Download Taster Lab Student Doc PDF

Personal Genetics:
PCR Determination of PTC Tasters
Student Materials
Introduction ............................................................................................................................ 2
Lab Protocol ............................................................................................................................ 3
Predictions and Analysis .......................................................................................................... 9
Data Collection Worksheet ...................................................................................................... 11
Pre-Lab Questions ................................................................................................................... 13
Post-Lab Questions and Analysis .............................................................................................. 17
Students
You should read the Introduction and Lab Protocol and then answer the Pre-Lab Questions. Also be
sure to answer the questions that are embedded in the Introduction. Completion of the questions
will help you understand the concepts and procedures of the lab. Once you have completed the lab,
answer the Post-Lab Questions and Analysis.
Personal Genetics: PCR Determination of PTC Tasters
Introduction
Introduction:
Look around you, would you say that individuals look the same or different? Most of us would agree that
individuals look different. However, if you only look at the DNA of individuals, you might say that different
people actually look the same! The human genome contains approximately 3 billion nucleotides (A, T, C, and G)
linked together in a specific order on long DNA molecules called chromosomes. The human genome is 99.9%
identical from person to person.
What is considered the normal number of chromosomes for human body cells?
What is considered the normal number of chromosomes for human gametes?
Although we are almost identical at the DNA level, it is the less than 1% difference between individuals that
make each of us unique. These differences define our personal genetics and determine many aspects of our
individual biology. They specify hair and eye color, food allergies, reactions to certain medications, and the risk
for particular health problems such as high blood pressure or diabetes. The DNA differences between people
are also the basis of DNA fingerprinting.
Scientists have developed a number of methods to determine the nucleotide differences between individuals in
order to predict and prevent unwanted health problems. This emerging field, commonly termed personalized
medicine, tailors medical procedures, practices, and/or products to the individual patients, often on the basis
of genetic information, and has huge therapeutic potential to improve healthcare outcomes. Today we will use
DNA fingerprinting to test your genotype for a specific trait, the ability to taste the chemical
phenylthiocarbamide (PTC).
Phenylthiocarbamide (PTC) is a chemical found in some bitter tasting foods such as cabbage, broccoli, and
Brussels sprouts. About 75% of people can taste this bitter chemical while about 25% cannot taste PTC. The
ability to taste PTC is controlled by a specific protein (a taste receptor located on your tongue), which is
encoded by a single gene called, TAS2R38. There are different versions (alleles) of the TAS2R38 gene, including
a “taster” allele that encodes a protein that can detect the bitter PTC chemical and a “non-taster” allele that
encodes a faulty protein that does not detect the bitter PTC chemical.
Researchers have identified 2 DNA changes between the taster and non-taster alleles. These differences
between the taster and non-taster alleles are single nucleotide differences (also called single nucleotide
polymorphisms or SNPs). Shown below are 17 base pairs of the much larger TAS2R38 gene. The taster and nontaster alleles differ by one nucleotide within the 17 base pair region shown; the allele of the TAS2R38 gene that
encodes a protein that can detect PTC has a C-G base pair (highlighted in yellow). The allele of the TAS2R38
gene that encodes a protein that does NOT detect PTC has a T-A base pair (highlighted in blue),
SNP1:
5’ …CCTGTGCTGCCTTCATC… 3’
3’ …GGACACGACGGAAGTAG… 5’
“taster allele”: Can taste PTC
5’ …CCTGTGTTGCCTTCATC… 3’
3’ …GGACACAACGGAAGTAG… 5’
“Non-taster allele” Cannot taste PTC
How many copies of the TAS2R38 gene do your body cells have?
With respect to the TAS2R38 gene, what are all of the possible genotypes?
2
In some cases restriction enzymes can be used to identify the differences between alleles of SNPs. Restriction
enzymes recognize a specific DNA sequence and cleave the DNA at that site. Even if 1 nucleotide is different
from the restriction enzyme’s recognized sequence, the restriction enzyme will not cleave the DNA.
For example, an enzyme called Fnu4HI recognizes and cuts within the DNA sequence:
5’ …GCTGC… 3’ but will not recognize and cut 5’ …GTTGC… 3’
3’ …CGACG… 5’
3’ …CAACG… 5’
SNP1 of the TAS2R38 gene falls within an Fnu4HI recognition site. The result is that Fnu4HI will cleave the DNA
sequence of the taster allele, but it will not cleave the DNA sequence at SNP1 of the non-taster allele.
SNP1, taster allele:
5’ …CCTGTGCTGCCTTCATC… 3’
3’ …GGACACGACGGAAGTAG… 5’
SNP1, non-taster allele:
5’ …CCTGTGTTGCCTTCATC… 3’
3’ …GGACACAACGGAAGTAG… 5’
Can taste PTC and DNA is cut by Fnu4HI at SNP1
Cannot taste PTC and DNA is NOT cut by Fnu4HI at SNP1
Within the TAS2R38 gene there is a second site, SNP2, where the DNA differs between the taster and nontaster alleles. SNP2 affects the recognition sequence for the restriction enzyme, CAC8I, which cuts at: 5’
…GCAGGC… 3’
3’ …CGACCG… 5’
SNP2, taster allele:
5’ …AGAGGCAGCCACT… 3’
3’ …TCTCCGTCGGTGA… 5’
SNP2, non-taster allele:
5’ …AGAGGCAGGCACT… 3’
3’ …TCTCCGTCCGTGA… 5’
Can taste PTC and DNA is not cleaved by CAC8I at SNP2
Cannot taste PTC and DNA is cleaved by CAC8I at SNP2
Are you a taster or a non-taster? Today you will test your TAS2R38 DNA to determine your genotype. You will
then test your ability to taste PTC using special paper and determine whether your PTC taster genotype
matches your PTC taster phenotype.
Given your food preferences, make a guess as to whether you are a taster or a non-taster.
3
Personal Genetics: PCR Determination of PTC Tasters
Lab Protocol
Overview: The first step in determining your personal genetics is to collect some of your cells. You will use your
cheek cells as they can be gently scraped off with a toothpick or wooden stick.
You will then isolate the DNA from these cells by exposing them to sodium hydroxide (NaOH), which will break
open the cell membrane so that your DNA will be released into solution.
Although you will have DNA from many cells, there will not be enough DNA to study the TAS2R38 gene, so the
next step is to make many copies of the two regions of the TAS2R38 gene that contain SNP1 and SNP2 for
further analysis. You will use a powerful technique called polymerase chain reaction (PCR) to amplify the two
DNA regions.
PCR will produce millions of identical DNA molecules that will include SNP1. All of the molecules produced by
PCR will be the same size, whether or not you are a taster. But remember that the restriction enzyme Fnu4HI
will cut the DNA molecules if you have the taster allele, but will not cut the molecules if you are a non-taster.
Likewise, a second PCR reaction will produce millions of identical DNA molecules that will include SNP2. All of
the molecules produced by this PCR will be the same size, but the restriction enzyme CAC8I will NOT cut the
DNA molecules if you have the taster allele, but will cut the molecules if you are a non-taster.
Lastly, you will visualize the sizes of the DNA fragments generated by restriction enzyme digest by performing
gel electrophoresis. Gel electrophoresis allows us to separate the DNA fragments based on size. By analyzing
the size of the DNA pieces you will be able to determine which alleles of the TAS2R38 gene you have in your
DNA.
Experiment Flowchart:
4
Materials – Student Workstation
Cheek cell isolation:
 PBS (Phosphate Buffered Saline)
 Toothpick
 Microcentrifuge
 p1000 micropipette and tips
 Permanent marker
 Timer
 Microcentrifuge tubes

DNA Isolation:
 p200 micropipette and tips
 P1000 micropipette and tips
 Cell Lysis Solution (5mM NaOH)
 Neutralization Buffer
 Timer
 Microcentrifuge tubes
PCR:








Taq Mix
Primer Mix SNP1 (3µM)
Primer Mix SNP2 (3µM)
Distilled Water
PCR tubes (small thin walled tubes that fit in the PCR machine)
p200 micropipette and tips
p20 micropipette and tips
Permanent marker
Restriction Digest:
 p200 micropipette and tips
 tubes
 Fnu4HI restriction enzyme
 CAC 8I restriction enzyme
 Timer
Gel Electrophoresis (per 2 students):
 Electrophoresis gel box, tray, comb and electrodes
 Agarose gel and running buffer
 p20 micropipette and tips
 Permanent marker
 100 bp ladder
5
Procedure:
Cheek Cell Isolation: (Each student performs all steps)
1. Avoid eating food immediately prior to cheek swab. If you have recently eaten rinse your mouth
vigorously with water.
2. Collect tissue sample:
a. Insert toothpick in mouth and gently scrape inner cheek for 10-15 seconds. Do not scrape too
vigorously (this should not be painful).
b. Insert toothpick containing cheek cells into the PBS solution in the microcentrifuge tube. Make
sure the toothpick is oriented so that the cheek cells are immersed in the PBS solution. Stir the
PBS with the stick and let sit in tube for 2-3 minutes. Gently shake stick to dislodge attached
cells and remove stick from tube.
c. Dispose of toothpick in biohazard trash. Do not reuse toothpick.
3. Close microcentrifuge tube and centrifuge at 1200g for 5 minutes. Carefully remove tube and look for
white pellet of cheek cells at bottom of tube. Don’t worry if you don’t see cells, a small number of cells
will be at the bottom of the tube.
IMPORTANT TIP!! Always put the hinge of the microfuge tube pointing towards
the outside of the centrifuge. The pellet will then form under the hinge
4. Using a p1000 micropipette, carefully remove 900 µL PBS solution. Be careful to avoid removing the cell
pellet, which is located at the bottom of your tube.
5. Close the microcentrifuge tube and centrifuge at 1200g for 5 minutes. Carefully remove tube and look
for a white pellet of cheek cells at bottom of tube (under the hinge). Don’t worry if you don’t see cells,
a small number of cells will be at the bottom of the tube.
6. Using a p200 micropipette, carefully remove the rest of the PBS solution. Be careful to avoid removing
the cell pellet, which is located at the bottom of your tube.
Stopping Point – Check with your teacher before continuing with the protocol.
DNA Isolation: (Each student performs all steps)
7. Add 240 µL of Cell Lysis Solution (5mM NaOH) to the cheek cells in the tube. Pipette the cells up and
down in the solution until the cells disappear (5-10 times).
8. Incubate the cells in the Cell Lysis Solution at room temperature (~25C) for 10 minutes.
9. Using a p200 micropipette, add 60 µL of neutralization buffer (Neut Buffer) to cells.
10. Centrifuge the tube at 1200g (the speed is not critical) for 30 seconds to pellet the cellular debris.
11. Using a p200, carefully remove 150 µL of the solution from the top of the tube (do not disturb the
pellet) and place it into a clean microcentrifuge tube labeled with “DNA” and your initials. This is now
the DNA sample you will use for PCR.
Stopping Point – Check with your teacher before continuing with the protocol.
6
PCR: (Each student performs all steps)
10. Label the side of one PCR tube with your initials and SNP1.
11. Label the side of another PCR tube with your initials and SNP2.
12. Using a p200 micropipette, add 25 µL of Taq mix to each PCR tube. The Taq solution contains Taq
polymerase, dNTPs, and loading dye. The Taq mix is green.
13. Using a p20 micropipette, add 19 µL of sterile water to each PCR tube. Be sure to use a fresh tip for
each tube!
14. Using a p20 micropipette, add 3 µL of your DNA sample to each PCR tube (3 µL for each tube). Be sure
to use a fresh tip for each tube!
15. Using a p20 micropipette, add 3 µL of Primer Mix SNP1 to the PCR tube labeled SNP1. Be sure to use a
fresh tip for each tube!
16. Using a p20 micropipette, add 3µL of Primer Mix SNP2 to the PCR tube labeled SNP2. Be sure to use a
fresh tip for each tube!
17. Place PCR tubes in PCR machine and run the following PCR program:
94C 3 minutes
40 cycles of the next 3 temperatures
94C
15 seconds
60C
30 seconds
70C
30 seconds
1 cycle of the last temperature
72C
5 minutes
Stopping Point – Check with your teacher before continuing with the protocol.
Restriction Digest: (Each student performs all steps)
18. Label the side of 1 PCR tube with your initials and SNP1 + Fnu4HI. Label the side of another PCR tube
with your initials and SNP2 + CAC8I.
19. Using a p200 micropipette, remove 25 µL of PCR reaction from SNP1 and add it to the bottom of the
tube labeled SNP1 + Fnu4HI. Be sure to use a fresh tip for each tube!
20. Obtain Fnu4HI enzyme from teacher. Using a p20 micropipette, remove 1 µL of Fnu4HI restriction
enzyme and add it to the solution in the SNP1 + Fnu4HI tube. Pipette up and down a couple of times.
Be sure to use a fresh tip for each tube!
21. Using a p200 micropipette, remove 25 µL of PCR reaction from SNP2 and add it to the bottom of the
tube labeled SNP2 + CAC8I. Be sure to use a fresh tip for each tube!
7
22. Obtain CAC8I enzyme from teacher. Using a p20 micropipette, remove 1 µL of CAC8I restriction enzyme
and add it to the solution in the SNP2 + CAC8I tube. Pipette up and down a couple of times. Be sure to
use a fresh tip for each tube!
23. Incubate restriction digest tubes at 37C for 1hr.
Stopping Point – Check with your teacher before continuing with the protocol.
Gel Electrophoresis: (Students work in pairs- 1 gel per 2 students)
24. You and your partner will need to obtain a 2.0% agarose gel with at least 9 lanes (or wells).
25. Load, run, and examine the gel:
Coordinate with your partner to load and run the gel.
a. Using a p20, load 10 µL of 100bp ladder to lane 5 of your gel
b. Using a p20, load 15 µL of your sample into the gel wells in the following order. Be sure to use a
fresh tip for each tube!
Note: you do not need to add loading dye to your DNA samples because the OneTaq 2X
Master Mix (used in step #12) and 100 bp ladder already include loading dye.
SNP1
uncut
c.
d.
Student 1
SNP1+
SNP2
Fnu4HI
uncut
SNP2+
CAC8I
100 bp
Ladder
SNP1
uncut
Student 2
SNP1 +
SNP2
Fnu4HI
uncut
SNP2 +
CAC8I
Run the gel as instructed by your teacher.
Place your gel on the illuminator and examine your results. Be sure to take a photograph of
your gel or sketch your results on the template provided.
26. Clean up your lab bench, pour the gel running buffer down the drain and dispose of your gel.
8
Personal Genetics: PCR Determination of PTC Tasters
Predictions and Analysis
To determine your TAS2R38 genotype, you used one set of DNA primers to copy the SNP1 region and a
different set of primers to copy the SNP2 region.
Below is schematic of the TAS2R38 gene showing the relative locations of the DNA primers used to amplify the
SNP1 and SNP2 regions and the Fnu4HI and CAC8I restriction sites.
TAS2R38 gene:
Fnu4HI
CAC8I
65 bp
60 bp
SNP2
SNP1
313 base pairs
360 base pairs
The table below lists the expected sizes of the SNP1 DNA molecules before and after digestion with restriction
enzyme for both the taster and non-taster alleles in the table below.
Complete the table for SNP 2.
SNP1 PCR
uncut
Sizes (base pairs)
SNP1 PCR
SNP2 PCR
cut with Fnu4HI
uncut
Taster
360
295 + 65
Non-Taster
360
360
SNP2 PCR
Cut with CAC8I
313
9
Use the gel diagram below to predict the expected results for each of the three possible genotypes. Draw a
band to indicate where the DNA bands would appear. Use the ladder on the left to judge distance traveled.
10
Personal Genetics: PCR Determination of PTC Tasters
Data Collection Worksheet
Student 1
1
2
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
3
4
Ladder
Sketch what your gel looks like on the template below. Use a ruler to draw your results on gel the template
below as accurately as possible. If possible take a photograph of your gel and attach it to this sheet.
Student 2
6
7
8
9
10
SNP1 PCR uncut
SNP1 PCR + Fnu4HI
SNP2 PCR uncut
SNP2 PCR + CAC8I
100bp DNA Ladder
SNP1 PCR uncut
SNP1 PCR + Fnu4HI
SNP2 PCR uncut
SNP2 PCR + CAC8I
No sample
11
Using the fragment sizes of the 100 bp DNA ladder as indicated below, estimate the sizes of the restriction
fragments you observed on your gel. List the estimated sizes in the table below:
SNP1 PCR
uncut
Sizes (base pairs)
SNP1 PCR
SNP2 PCR
cut with Fnu4HI
uncut
SNP2 PCR
Cut with CAC8I
Taster
Non-Taster
a) Were there any differences between the size of the
SNP1 PCR product with and without enzyme? Explain
why you obtained this result
500 nucleotides
400 nucleotides
300 nucleotides
200 nucleotides
b) Were there any differences between the size of the
SNP2 PCR product with and without enzyme?
100 nucleotides
c) What is your genotype?
Compare your genotype to your phenotype
1. Obtain two pieces of taster paper, one is PTC paper, the other is a control.
2. Place the control paper on your tongue. Record what you experienced below:
3. Place the PTC paper on your tongue. Record what you experienced below:
Does your ability to taste PTC correlate with your genotype as determined by DNA fingerprinting?
Does your ability to taste PTC correlate with the prediction you made on page 3?
12
Pre Lab Questions
1)
The restriction enzyme EcoRV recognizes and cleaves at the sequence: 5’ GATATC 3’ 
5’ GAT ATC 3’
3’ CTATAG 5’
3’ CTA TAG 5’
Circle the sequence that can be cleaved by the EcoRV enzyme.
a.
5’ GGTACTGACTGGTGCTAGCTAGCTTGCAGAAA 3’
3’ CCATGACTGACCACGATCGATCGAACGTCTTT 5’
b.
5’ ATCGGATATCACTCGATCGGCGCTAGCTCGAT 3’
3’ TAGCCTATAGTGAGCTAGCCGCGATCGAGCTA 5’
c.
5’ TTTAGCGATCGCGCTAGCTAGCTCGATCGACT 3’
3’ AAATCGCTAGCGCGATCGATCGAGCTAGCTGA 5’
2) Assume that the sequence you selected in question 1 was cut by the EcoRV enzyme. Give the sizes of the resulting
two pieces of DNA. Give your answer in terms of the number of base pairs.
Piece 1: ___________
Piece 2: ___________
3) When BamHI recognizes the target sequence shown, it cleaves the DNA between the first two G nucleotides on
the 5’ end of the target sequence. Draw the resulting two DNA fragments.
5’
3’
3’
5’
GGATCC
CCTAGG
4) In gel electrophoresis, an electrical current is applied to separate DNA pieces by size. In the diagram below,
indicate in which direction the DNA will migrate through the gel within the electric field present in the gel box.
Draw the chemical structure of a DNA nucleotide and use that drawing to explain why DNA will migrate through
the gel in the manner you have indicated.
Negative Electrode
DNA
Positive Electrode
13
5) During gel electrophoresis, smaller pieces of DNA will travel faster than larger pieces of DNA. This is because
smaller pieces of DNA can move easily or migrate through the “obstacle course” gel matrix that forms when the
agarose polymerizes. In the gel below, indicate which band represents the larger pieces of DNA.
Negative Electrode
Lane 1
Positive Electrode
6) You are given five samples, each containing DNA fragments of an unknown length. To determine the size of DNA
fragment for each sample, you decide to perform gel electrophoresis. In the first lane you load a DNA ladder,
which contains multiple pieces of DNA with known sizes. In the figure below, what are the approximate sizes of
the DNA fragments in each of the five samples you characterized?
ladder
Size in base pairs
Lane 2
Lane 3
Lane 4
Lane 5 Lane 6
Lane 2:_____
1500
Lane 3:_____
1200
1000
900
Lane 4:_____
700
600
Lane 5:_____
Lane 6:_____
500
400
300
200
100
6) Sickle-cell trait and sickle-cell anemia are associated with a single nucleotide polymorphism (SNP) that changes an
A to T at nucleotide 17 in the beta-globin gene. You have developed an assay to distinguish between the A and T
variants. In alleles with the T variant, BamHI can recognize and cleave the DNA at this SNP. BamHI cannot cleave
the A variant of the beta-globin gene at the SNP. Individuals with one copy of the T variant and one copy of the A
variant have sickle-cell trait. Individuals with two copies of the T variant (homozygous for the mutant allele) have
sickle-cell anemia. Individuals homozygous for the A variant do not have sickle-cell trait or anemia.
14
The schematic below shows a region of the beta-globin gene that was amplified using PCR and that includes the
BamHI restriction site present in the T variant. This BamHI restriction site is not present in the A variant.
BamHI
400 base pairs
600 base pairs
a.
For people with sickle-cell anemia, PCR amplification of genomic DNA from this region of the beta-globin
gene and digestion of the PCR product with BamHI will result in a DNA piece or DNA pieces of what size?
b.
For people who do not have sickle-cell trait or anemia, PCR amplification of genomic DNA from this
region of the beta-globin gene and digestion of the PCR product with BamHI will result in a DNA piece or
DNA pieces of what size?
c.
For people with sickle-cell trait, PCR amplification of genomic DNA from this region of the beta-globin
gene and digestion of the PCR product with BamHI will result in a DNA piece or DNA pieces of what size?
d.
You isolate DNA from five people and amplify the region of the beta-globin gene that contains the T
variant SNP. You then cut the amplified DNA molecules with the BamHI enzyme and separate the
resulting fragments using gel electrophoresis. You find that the patient represented in lane 2 has sicklecell anemia, the patient represented in lane 4 has sickle-cell trait and the other three are normal. Draw
the expected bands on the gel below.
ladder
Lane 2
Lane 3
Lane 4
Lane 5 Lane 6
1500 base pairs
1000 base pairs
600 base pairs
500 base pairs
400 base pairs
200 base pairs
100 base pairs
15
Post Lab Questions
1.
Did your experiment allow you to identify your genotype? If your experiment did not allow you to identify your
genotype, explain what happened that prevented you from obtaining the needed data and suggest changes you
could make if you were to repeat the experiment.
2.
How did your ability to taste PTC align with your TAS2R38 genotype? Did everyone’s PTC taster phenotype align
with his or her genotype? If not, can you come up with a reason why not?
3.
What does SNP stand for? Briefly explain how SNPs are biologically important in nature and in medicine.
4.
What was the purpose of performing the PCR reaction in this experiment?
5.
How did you use restriction enzymes to distinguish between people with PTC taster and non-taster alleles in this
lab?
5.
What are some ways in which scientists use personalized medicine to provide better health care?
16