-resolution
physical mapping reveals that the apospory-specific genomic region
(ASGR) in Cenchrus ciliaris is located on a heterochromatic and hemizygous region of a single chromosome. Theor. Appl. Genet. 111:1042–
1051. doi:10.1007/s00122-005-0020-5
Anderson, P.A., G.J. Lawrence, B.C. Morrish, M.A. Ayliffe, E.J. Finnegan,
and J.G. Ellis. 1997. Inactivation of the flax rust resistance gene M associated with loss of a repeated unit within the leucine-rich repeat coding
region. Plant Cell 9:641–651. doi:10.1105/tpc.9.4.641
Bansal, U., H. Bariana, D. Wong, M. Randhawa, T. Wicker, M. Hayden, et
al. 2014. Molecular mapping of an adult plant stem rust resistance gene
Sr56 in winter wheat cultivar Arina. Theor. Appl. Genet. 127:1441–1448.
doi:10.1007/s00122-014-2311-1
Ben-David, R., W.L. Xie, Z. Peleg, Y. Saranga, A. Dinoor, and T. Fahima.
2010. Identification and mapping of PmG16, a powdery mildew resistance gene derived from wild emmer wheat. Theor. Appl. Genet.
121:499–510. doi:10.1007/s00122-010-1326-5
Bhullar, N.K., K. Street, M. Mackay, N. Yahiaoui, and B. Keller. 2009.
Unlocking wheat genetic resources for the molecular identification of
previously undescribed functional alleles at the Pm3 resistance locus.
Proc. Natl. Acad. Sci. USA 106:9519–9524. doi:10.1073/pnas.0904152106
Bhullar, N.K., Z. Zhang, T. Wicker, and B. Keller. 2010. Wheat gene bank
accessions as a source of new alleles of the powdery mildew resistance
gene Pm3: A large scale allele mining project. BMC Plant Biol. 10:88.
doi:10.1186/1471-2229-10-88
8
of
9
Bossolini, E., T. Wicker, P.A. Knober, and B. Keller. 2007. Comparison of
orthologous loci from small grass genomes Brachypodium and rice:
Implications from wheat genomics and grass genome annotation. Plant
J. 49:704–717. doi:10.1111/j.1365-313X.2006.02991.x
Cao, A.Z., L.P. Xing, X.Y. Wang, X.M. Yang, W. Wang, Y.L. Sun, et al. 2011.
Serine/threonine kinase gene Stpk-V, a key member of powdery mildew
resistance gene Pm21, confers powdery mildew resistance in wheat.
Proc. Natl. Acad. Sci. USA 108:7727–7732. doi:10.1073/pnas.1016981108
Casselman, A.L., J. Vrebalov, J.A. Conner, A. Singhal, J. Giovannoni, M.E.
Nasrallah, et al. 2000. Determining the physical limits of the Brassica
S locus by recombinational analysis. Plant Cell 12:23–33. doi:10.1105/
tpc.12.1.23
Chhuneja, P., K. Kumar, D. Stirnweis, S. Hurni, B. Keller, H.S. Dhaliwal, et
al. 2012. Identification and mapping of two powdery mildew resistance
genes in Triticum boeoticum L. Theor. Appl. Genet. 124:1051–1058.
doi:10.1007/s00122-011-1768-4
Chhuneja, P., B. Yadav, D. Stirnweis, S. Hurni, S. Kaur, A.F. Elkot, et al.
2015. Fine mapping of powdery mildew resistance genes PmTb7A.1 and
PmTb7A.2 in Triticum boeoticum (Boiss.) using the shotgun sequence
assembly of chromosome 7AL. Theor. Appl. Genet. 128:2099–2111.
doi:10.1007/s00122-015-2570-5
Collins, N., J. Drake, M. Ayliffe, Q. Sun, J. Ellis, S. Hulbert, et al. 1999.
Molecular characterization of the maize Rp1-D rust resistance haplotype and its mutants. Plant Cell 11:1365–1376. doi:10.1105/tpc.11.7.1365
Everts, K.L., and S. Leath. 1992. Effect of early season powdery mildew on
development, survival, and yield contribution of tillers of winter wheat.
Phytopathology 82:1273–1278. doi:10.1094/Phyto-82-1273
Feuillet, C., S. Travella, N. Stein, L. Albar, A. Nublat, and B. Keller. 2003.
Map-based isolation of the leaf rust disease resistance gene Lr10 from
the hexaploid wheat (Triticum aestivum L.) genome. Proc. Natl. Acad.
Sci. USA 100:15253–15258. doi:10.1073/pnas.2435133100
Gasperini, D., A. Greenland, P. Hedden, R. Dreos, W. Harwood, and S.
Griffiths. 2012. Genetic and physiological analysis of Rht8 in bread
wheat: An alternative source of semi-dwarfism with a reduced sensitivity to brassinosteroids. J. Exp. Bot. 63:4419–4436. doi:10.1093/jxb/ers138
Goel, S., Z. Chen, J.A. Conner, Y. Akiyama, W.W. Hanna, and P. OziasAkins. 2003. Delineation by fluorescence in situ hybridization of a
single hemizygous chromosomal region associated with aposporous
embryo sac formation in Pennisetum squamulatum and Cenchrus ciliaris. Genetics 163:1069–1082.
Hao, Y., R. Parks, C. Cowger, Z. Chen, Y. Wang, D. Bland, et al. 2015.
Molecular characterization of a new powdery mildew resistance gene
Pm54 in soft red winter wheat. Theor. Appl. Genet. 128:465–476.
doi:10.1007/s00122-014-2445-1
Hsam, S.L.K., X.Q. Huang, F. Ernst, L. Hartl, and F.J. Zeller. 1998. Chromosomal location of genes for resistance to powdery mildew in common
wheat (Triticum aestivum L. em. Thell.). 5. Alleles at the Pm1 locus.
Theor. Appl. Genet. 96:1129–1134. doi:10.1007/s001220050848
Hurni, S., S. Brunner, G. Buchmann, G. Herren, T. Jordan, P. Krukowski, et
al. 2013. Rye Pm8 and wheat Pm3 are orthologous genes and show evolutionary conservation of resistance function against powdery mildew.
Plant J. 76:957–969. doi:10.1111/tpj.12345
The International Brachypodium Initiative. 2010. Genome sequencing and
analysis of the model grass Brachypodium distachyon. Nature 463:763–
768. doi:10.1038/nature08747
Jeon, J.S., D. Chen, G.H. Yi, G.L. Wang, and P.C. Ronald. 2003. Genetic
and physical mapping of Pi5(t), a locus associated with broad-spectrum
resistance to rice blast. Mol. Genet. Genomics 269:280–289.
Ji, X., C. Xie, Z. Ni, T. Yang, E. Nevo, T. Fahima, et al. 2008. Identification and genetic mapping of a powdery mildew resistance gene in wild
emmer (Triticum dicoccoides) accession IW72 from Israel. Euphytica
159:385–390. doi:10.1007/s10681-007-9540-1
Lawrence, G.J., P.A. Anderson, P.N. Dodds, and J.G. Ellis. 2010. Relationships between rust resistance genes at the M locus in flax. Mol. Plant
Pathol. 11:19–32. doi:10.1111/j.1364-3703.2009.00563.x
Lawrence, G.J., E.J. Finnegan, M.A. Ayliffe, and J.G. Ellis. 1995. The L6 gene
for flax rust resistance is related to the Arabidopsis bacterial resistance
gene RPS2 and the tobacco viral resistance gene N. Plant Cell 7:1195–
1206. doi:10.1105/tpc.7.8.1195
Leister, D., J. Kurth, D.A. Laurie, M. Yano, T. Sasaki, K. Devos, et al. 1998.
Rapid reorganization of resistance gene homologues in cereal genomes.
Proc. Natl. Acad. Sci. USA 95:370–375. doi:10.1073/pnas.95.1.370
the pl ant genome

ju ly 2016

vol . 9, no . 2
Li, N., Z. Wen, J. Wang, B.S. Fu, J. Liu, H.H. Xu, Z.X. Kong, et al. 2014.
Transfer and mapping of a gene conferring powdery mildew resistance
at later growth stages in a tetraploid wheat accession. Mol. Breed.
33:669–677. doi:10.1007/s11032-013-9983-0
Lin, F., S. Chen, Z. Que, L. Wang, X. Liu, and Q. Pan. 2007. The blast resistance gene Pi37 encodes a nucleotide binding site leucine-rich repeat
protein and is a member of a resistance gene cluster on rice chromosome 1. Genetics 177:1871–1880. doi:10.1534/genetics.107.080648
Ling, H.Q., S. Zhao, D. Liu, J. Wang, H. Sun, C. Zhang, et al. 2013. Draft
genome of the wheat A-genome progenitor Triticum urartu. Nature
496:87–90. doi:10.1038/nature11997
Liu, B.H. 1998. Statistical genomics: Linkage, mapping, and QTL analysis.
CRC, Boca Raton, Florida.
Liu, R.H., and J.L. Meng. 2003. MapDraw: A Microsoft Excel macro for
drawing genetic linkage maps based on given genetic linkage data.
Heraditas (Beijing) 25:317–321.
Liu, Z., J. Zhu, Y. Cui, Y. Liang, H. Wu, W. Song, et al. 2012. Identification
and comparative mapping of a powdery mildew resistance gene derived
from wild emmer (Triticum turgidum var. dicoccoides) on chromosome
2BS. Theor. Appl. Genet. 124:1041–1049. doi:10.1007/s00122-011-1767-5
Luo, S., Y. Zhang, Q. Hu, J.J. Chen, K.P. Li, C. Lu, et al. 2012. Dynamic
nucleotide-binding site and leucine-rich repeat-encoding genes in the
grass family. Plant Physiol. 159:197–210. doi:10.1104/pp.111.192062
Ma, P., H. Xu, Y. Xu, L. Li, Y. Qie, Q. Luo, et al. 2015. Molecular mapping of
a new powdery mildew resistance gene Pm2b in Chinese breeding line
KM2939. Theor. Appl. Genet. 128:613–622. doi:10.1007/s00122-015-2457-5
Ma, Z.Q., M.E. Sorrells, and S.D. Tanksley. 1994. RFLP markers linked to
powdery mildew resistance genes Pm1, Pm2, Pm3, and Pm4 in wheat.
Genome 37:871–875. doi:10.1139/g94-123
MacVector, Inc. 2011. MacVector 12 user guide. MacVector Inc., Apex, NC.
Maxwell, J.J., J.H. Lyerly, C. Cowger, D. Marshall, G. Brown-Guedira, and
J.P. Murphy. 2009. MlAG12: A Triticum timopheevii-derived powdery
mildew resistance gene in common wheat on chromosome 7AL. Theor.
Appl. Genet. 117:103–115.
McDonald, B.A., and C. Linde. 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol.
40:349–379. doi:10.1146/annurev.phyto.40.120501.101443
McIntosh, R.A., J. Dubcovsky, W.J. Rogers, C. Morris, R. Appels, and X.C.
Xia. 2014. Catalogue of gene symbols for wheat: 2013–2014 supplement.
Komugi–wheat genetic resources database. http://www.shigen.nig.ac.jp/
wheat/komugi/ (accessed 7 Oct. 2014).
McIntosh, R.A., Y. Yamazaki, J. Dubcovsky, J. Rogers, C. Morris, R. Appels,
et al. 2013. Catalogue of gene symbols for wheat. 12th Int. Wheat Genetics Symp. Yokohama, Japan.
Meyers, B.C., D.B. Chin, K.A. Shen, S. Sivaramakrishnan, D.O. Lavelle,
Z. Zhang, et al. 1998. The major resistance gene cluster in lettuce is
highly duplicated and spans several megabases. Plant Cell 10:1817–1832.
doi:10.1105/tpc.10.11.1817
Meyers, B.C., A. Kozik, A. Griego, H. Kuang, and R.W. Michelmore. 2003.
Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis.
Plant Cell 15:809–834. doi:10.1105/tpc.009308
Monosi, B., R.J. Wisser, L. Pennill, and S.H. Hulbert. 2004. Full-genome
analysis of resistance gene homologues in rice. Theor. Appl. Genet.
109:1434–1447. doi:10.1007/s00122-004-1758-x
Nagy, E.D., Y. Chu, Y.F. Guo, S. Khanal, S.X. Tang, Y. Li, et al. 2010. Recombination is suppressed in an alien introgression in peanut harboring
Rma, a dominant root-knot nematode resistance gene. Mol. Breed.
26:357–370. doi:10.1007/s11032-010-9430-4
Neu, C., N. Stein, and B. Keller. 2002. Genetic mapping of the Lr20-Pm1
resistance locus reveals suppressed recombination on chromosome arm
7AL in hexaploid wheat. Genome 45:737–744. doi:10.1139/g02-040
Ouyang, S.H., D. Zhang, J. Han, X.J. Zhao, Y. Cui, W. Song, et al. 2014.
Fine physical and genetic mapping of powdery mildew resistance gene
MlIW172 originating from wild emmer (Triticum dicoccoides). PLoS
ONE 9:e100160. doi:10.1371/journal.pone.0100160
Qiu, Y.C., R.H. Zhou, X.Y. Kong, S.S. Zhang, and J.Z. Jia. 2005. Microsatellite mapping of a Triticum urartu Tum. derived powdery mildew resistance gene transferred to common wheat (Triticum aestivum L.). Theor.
Appl. Genet. 111:1524–1531. doi:10.1007/s00122-005-0081-5
Quraishi, U.M., M. Abrouk, S. Bolot, C. Pont, M. Throude, N. Guilhot, et al.
2009. Comparative genomics in cereals: From genome-wide conserved
orthologous set (COS) sequences to candidate genes for trait dissection.
Funct. Integr. Genomics 9:473–484. doi:10.1007/s10142-009-0129-8
liang et al .: fine m apping of the pm1 cluster Ramakrishna, W., J. Emberton, M. Ogden, P. SanMiguel, and J. Bennetzen.
2002. Structural analysis of the maize Rp1 complex reveals numerous
sites and unexpected mechanisms of local rearrangement. Plant Cell
14:3213–3223. doi:10.1105/tpc.006338
Saintenac, C., W. Zhang, A. Salcedo, M.N. Rouse, H.N. Trick, E. Akhunov, et
al. 2013. Identification of wheat gene Sr35 that confers resistance to Ug99
stem rust race group. Science 341:783–786. doi:10.1126/science.1239022
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Plainview, NY.
Santos, F.R., S.D. Pena, and J.T. Epplen. 1993. Genetic and population study of
a Y-linked tetranucleotide repeat DNA polymorphism with a simple nonisotopic technique. Hum. Genet. 90:655–656. doi:10.1007/BF00202486
Singrün, C., S.L.K. Hsam, L. Hartl, F.J. Zeller, and V. Mohler. 2003. Powdery mildew resistance gene Pm22 in cultivar Virest is a member of the
complex Pm1 locus in common wheat (Triticum aestivum L. em Thell.).
Theor. Appl. Genet. 106:1420–1424.
Smith, S.M., A.J. Pryor, and S.H. Hulbert. 2004. Allelic and haplotypic
diversity at the rp1 rust resistance locus of maize. Genetics 167:1939–
1947. doi:10.1534/genetics.104.029371
Srichumpa, P., S. Brunner, B. Keller, and N. Yahiaoui. 2005. Allelic series
of four powdery mildew resistance genes at the Pm3 locus in hexaploid
bread wheat. Plant Physiol. 139:885–895. doi:10.1104/pp.105.062406
Stein, N., C. Feuillet, T. Wicker, E. Schlagenhauf, and B. Keller. 2000. Subgenome chromosome walking in wheat: A 450-kbp physical contig in
Triticum monococcum L. spans the Lr10 resistance locus in hexaploid
wheat (Triticum aestivum L.). Proc. Natl. Acad. Sci. USA 97:13436–
13441. doi:10.1073/pnas.230361597
Van Daelen, R.A., F. Gerbens, F. Van Ruissen, J. Aarts, J. Hontelez, and P. Zabel.
1993. Long-range physical maps of two loci (Aps-1 and GP79) flanking the
root-knot nematode resistance gene (Mi) near the centromere of tomato
chromosome 6. Plant Mol. Biol. 23:185–192. doi:10.1007/BF00021430
Vallejos, C.E., G. Astua-Monge, V. Jones, T.R. Plyler, N.S. Sakiyama, and
S.A. Mackenzie. 2006. Genetic and molecular characterization of the I
locus of Phaseolus vulgaris. Genetics 172:1229–1242. doi:10.1534/genetics.105.050815
Wang, Z., H. Li, D. Zhang, L. Guo, J. Chen, Y. Chen, et al. 2015. Genetic
and physical mapping of powdery mildew resistance gene MlHLT in
Chinese wheat landrace Hulutou. Theor. Appl. Genet. 128:365–373.
doi:10.1007/s00122-014-2436-2
Wei, F., K. Gobelman-Werner, S.M. Morroll, J. Kurth, L. Mao, R. Wing, et
al. 1999. The Mla (powdery mildew) resistance cluster is associated with
three NBS-LRR gene families and suppressed recombination within
a 240-kbp DNA interval on chromosome 5S (1HS) of barley. Genetics
153:1929–1948.
Woo, S.S., J. Jiang, B.S. Gill, A.H. Paterson, and R.A. Wing. 1994. Construction and characterization of a bacterial artificial chromosome library
of Sorghum bicolor. Nucleic Acids Res. 22:4922–4931. doi:10.1093/
nar/22.23.4922
Xue, F., W. Ji, C. Wang, H. Zhang, and B. Yang. 2012. High-density mapping and marker development for the powdery mildew resistance gene
PmAS846 derived from wild emmer wheat (Triticum turgidum var.
dicoccoides). Theor. Appl. Genet. 124:1549–1560. doi:10.1007/s00122012-1809-7
Yahiaoui, N., S. Brunner, and B. Keller. 2006. Rapid generation of new
powdery mildew resistance genes after wheat domestication. Plant J.
47:85–98. doi:10.1111/j.1365-313X.2006.02772.x
Yahiaoui, N., N. Kaur, and B. Keller. 2009. Independent evolution of functional Pm3 resistance genes in wild tetraploid wheat and domesticated
bread wheat. Plant J. 57:846–856. doi:10.1111/j.1365-313X.2008.03731.x
Yahiaoui, N., P. Srichumpa, R. Dudler, and B. Keller. 2004. Genome
analysis at different ploidy levels allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat. Plant J. 37:528–538.
doi:10.1046/j.1365-313X.2003.01977.x
Yan, L., D. Fu, C. Li, A. Blechl, G. Tranquilli, M. Bonafede, et al. 2006. The
wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc.
Natl. Acad. Sci. USA 103:19581–19586. doi:10.1073/pnas.0607142103
Yao, G., J. Zhang, L. Yang, H. Xu, Y. Jiang, L. Xiong, et al. 2006. Genetic
mapping of two powdery mildew resistance genes in einkorn (Triticum monococcum L.) accessions. Theor. Appl. Genet. 114:351–358.
doi:10.1007/s00122-006-0438-4
9
of
9