Download Genetics = science of heredity - Suffolk County Community College

Microbial Genetics
(Chapter 8)
Genetics = science of heredity
study of what genes are, how they carry
info, how they are replicated, passed along,
and how expression of the info determines
characteristics of the organism
Genome = all genetic info in a cell
Chromosome = organized unit of genome;
bundle of DNA
bacteria have 1, humans have 46
Genes = segments of DNA that code for
functional products (rRNA, tRNA or
protein)
Genomics = field of genetics involved in
sequencing and molecular characterization
of genomes
Many organisms sequences known: e.g.
E.coli = 4 million bp (~3-4 thousand genes)
Yeast= 12 million bp (~5-6 thousand genes)
Human= 3 billion bp (~30 thousand genes)
Lecture Materials
for
Amy Warenda Czura, Ph.D.
Suffolk County Community College
Eastern Campus
Primary Source for figures and content:
Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson
Benjamin Cummings, 2004, 2007, 2010.
DNA = macromolecule, strands of nucleotides
nucleotide = nitrogenous base + deoxyribose +
phosphate
Features of biological info storage:
1. linear sequence of bases provides actual
genetic info: only four bases but in chain of
X length there are 4X possibilities of
different orders
e.g. chain 2 bases long, using 4 possible
bases, 42 = 16 possible configurations:
AA TA CA GA
AT TT CT GT
AC TC CC GC
AG TG CG GG
-deoxyribose and phosphate
form linear strand, “backbone”
-nitrogenous bases hang
off side
-two strands held together by
H-bonding between bases,
forms a double helix, two
strands wound around each
other
-base pairing: A-T, G-C
-bases on one strand determine bases
on the other: the strands are
complementary
-sequence contains genetic info
Amy Warenda Czura, Ph.D.
2. complementary structure of DNA allows
precise duplication: one strand determines
sequence of other: A-T, G-C
1
SCCC BIO244 Chapter 8 Lecture Notes
Genotype = DNA, genetic makeup
all the genes that can encode characteristics
of an organism, potential properties
Phenotype = protein
the observed outcome of gene expression
the appearance or metabolic capabilities of
an organism
Gene expression = turning the info from the
gene in DNA into the molecule it encodes,
usually a protein
Not all genes are expressed: if not expressed
the gene cannot contribute to the
phenotype
-the DNA is ~1000x longer than cell but
chromosome structure is organized to
occupy only 10% of cell volume
DNA Replication
-must replicate DNA to pass genetic info to
progeny cells
-process converts one parental molecule into
two identical daughter molecules
DNA and Chromosomes
-bacteria: usually one chromosome
(yeast -7 humans -46)
-bacterial chromosome is circular DNA with
associated proteins, attached to plasma
membrane
(eukaryotes = linear chromosomes, in nucleus)
-DNA is a directional molecule
-two strands in double helix are anti-parallel:
run in opposite directions
-directionality
dictated by the
sugar-phosphate
bonds of the
backbone:
-process is
semi-conservative:
each strand of parental
molecule is template for
new strand, and new
molecules contain half
parental and half new
DNA complementary
base paired
P on 5’carbon
of nucleotide
gets bound to
OH on 3’
carbon of next
nucleotide
-DNA polymerase (enzyme for DNA
synthesis) can add nucleotides only to
the 3’ end of a growing molecule
Amy Warenda Czura, Ph.D.
2
SCCC BIO244 Chapter 8 Lecture Notes
-new strands synthesized in opposite
directions
-energy for bond making comes from free
nucleotides in tri-phosphate forms: ATP,
TTP, GTP, CTP
-two phosphates are removed and energy is
used to create the sugar-phosphate (OH to
P) bond between nucleotides
DNA Replication
1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication.
2. Proteins stabilize the unwound parental DNA creating the replication fork.
3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the
leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the
replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are
complementarily base paired with the parental strand and chemically bonded to the 3’end of the
RNA primer and subsequently to each other at the 3’ends (via removal of two phosphates) to create a
new DNA strand.
4. The lagging strand is synthesized discontinuously:
At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA.
Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the
3’ end of the RNA primer and growing chain by DNA polymerase, working away from the
replication fork for ~1000bases. The resulting segment is called an Okazaki fragment.
5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3’
end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA
primers on completed Okazaki fragments on the lagging strand and replaces them with DNA
nucleotides.
6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the
neighboring fragments into a single continuous molecule.
7. Replication continues down the full length of the chromosome until both parental strands are completely
separated and each is base paired to a newly synthesized strand.
DNA Replication Events
(on handout)
Bacterial chromosomes can replicate
bidirectionally: one origin of replication
with two replication forks moving in
opposite directions
-origin of replication is associated with the
plasma membrane to insure separation of
duplicated chromosomes to each daughter
cell during binary fission
DNA replication accurate: DNA polymerase
has proofreading ability to insure proper
base pairing before backbone is chemically
bonded
Error rate = ~1 in 109 bases
error = mutation
Gene Expression:
RNA and protein synthesis
-DNA replication only occurs in cells that are
dividing
-gene expression occurs in all cells all the
time: cells are constructed of protein and
require enzymes to function
DNA --------------> RNA --------------> Protein
transcription
translation
Amy Warenda Czura, Ph.D.
3
SCCC BIO244 Chapter 8 Lecture Notes
Transcription = synthesis of complementary
strand of RNA from DNA template
Translation = synthesis of protein from info on
mRNA template
Transcription
making RNA from DNA
3 types of RNA:
1. Ribosomal RNA (rRNA) - integral part of
ribosomes, which carry out protein
synthesis
2. Transfer RNA (tRNA) - bring amino acids
to ribosome for use in protein synthesis
3. Messenger RNA (mRNA) - carries coded
info for synthesis of specific proteins from
DNA gene to ribosome for use
RNA is synthesized as complementary copy
of a DNA gene except that T is replaced by U
The complement is produced from the
template or sense strand of the DNA gene
Coding/Antisense strand of the DNA:
ATGGTATTCTCCTATCGTTAA
Template/Sense of the DNA gene:
TACCATAAGAGGATAGCAATT
RNA:
AUGGUAUUCUCCUAUCGUUAA
Gene Structure (on handout)
Promoter
Open Reading Frame (ORF)
(codons for amino acids)
Start codon
Terminator
Stop codon
The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be
transcribed
The start and stop codons are directions for the ribosome to indicate where the amino acid information for
translation begins and ends
The ORF is the “coding” region of the gene: it begins at the start codon and contains in order all the codons
for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of
the 20 amino acids) The ORF ends at the stop codon.
Transcription Events
(on handout)
Translation
-protein synthesis at the ribosome
DNA: 4 different bases in a particular order
make up the gene sequence
RNA: 4 bases complementary to the DNA
gene make up the RNA sequence
Nucleotide bases are like letters in the
alphabet: used in groups of three to make
“words”; each word indicates a particular
amino acid
3 nucleotides = 1 codon
Each codon = one amino acid of the 20
possible
Translation involves “reading” the codons on
the mRNA to build the polypeptide using
the correct amino acids in the order
specified by the gene
The Genetic Code
-all organisms use the same codons to specify
the particular amino acids
Amy Warenda Czura, Ph.D.
4
SCCC BIO244 Chapter 8 Lecture Notes
Use the genetic code chart to decode the
amino acid sequence of any mRNA:
AUG /GUA /UUC /UCC /UAU /CGU /UAA
on
han
dou
t
64 possible codons (43) but only 20 amino
acids: some are redundant
61 codons code for amino acids = sense
codons
3 nonsense codons serve as the STOP signal
to terminate protein synthesis
For each sense codon there is a tRNA with a
complementary antisense codon: this tRNA
carries the amino acid specified by the
codon
There are no tRNA molecules with anticodons
to the 3 nonsense codons (stop codons):
UAA, UAG, UGA, and thus no amino
acids
The start codon is AUG and codes for the
amino acid methionine
The start codon establishes the reading frame
of the mRNA: all other codons (each three
nucleotides) can be read once the start has
been identified
AUG /GUA /UUC /UCC /UAU /CGU /UAA
Met - Val -Phe -Ser -Tyr -Arg -STOP
Translation Events (on handout)
Translation begins at the AUG codon
Amy Warenda Czura, Ph.D.
5
SCCC BIO244 Chapter 8 Lecture Notes
Once the ribosome begins moving along the
mRNA molecule the start codon is exposed
and another ribosome can assemble and
begin translation
In prokaryotes
there is no
nuclear
separation
so translation
can begin
before
transcription
is complete
Translation ends at the stop codon because:
-no tRNA with a complementary anticodon
exists to pair with a stop codon
-no amino acid arrives to be peptide bonded
to the chain
Amy Warenda Czura, Ph.D.
6
SCCC BIO244 Chapter 8 Lecture Notes
In eukaryotes, transcription occurs in the
nucleus: mRNA must exit to the cytoplasm
before translation can begin
Also eukaryotic RNA must be processed
before a functional mRNA is generated
Eukaryotic genes contain introns and exons
exons = coding portion (codons)
introns = “junk”
RNA generated by complementary base
pairing to the template DNA contains both
introns and exons.
Small nuclear ribonucleoproteins (snRNPs)
cut out the introns and splice together the
exons to form mRNA that can be used for
translation
Exons can provide variability: many mRNA
configurations can be formed from a single
gene with multiple exons
e.g. use all or only some of the exons:
3 exons = 7+ different mRNAs (and thus
proteins) 1-2-3, 1-2, 1-3, 2-3, 1, 2, 3
Regulation of Bacterial Gene Expression
-protein synthesis metabolically expensive:
cells only make what is needed
-60-80% of genes constitutively expressed:
“housekeeping genes”
-genes not involved in normal or continuous
processes have expression regulated
-feedback inhibition regulates enzymes that
have already been synthesized
-genetic control mechanism control the
synthesis of new enzymes
1. Induction = mechanism that turns on the
transcription of a gene and thus
translation of its enzyme product
-tends to control catabolic pathway
enzymes
-gene expression induced by substrate for
pathway
-default position of gene expression is ‘off’
Mode of Action:
-Gene expression is off because active
repressor protein blocks RNA
polymerase
-Inducer (substrate) binds to repressor thus
inactivating it
-RNA polymerase now free to transcribe
gene (gene expression on)
-mRNA synthesized
-protein synthesized
Genetic Control Mechanisms:
-regulate transcription of mRNA, thus control
enzyme synthesis
Two Mechanisms:
1. Induction
2. Repression
Inducible gene system ! inducible enzyme
Amy Warenda Czura, Ph.D.
7
SCCC BIO244 Chapter 8 Lecture Notes
2. Repression = mechanism that inhibits gene
expression thus decreasing synthesis of
corresponding enzyme
-tends to control anabolic pathway enzymes
-gene expression repressed by final product
produced in pathway
-default position of gene expression is ‘on’
Mode of Action:
-Gene expression is on
-Repressor (regulatory protein) is activated
by corepressor (product)
-repressor + corepressor block RNA
polymerase
-no mRNA synthesis (gene expression off)
-no protein synthesis
All genes involved in one pathway are often
organized together on the chromosome
under control of one promoter in a unit
called an operon
An operon has only one promoter and one
operator that control all the genes at once:
all are expressed or none are.
Each gene has its own start & stop codon: all
will be transcribed on one mRNA but
during translation each ORF will form its
own separate protein.
Examples of genetic control of gene expression:
1. Lac Operon (on handout)
Terminator
Operon consists of:
1. Promoter: region of DNA where RNA
polymerase initiates transcription
2. Operator: region of DNA that serves as
stop/go signal for transcription
3. Genes: all the ORFs for all the enzymes in
the pathway linked end to end; each has its
own start and stop codon
4. Terminator: region of DNA where RNA
polymerase ends transcription
O
Terminator
Transcription
Translation
D
E
C
Amy Warenda Czura, Ph.D.
B
A
8
SCCC BIO244 Chapter 8 Lecture Notes
2. Tryptophan Synthesis Operon
(on handout)
Genetic Mutations
Mutation = change in base sequence of DNA
Silent mutation = no change in the activity of
the gene product
-no change in amino acid (often third base
in codon)
e.g. G-C-anything = alanine
-change in amino acid did not affect
function of the protein
Some mutations harmful:
decreased activity, loss of activity
Some mutations beneficial:
new or enhanced activity
(this drives evolution)
Types of mutations:
1. Base substitution / point mutation
single base at one point in DNA
replaced by another base
A. Silent point mutation: does not change
the amino acid
B. Missense point mutation: causes
insertion of the wrong amino acid
e.g. Sickle cell anemia:
A ! T, GAG ! GTG in hemoglobin
glutamic acid (+ charge) ! valine (neutral)
folded hemoglobin globular ! fibrous
RBCs round ! elongated (block
capillaries, don’t carry O2 well
C. Nonsense point mutation: creates a stop
codon in the middle of a gene - protein
will be incomplete
template
Amy Warenda Czura, Ph.D.
9
SCCC BIO244 Chapter 8 Lecture Notes
2. Frameshift mutation
one or a few nucleotides are deleted or
inserted - this can alter the translational
reading frame
e.g. AUG GCU ACC GUC...
Met - Ala - Thr - Val
insert A at 4th position:
AUG AGC UAC CGU C…
Met - Ser - Tyr - Arg-
Spontaneous mutations: occur in absence of
any mutation causing agent, represent the
error rate of DNA polymerase (1 in 109)
Mutagen = agent in environment that brings
about DNA mutation. Usually chemically
or physically interact with DNA to cause
change. Once mistake is fixed into the
DNA the change is permanent.
1. Chemical mutagens (examples)
A. Nitrous acid: converts A so it pairs with
C instead of T
template
Frameshift mutations almost always cause
long stretch of altered amino acids
resulting in inactive protein.
Nonsense mutations (stop codons) can also
be created
B. Nucleoside analogs: have chemical
structure similar to a base but do not
base pair correctly
e.g. 5-bromouracil incorporated in place
of T but base pairs with G not A
2. Radiation
A. x-rays and "-rays: create ions and free
radicals that break molecular bonds
B. UV: causes crosslinking of T bases
(Thymine dimer) which can prevent
unwinding for replication or
transcription
Cells have light repair enzymes called
photolyases which cut out damaged Ts
and replace them
C. Benzopyrene (cigarette smoke): causes
frameshift mutations: binds between
bases and offsets the double helix
strands, repair mechanisms add a base
to the other strand to re-set alignment
Amy Warenda Czura, Ph.D.
10
SCCC BIO244 Chapter 8 Lecture Notes
Nucleotide excision repair = enzymes that
function to cut out and replace DNA damage
1. damaged parts are removed leaving gap in
strand
2. gap is filled by complementary base pairing
from other strand
-often repair restores correct sequence
-sometimes errors are made during repair:
once nucleotide excision repair mechanisms
seal the DNA, mutation is permanent
Damage on one strand
Damage on both strands
ATGCTAGGCTATTATCG
TACGATCCGATAATAGC
ATGCTAGGCTATTATCG
TACGATCCGATAATAGC
ATGCT
TACGAT
GCTATTATCG
GATAATAGC
ATGCTA?GCTATTATCG
TACGAT?CGATAATAGC
Mutation rate = probability that gene will
mutate when cell divides
Spontaneous mutation rate ~10-9
(1 in a billion)
Average gene ~103 bp long, so approximately
1 in 106 genes mutated each replication
Mutations are random
If harmful, organism dies
If beneficial, organism thrives and passes
mutation to offspring (drives adaptation
and evolution)
Genetic Transfer and Recombination
genetic recombination = exchange of genes
between two DNA molecules to form new
combinations of genes on chromosome
-involves crossing over
Mutagens change rate 10-1000 fold: up to
1:1000 genes mutated each replication
Amy Warenda Czura, Ph.D.
11
SCCC BIO244 Chapter 8 Lecture Notes
Genetic recombination contributes to
population diversity: recombinations more
likely than mutations to provide beneficial
change since it tends not to destroy gene
function
Eukaryotes: recombination during meiosis for
sexual reproduction
-creates diversity in offspring but parent
remains unchanged
-vertical gene transfer = genes passed from
organism to offspring
-transfer involves donor cell that gives portion
of DNA to recipient cell
-when donor DNA incorporated into recipient,
recipient now called recombinant cell
-if recombinant cell acquired new
function/characteristic as result of new
DNA, cell has been transformed
Generation of recombinant cells is very low
frequency event (less than 1%): very few
cells in population are capable of
exchanging and incorporating DNA
Prokaryotes: recombination via gene transfer
between cells or within cell by
transformation, conjugation, or
transduction
-original cell is altered
-horizontal gene transfer = genes passed to
neighboring microbes of same generation
Three methods of prokaryotic gene transfer:
1. Bacterial Transformation
-genes transferred as naked DNA
-can occur between unrelated genus/species
-discovered by F. Griffith 1928 who studied
Streptococcus pneumoniae
-virulent strain had capsule
-non-virulent stain did not
-in mouse, dead virulent strain could
pass “virulence factor” to live nonvirulent strain
-competent cells can pick up DNA from dead
cells and incorporate it into genome by
recombination (e.g. antibiotic resistance)
-transformed cell
than passes
genetic
recombination
to progeny
competent =
permeable to
DNA:
alterations in
cell wall that
allow large
molecule like DNA to get through (in lab
we use chemical agents to poke holes)
-transformation works best when donor and
recipient are related but they do not have to
be
Amy Warenda Czura, Ph.D.
12
SCCC BIO244 Chapter 8 Lecture Notes
2. Conjugation
-genes transferred between two live cells via
sex pilus (Gram -) or surface adhesion
molecules (Gram +)
-transfer mediated by a plasmid: small circle
of DNA separate from genome that is self
replicating but contains no essential genes
-plasmid has genes for its own transfer
-Gram negative plasmids have genes for pilus
-Gram positive plasmids have genes for
surface adhesion molecules
Conjugation requires cell to cell contact
between two cells of opposite mating type,
usually the same species, must be same
genus
During conjugation plasmid is replicated and
single stranded copy is transferred to
recipient. Recipient synthesizes
complementary strand to complete plasmid
3. Transduction
-DNA from a donor is carried by a virus to a
recipient cell
Bacteriophage / Phage = virus that infects
bacterial cells
-each phage is species specific (donor and
recipient are the same species)
Transduction mechanism:
1. Phage attaches to donor cell and injects
phage DNA
3. New phages are
assembled: phage
DNA is packaged
into capsids
Occasionally
bacterial DNA is
packaged by mistake
4. Capsid containing
bacterial DNA
“infects” new host
recipient cell by
injecting the DNA
5. Donor DNA does not
direct viral
replication (not viral
DNA): instead
integrates into
recipient genome
-plasmid can remain as separate circle or
-plasmid can be integrated into host cell
genome resulting in permanent
chromosomal changes
2. Phage DNA directs donor cell to synthesize
phage proteins and DNA, phage enzymes
digest the bacterial chromosome
Amy Warenda Czura, Ph.D.
13
SCCC BIO244 Chapter 8 Lecture Notes
DNA entities used for genetic change:
(in both prokaryotes and eukaryotes)
1. Plasmids = self-replicating circle of DNA
containing “extra” genes
A. conjugative plasmids: used in bacterial
conjugation, at minimum contain genes for
pili or adhesion molecules
B. dissimilation plasmids: carry genes that
code for enzymes to trigger catabolism of
unusual carbs or hydrocarbons
C. pathogenicity plasmids: carry genes that
code for virulence traits ! capsules,
toxins, adhesion molecules, bacteriocins
D. resistance factor plasmids: carry genes for
resistance to antibiotic and toxins
-plasmids can be transferred between species:
-allows spread of antibiotic resistance
between different pathogens
-wide use of antibiotics has put selective
pressure on microbes to “develop” and
“share” resistance genes
2. Transposons = small segments of DNA that
can move independently from one region
of DNA to another
-discovered 1950s by McClintock: mosaic
pattern in indian corn (Nobel Prize 1983)
-transposons pop out and randomly insert at
rate of 10-5 to 10-7 per generation
-integration is random: can disrupt genes
-at minimum transposons carry genetic info to
carry out own transposition, may also carry
other genes
Simplest transposon = insertion sequence
-gene for transposase (enzyme that cuts DNA
at recognition sites and religates it
elsewhere in genome)
-two recognition sites called inverted repeats,
mark ends of transposon, recognized by
transposase
-complex transposons have inverted repeats
outside other genes
-genes will get carried with transposon when it
moves
-transposons can be carried between cells on
plasmids or by viruses, even between
species
-depending on where it inserts and what genes
it carries it can mediate good or bad
genetic changes
Amy Warenda Czura, Ph.D.
14
SCCC BIO244 Chapter 8 Lecture Notes