* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcriptional Attenuation
Designer baby wikipedia , lookup
Gene expression programming wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
X-inactivation wikipedia , lookup
Genome evolution wikipedia , lookup
Transfer RNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Frameshift mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Microevolution wikipedia , lookup
Gene expression profiling wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Non-coding DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
RNA interference wikipedia , lookup
Transcription factor wikipedia , lookup
Point mutation wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Polyadenylation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Genetic code wikipedia , lookup
Epigenetics of human development wikipedia , lookup
History of RNA biology wikipedia , lookup
RNA silencing wikipedia , lookup
Epitranscriptome wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
16 i5: 2494-2498. hermodynamic analysis of RNA tr . anscnpt ,Ii. Biochemistry 30: 1097-1118. mediated by lambdoid phage Q proteins" I York. . mtiterminator proteins of Escherich' za coli 'olymerase at a p-dependent terminator .-5305. and ;. 1989. Specificity and mechanism of ges A and 82.1. Mol. Bioi. 210: 453-460. . Roberts. 1987. Transcription antitermina_ ~gment spanning the RNA start site. Genes Transcriptional Attenuation Robert Landick Department of Biology Washington University 51. Louis, Missouri 63130 Charles L. Turnbough, Jr . Department of Microbiology University of Alabama at Birmingham Birmingham, Alabama 35294 sequence signalling transcription termina_ . A cad. Sci. 84: 6417-6421. OVERVIEW Transcriptional attenuation is a mechanism for gene regulation in which transcriptional termination at a specific site within an operon, called an attenuator, is controlled by a particular metabolic signal. In bacteria, there are many examples of attenuation that differ in the way that termination is made conditional. We have divided them into four classes based on their common features. A single, well-studied example of each class is described in detail, and other examples are mentioned to illustrate unique points. Possible cases of attenuation in eukaryotes are described. We also discuss the potential advantages and possible evolution of attenuation, as well as future prospects for studies in this field. INTRODUCTION In bacteria, transcriptional regulation can be accomplished by altering either initiation or termination of transcription. The control of gene e x p r e s - j sion by changes in the extent of termination at a site preceding one or more structural genes of an operon is called transcriptional attenuation. The interesting history of how attenuation was discovered dates to the original concept of repressors and operators, but is well documented in recent reviews (Artz and Holzschu 1983; Landick and Yanofsky 1987a) and, except for a brief account of the discovery of attenuation control of pyrimidine gene expression, is not recounted here. What has proven most fascinating about attenuation is that diverse mechanisms have evolved to control the level of many different genes by coupling transcript elongaTranscriplional Regulalion. Copyright 1992 Cold Spring Harbor Laboratory Press 0-87969-410-6/92 $3 + 00 407 408 R. Landick and C.L. Turnbough, Jr. tion to a wide variety of metabolic signals. We aim here to classify these mechanisms, to describe in detail the best-understood examples frorn each of these classes, and to offer speculations on what remains to be discovered. The possibility of attenuation in eukaryotes is discussed. w th 01 ar w Transcriptional Attenuation Involves Regulation of Specific Termination Signals Transcriptional attenuation might, in the broadest sense, include any phenomenon that reduces the extent or rate of transcription. In studies of bacterial gene regulation, however, it has acquired a more restricted definition and is used to describe a mechanism in which the level of transcriptional termination at a single, specific site within an operon, called an attenuator, is regulated in response to a physiologically relevant signal (Bauer et al. 1983). Thus, transcriptional attenuation can be distinguished from antitermination, which describes mechanisms that modify the transcription complex and diminish its response to most termination signals that it encounters after the modification (e.g., f.. N-dependent and Qdependent antitermination; see Greenblatt; Roberts; both this volume). Occasionally, transcriptional attenuation is confused with translational attenuation. Translational attenuation regulates the ability of ribosomes to initiate translation of certain genes, notably the antibiotic resistance genes cat and ermC in gram-positive bacteria, by changes in RNA folding that affect accessibility of the ribosome-binding site (Weisblum 1983; Lovett 1990). Although alternative RNA folding also is a feature of many transcriptional attenuation mechanisms, translational attenuation differs fundamentally and is not addressed here. d( a nj g( al e. w (f ty f( e g ~ Classes of Attenuation Mechanisms Transcriptional attenuation was discovered about 15 years ago during the study of Escherichia coli trp and Salmonella typhimurium his operon expression. Within only a few years, the mechanisms of trp and his attenuation were found to be similar in their key features, and analogous mechanisms were found for several other amino acid biosynthetic operons in enteric bacteria. During the past 10 years, however, numerous examples of attenuation employing fundamentally different mechanisms for controlling transcriptional termination have been uncovered in a variety of bacterial operons. Previous reviews have listed many of these (Bauer et al. 1983; Landick and Yanofsky 1987a). It now seems to us an appropriate time to attempt to classify these mechanisms by their common features. Four principal classes are evident to us: (1) mechanisms in Transcriptional Attenuation lals. We aim here to classify these ~ best-understood examples f rom . ilatlOns on what remains to be d'IS. m eukaryotes is discussed. Julation of the broadest sense, include any rate of transcription. In studies of t has acquired a more restricted :hanism in which the level of trancific site within an operon, called o a physiologically relevant signal al attenuation can be distinguished mechanisms that modify the tranponse to most termination signals ion (e.g., A N-dependent and Q_ )latt; Roberts; both this volume). on is confused with translational regulates the ability of ribosomes , notably the antibiotic resistance )acteria, by changes in RNA foldibosome-binding site (Weisblum ive RNA folding also is a feature ~hanisms, translational attenuation sed here. ~red about 15 years ago during the mella typhimurium his operon exnechanisms of trp and his attenua:ey features, and analogous mechnino acid biosynthetic operons in ars, however, numerous examples ly different mechanisms for con'e been uncovered in a variety of ve listed many of these (Bauer et 7a). It now seems to us an ap:!se mechanisms by their common vident to us: (1) mechanisms in 409 which the position of a translating ribosome dictates the formation of either an RNA secondary structure that causes transcriptional termination or an alternative secondary structure that precludes termination (e.g., amino acid biosynthetic operons in enteric bacteria), (2) mechanisms in which the extent of coupling between transcription and translation determines whether or not a ribosome can directly block the formation of a termination RNA hairpin (e.g., the E. coli pyrB! operon), (3) mechanisms in which a trans-acting factor binds to the nascent transcript to govern formation of a terminator structure either directly or through alternative folding of RNA (regulatory-factor-dependent attenuation; e.g., the E. coli ~-glucoside utilization operon), and (4) mechanisms in which p-dependent termination is modulated to control gene expression (p-dependent attenuation; e.g., the E. coli tryptophanase operon). Other types of attenuation mechanisms are easily imaginable and may well be found in other prokaryotic operons or in eukaryotes. ATTENUATION CONTROL IN THE AMINO ACID BIOSYNTHETIC OPERONS OF ENTERIC BACTERIA: RIBOSOME POSITIONING CONTROLS FORMATION OF ALTERNATIVE RNA SECON9ARY STRUCTURES THAT GOVERN TRANSCRIPTIONAL TERMINATION Very similar attenuation control mechanisms have been described for the trp, his, leu, thr, ilvGMEDA, ilvBN, and pheST operons from various enteric bacteria. All these operons except pheST encode amino acid biosynthetic enzymes; pheST encodes phenylalanyl-tRNA synthetase. In each case, a leader region between the promoter(s) and first structural gene contains a p-independent transcriptional terminator, the attenuator, which specifies a G+C-rich RNA hairpin immediately preceding a long (typically 7-9), continuous run of uri dine residues. Both the RNA hairpin structure and the run of uridines are required for termination (Yager and von Hippel 1987). Each leader transcript can form two mutually exclusive secondary structures. One of these structures includes the attenuator-encoded RNA hairpin required for termination (termination conformation; Fig. 1). The other secondary structure precludes formation of the terminator hairpin, thereby allowing transcription to continue beyond the attenuator and into the structural genes of the operons (readthrough conformation; Fig. 1). The relative proportion of these two leader RNA conformations, and hence the degree of transcriptional attenuation, depends on the position of a ribosome engaged in translation of a leader peptide coding region. Within the leader peptide coding region for each of these operons are from 2 (trp) to 15 (ilvGMEDA) 410 R. Landick and C.L. Turnbough, Jr. 2:3 Readthrough Conformation materi operor tures ( be sub •••••• • UGA A Refil Pause RNA Hairpin Alternative RNA Secondary Structures of the Leader Transcript The E versio regior Terminator Hairpin UG 1:2 3:4 14-re~ Termination Conformation Leader Peptide • Coding Region • RNA UUUUUUU i (Fig. tween transl achie' Transcription DNA I Promoter Transcription Start First r 2 _3_ _4_ Gene ATG • • • • • • • • • TGA ;:0- Leader Peptide Coding Region Structural ~ ~ Pause Site / c= Attenuator A AAGUU Figure 1 Basic features of an attenuator control region. The example given is for an amino acid biosynthetic operon that is controlled by attenuation. However, with occasional modification, the same terms can be used to describe features of other types of attenuator control regions. Note that the first secondary structure shown for the termination conformation (pause RNA hairpin) is not present when a ribosome is stalled on the attenuation control codons. "control codons" that specify an amino acid end product (or substrate for pheST) of the enzymes encoded by the operon. When a ribosome stalls at one of these control codons due to an inadequate supply of the cognate aminoacyl-tRNA, the leader RNA forms the readthrough conformation. When the supplies of aminoacyl-tRNAs allow efficient translation, the ribosome quickly reaches the leader peptide stop codon, where it blocks formation of the readthrough conformation, allowing the nascent transcript to form the terminator hairpin and prevent transcription beyond the attenuator. Thus, readthrough occurs when the supply of the controlling amino acid is low, and termination occurs when the supply is adequate. The experimental support for this model is overwhelming and has been reviewed in detail elsewhere, together with complete descriptions of each example (Kolter and Yanofsky 1982; Artz and Holzschu 1983; Bauer et a1. 1983; Landick and Yanofsky 1987a). Rather than restate this B FigL Ten Transcriptional Attenuation 2:3 Readthrough Conformation 411 material, we present here a refined model for attenuation in the trp operon, as an archetypical example, and the data that support key features of this model, emphasizing aspects of attenuation that continue to . be subjects of active investigation. JGA A Refined Model for Attenuation in the \ Hairpin Terminator Hairpin 3:4 Termination Conformation uuuuuuu trp Operon The E. coli trp operon encodes five polypeptides that catalyze the conversion of chorismate to tryptophan. The 172-nucleotide trp leader region specifies two alternative RNA secondary structures and encodes a 14-residue leader peptide that includes two adjacent tryptophan residues (Fig. 2). The attenuation mechanism requires very tight coupling between RNA polymerase synthesizing the leader transcript and a ribosome translating the leader peptide coding region. This synchronization is achieved by strong transcriptional pausing at a site immediately after the ranscription _2_ _3_ _4_ ,.. .............. Pause Site ,/" First Structural Gene r-= A A AA Stop 70 G Attenuator rol region. The example given is for ontrolled by attenuation. However i can be used to describe features of ,te that the first secondary structure lause RNA hairpin) is not present control codons. f AAGUUCACG 10U A A A A ~ 3:4 A AU U G C 120 CEt A~C G UA G G UU GEC G Trp GEC CEG130 U U=A CEG 20 A Trp GEC CEG U Met Lys Ala lie Phe Val Leu Lys Gly G EC 90 GE C CGACAAUGAAAGCAAUUUUCGUACUGAAAGGUU = A AUCAGAUACCCA= UUUUUUUU 30 cid end product (or substrate for Jeron. When a ribosome stalls at ladequate supply of the cognate ; the readthrough conformation. , allow efficient translation, the tide stop codon, where it blocks :ion, allowing the nascent tranprevent transcription beyond the en the supply of the controlling ; when the supply is adequate. lodel is overwhelming and has er with complete descriptions of )82; Artz and Holzschu 1983; 1987a). Rather than restate this C U G CEG Ser CEG U C U=A Thr CEGM A=U CEG 40 50 U=A 110 140 /GEC GCE ~'00 PAUSE UAA B Figure 2 Alternative secondary structures of the trp leader transcript. (A) Termination conformation. (B) Readthrough conformation. 412 R. Landick and C.L. Turnbough, Jr. DNA segment that encodes the 1:2 RNA hairpin (Fig. 2). RNA polymerase is released from the pause site when the ribosome approaches on the nascent transcript. Once RNA polymerase leaves the pause site, the rate at which th ribosome synthesizes the remainder of the leader peptide and releases the mRNA, relative to the rate at which polymerase transcribes the at~ tenuator, determines the extent of attenuation. One of five outcomes can occur (Fig. 3). First, if the ribosome stalls at the tryptophan Control co dons, the transcript will form the 2:3 RNA structure, precluding forma_ tion of the 3:4 terminator structure and causing readthrough of the attenuator (outcome 1; readthrough, Fig. 3). If the ribosome moves rapidly to the leader peptide stop codon, three additional outcomes are possible. The ribosome may release very quickly, allowing 1:2 to reform prior to synthesis of 3 and cause terminator hairpin formation (outcome 2; not shown in Fig. 3). The ribosome may release after synthesis of segment 3, allowing competition between 1:2 and 2:3 formation and readthrough of the attenuator when the 2:3 RNA hairpin forms (outcome 3; basal level readthrough, Fig. 3); or the ribosome may not release until after transcription of the attenuator, in which case its presence will preclude 2:3 formation and caw~e formation of the terminator (outcome 4; termination, Fig. 3). Finally, if'no ribosome initiates translation of the leader peptide coding region, RNA polymerase eventually will escape the pause site and synthesize the remainder of the leader RNA in the 1 :2+3:4 termination conformation (outcome 5; superattenuation, Fig. 3). When intracellular tryptophan is abundant, approximately 90% of the transcripts terminate at the attenuator, producing the 141-nucleotide leader transcript (Fig. 2). The 10% readthrough transcription accounts for basal level trp expression. Under superattenuation conditions, where leader peptide synthesis is prevented, readthrough at the trp attenuator is reduced to 2-3%. The increase in basal level readthrough caused by leader peptide synthesis can be explained by the extent of ribosome release from the leader peptide stop codon before synthesis of RNA segment 4 (outcome 3; basal level readthrough, Fig. 3). Superattenuation when translation is inefficient and variation of the rate of ribosome release may allow attenuation control to respond to physiological changes other than depletion of the cognate aminoacyl-tRNA for the leader peptide control codons. Interestingly, the presence or absence of tryptophan in the growth medium does not affect readthrough of the trp attenuator in a prototrophic bacterium; tryptophan starvation sufficient to increase readthrough occurs only when induced by mutations in the biosynthetic pathway or by addition of inhibitors, or transiently when bacteria grown in tryptophan-containing media are transferred to mini- "franscril pa~ses Aft RIBOSO~ Rib< Allo\ 2:3 Hairpi Prevenl Formatia of t~ "ferminatl REJl Fit m; no m: at" cc te Transcriptional Attenuation R~A hairpin (Fig. 2). RNA ~ site when the ribosome INITIAL STAGES OF TRANSCRIPTION DNA--~ ap_ lUse site, the rate at which the ~ leader peptide and releases the polymerase transcribes the atttion. One of five outcomes can taIls at the tryptophan Control ~A structure, precluding formacausing read through of the at. If the ribosome moves rapidly Iditional outcomes are Possible. allowing 1:2 to reform prior to 'Pin formation (outcome 2; not lse after synthesis of segment 3, 3 formation and readthrough of I forms (outcome 3; basal level ay not release until after tran: its presence will preclude 2:3 dnator (outcome 4; termination, ranslation of the leader peptide illy will escape the pause site r RNA in the 1:2+3:4 term inalation, Fig. 3). iant, approximately 90% of the producing the 141-nucleotide ough transcription accounts for ·attenuation conditions, where Ithrough at the trp attenuator is level read through caused by ~d by the extent of ribosome I before synthesis of RNA segugh, Fig. 3). Superattenuation ttion of the rate of ribosome to respond to physiological nate aminoacyl-tRNA for the ly, the presence or absence of It affect read through of the trp )tophan starvation sufficient to induced by mutations in the nhibitors, or transiently when media are transferred to mini- 413 J... y~ ~ LEADER TRANSCRIPT 1:2 Transcription Complex. Pauses After 1:2 SynthesIs RNA POLYMERASE Fails to Bind TranscriPt) ibosome Binds to Transcript 1:2 RIBOSOME £ 0 ... ~ C1C A ~:2 3:4 Ribosome Ribosome Disrupts the 1:2 RNA Hairpin and Releases the ~paused Tra:scriPtion Complex PPP SUPERATTENUATION PP TRP STARVATION Ribosome Stalls on Trp C O d o n S ' A Allowing Formation of 2:3 Hairpin Ribosome Moves to Stop Codon 2:3 Ribosome Releas~~ / at Stop COd~ 1 2:3 Hairpin Prevents Formation of the Terminator o I ..J....: 3 2A 2:3 2:3 Forms; Terminator (3:4) ~ READTHROUGH Formation of 2:3 is Blocked; Terminator Forms BI,ok,d BASAL LEVEL READTHROUGH .~ "w"""""" 1:2 Forms; Terminator (3:4) TranscrlPQ Released ~ TERMINATIO~ Figure 3 Model for attenuation in the trp operon. See text for description. mal media (Yanofsky et al. 1984; c. Yanofsky, pers. comm.). Thus, the normal contribution of attenuation control to regulation of the trp operon may reflect predominantly changes in basal level readthrough and superattenuation rather than ribosome stalling on the tryptophan control codons as ~onventionally presented. This may be an adaptation of the attenuation mechanism in an operon also regulated by repression. The at- 414 R. Landick and C.L. Turnbough, Jr. tenuation response to extreme tryptophan starvation may allow r . . . aval'1 a b'l' I Ity, w h ereas repression Contapld I a d aptatIon to c h ange d nutnent . . d' . ro s operon expression at mterme late concentrations of tryptoph (Yanofsky et al. 1984). In some operons in which attenuation is the so~n regulatory mechanism, for instance, ilvGMEDA and thr, changes in at~ tenuator readthrough clearly occur in the normal range of amino acid concentrations. The Leader Transcript Forms Alternative RNA Secondary Structures Evidence for the role of alternative RNA secondary structures in controlling atterruation is compelling and has been reviewed in detail previously (Kolter and Yanofsky 1982; Artz and Rolzschu 1983; Bauer et al. 1983' Landick and Yanofsky 1987a). Distinct, but analogous, structures occu; in the termination and read through conformations of leader transcripts from the various amino acid biosynthetic operons that are regulated by attenuation (see Landick and Yanofsky 1987a). For instance, the termination conformation of the his leader transcript contains three significant RNA hairpiI!s and the readthrough conformation contains two. Studies of the his '(Johnston and Roth 1981) and trp (Kolter and Yanofsky 1984) attenuation control mechanisms confirmed that many base changes that alter the relative stability predicted for the termination and readthrough conformations of the leader transcript increase or decrease attenuation in a manner consistent with the model. Two results from these studies are particularly important in showing that an alternative RNA secondary structure causes readthrough of the attenuator: (1) The trpL75 mutation, which changes G75 to A (Fig. 2), destabilizes the structure 2:3 without affecting 1:2 or 3:4 and prevents increased readthrough of the trp attenuator during tryptophan starvation (Kolter and Yanofsky 1982 and references therein); and (2) the his09712 and his09713 mutations, which individually cause increased termination at the his attenuator because they change, respectively, the 5' and 3' base of a key C:G base pair in the readthrough conformation of the his leader transcript, restore wild-type expression when they are recombined to create an A:U base pair in the structure (R. M. Johnston and J. R. Roth, pers. comm.). Three other key findings also strongly support the role of alternative RNA secondary structures in attenuation: (1) Systematic deletions of RNA segments 1, 2, and 3 in both the Serratia marcescens (Stroynowski and Yanofsky 1982) and E. coli (Landick et al. 1990) trp leader transcripts yield alternately increased and decreased readthrough of the at- ten uator , a la ted trp h tures of th Yanofsky oligonucle readthro u ! of the rea( The ke well docu at the attl stem of t1 al. 1983; more, usi Iy by in mutation strand, a present i and Gan least six required thymidil terminal Translal Not the The im from th Landic histidir readtht Iy, inc structu mutati (hisT) synthe tenuat codon upon chang codin defec Transcriptional Attenuation starvation may all ow rap'd 1, whereas repression c I . ontrols )ncentratlOns of try t · h P ophan 1 w h IC attenuation is th ,r e sole tlEDA and thr change . , s In atnormal range of amino . 1 aCId A econdary structures in control_ reviewed in detail previously ~schu 1983; Bauer et al. 1983' ut analogous, structures occu'r . rmatlOns of leader transcripts operons that are regulated b ( 1987a). For instance, th~ r transcript contains three sig;h conformation contains two. 1981) and trp (Kolter and lanisn:s confirmed that many 'i predicted for the termination leader transcript increase or It with the model. Two results mt in Showing that an alternalthrough of the attenuator: (1) to A (Fig. 2), destabilizes the and prevents increased readtophan starvation (Kolter and and (2) the his09712 and :ause increased termination at ;pectively, the 5' and 3' base conformation of the his leader vhen they are recombined to r. M. Johnston and J. R. Roth, I support the role of alternative : (1) Systematic deletions of atia marcescens (Stroynowski k et a1. 1990) trp leader tran:reased readthrough of the at- 415 tenuator, as the model predicts; (2) the ribonuclease sensitivities of isolated trp leader RNAs are consistent with the proposed secondary structures of the leader transcript (Fig. 2) (Oxender et a1. 1979; Kuroda and Yanofsky 1984); and (3) addition to in vitro transcription reactions of an oligonucleotide complementary to trp RNA segment 1 causes attenuator readthrough, apparently by shifting the base-pairing equilibrium in favor of the readthrough conformation (Fisher and Yanofsky 1984). The key role of the 3:4 terminator RNA structure has been especially well documented. In the his, trp, leu, and thr leader regions, termination at the attenuator is reduced by mutations that disrupt base pairs in the stem of the terminator hairpin (see Kolter and Yanofsky 1982; Bauer et al. 1983; Landick and Yanofsky 1987a and references therein). Furthermore, using the trp and thr leader regions, it has been shown convincingly by in vitro transcription of heteroduplex DNA templates that such mutations affect attenuation only when they reside in the transcribed strand, and thus appear in the RNA transcript, and not when they are present in the non transcribed strand (Ryan and Chamberlin 1983; Yang and Gardner 1989). Finally, Gardner and co-workers have shown that at least six of the nine tandem thymidine residues in the thr attenuator are required for efficient termination and that successive removal of more thymidines linearly decreases termination, until, when only two remain, termination is abolished (Lynn et a1. 1988). Translation of the Leader Peptide Coding Region, Not the Peptide Product, Controls Attenuation The importance of translation in controlling attenuation was first evident from the effects of mutations that affect tRNA structure or charging (see Landick and Yanofsky 1987a). Mutations in the genes for the tryptophan, histidine, leucine, and threonine aminoacyl-tRNA synthetases increase readthrough of the trp, his, leu, and thr attenuators, respectively. Similarly, increased readthrough of attenuators is caused by mutations in the structural genes for tRNATrp and tRNAHis and by the miaA and hisT mutations, which affect isopentenylation (miaA) and pseudouridylation (hisT) of certain tRNAs. The regulatory requirement for leader peptide synthesis was established most clearly in genetic studies of his and trp attenuation. In both cases, mutations that alter the leader peptide initiation codon reduce operon expression and eliminate increased readthrough upon amino acid starvation; some of the his mutations and several changes in the ribosome-binding site for S. marcescens trp leader peptide coding region give intermediate phenotypes consistent with a partial defect in translation. ~ r .... 416 R. Landick and C.L. Turnbough, Jr. Synthesis of the leader peptide has been demonstrated by expressi of genes (such as lacZ) fused to the leader peptide coding region and ~n direct detection of the unstable leader peptide both in vitro and in Vi/ 0 (see Landick and Yanofsky 1987a). However, all tests for a trans-actin function for the leader peptide have been negative: It is the act of transla~ tion, rather than its product, that controls attenuation. Once the regulatory decision is made, after one round of leader peptide synthesis the completed leader transcript blocks additional (and wasteful) transla~ tion by complementary base pairing between the leader peptide ShineDalgarno sequence and a distal segment of the transcript (see Landick and Yanofsky 1987a). Analysis of several mutations that result in new stop codons at his leader peptide positions 4, 5, and 7 suggests that the ribosome must move to within 16 bases of the bottom of the A:B RNA hairpin (equivalent to the trp 1:2 hairpin) before it can block formation of this structure (Johnston and Roth 1981; for review, see Landick and Yanofsky 1987a). Suppressor and frameshift mutations that allow the ribosome to translate past the normal stop codon in both the his (Johnston and Roth 1981) and thr (Roghani et al. 1985) leader regions increase transcriptional readthrough, apparently because the translating ribosome directly blocks formation of the terminator hairpin. Experiments in which attenuation control codons have been replaced by codons for other amino acids have verified the essential role of the control codons for regulation of attenuation and confirmed that the leader peptide lacks other functions. Interestingly, simple substitution of one set of codons for another does not always result in equivalent control of attenuation by the level of the new cognate charged tRNA. Replacement of the 8 threonine (7 ACC, 1 ACA) control codons in the thr leader region with either 5 or 8 histidine (CAC or CAT) codons eliminates response to threonine starvation and does cause increased readthrough in hisT (a tRNAHis_modifying mutation) strains (Lynn et al. 1987). However, replacement with either 2 arginine (1 CGU, 1 CGA) or 2 phenylalanine (UUC) codons of 2 leucine control codons (1 CUU, 1 CUA) in the E. coli ilvGMEDA leader region does not produce increased readthrough in response to starvation for arginine or phenylalanine (Chen et al. 1991). Furthermore, replacement of the 4 leucine (3 CUA, 1 CUG) control codons in the E. coli leu leader region with ACU threonine codons, which eliminates regulation in response to leucine starvation, gives only modest response to a defect in tRNAThr charging (Carter et al. 1985). Reducing the number of the rare CUA leucine codons to 1 or 2 decreases read through in response to leucine starvation, whereas incorporation of 6 or 7 CUA codons increases the sensitivity of response (Bartkus et al. 1991). which rnore e attenm isoacc1 rnent ( AGG tenuat, 1990) regula attenu tween ing ril Trans Trans One scrip1 until ling' duce for tl of R vide, (Pau ham anal ilvE Barl ther unti pol: knc cen ing reg of loc cre po Transcriptional Attenuation ~en demonstrated by exp . . resslon ~r ~eptlde codIng region and b ~PtJde both in vitro and' . y In VIVO ever, all tests for a trans . '. -actIng negatIve: It IS the act of tr ans Iamtrols attenuation. Once th :md of leader peptide synth . e ' . I eSIS Id ItIOna (and wasteful) tr I ' ans a.veen the leader peptide Sh'Ineof the transcript (see Landick ~ . suit in new stop codons at his itS that the ribosome must move ":B RNA ~airpin (equivalent to :k formatIon of this structur Landick and Yanofsky 1987a)~ allow the ribosome to translate , ~Johnston and Roth 1981) and ; Increase transcriptional readting ribosome directly blocks trol codons have been replaced ~rified the essential role of the n and confirmed that the leader I, simple substitution of one set mIt in equivalent control of at;harged tRNA. Replacement of codons in the thr leader region I codons eliminates response to reased readthrough in hisT (a 'nn et al. 1987). However, reT, 1 CGA) or 2 phenylalanine 1S (1 CUU, 1 CUA) in the E. lduce increased read through in nylalanine (Chen et al. 1991). ne (3 CUA, 1 CUG) control with ACU threonine codons I leucine starvation, gives onl; charging (Carter et al. 1985). :ine codons to 1 or 2 decreases Dn, whereas incorporation of 6 ty of response (Bartkus et al. 417 1991). A simple interpretation of these findings is that rare codons for which the cognate tRNA isoacceptor is present at low concentration are more effective at causing ribosome stalling, and thus readthrough of the attenuator, than frequently used codons for which the cognate tRNA isoacceptor is abundant. Two other results support this idea: (1) Replacement of the tryptophan control codons with a UGC cysteine and a rare AGG arginine codon increases basal level readthrough of the trp attenuator and abolishes response to a tRNATrp defect (Landick et al. 1990) and (2) a single rare CUA leucine codon is sufficient to allow regulation by charged tRNALeu levels of the S. marcescens ilvGMEDA attenuator (Hsu et al. 1985). Another possibility is that interactions between charged tRNAs on adjacent codon pairs are important in determining ribosome step-time (Gutman and Hatfield 1989). Transcriptional Pausing Couples Translation with Transcription Early in the Leader Region One problem confronting early models for attenuation was how transcription of the attenuator by every RNA polymerase could be delayed until a ribosome reached the tryptophan control codons. Complete coupling was required by the finding that extreme tryptophan starvation produced 100% readthrough but seemed inconsistent with the time required for translational initiation and with the stochastic nature of the movement of RNA polymerase and ribosomes. An answer to this puzzle was provided by the discovery that RNA polymerase pauses at a discrete site (Pause, Fig. 2) immediately after synthesis of the 1:2 RNA hairpin (Farnham and Platt 1981; Winkler and Yanofsky 1981). Similar pause sites at analogous positions now have been documented in the thr, ilvGMEDA, ilvBN, his, and leu operon leader regions (see Chan and Landick 1989; Bartkus et al. 1991; and Landick and Yanofsky 1987a and references therein). This suggests that pausing at these sites may halt transcription until a ribosome initiates translation and approaches the paused RNA polymerase. From extensive studies on pausing in the trp leader region in vitro, we know that pausing is increased by the NusA protein and by low concentrations of GTP (the next nucleotide added after the pause); that pausing can be decreased by translation of the trp leader peptide coding region, by addition of an oligonucleotide complementary to the 5' side of the pause RNA hairpin, and by base changes in the stem but not the loop region of the 1:2 RNA hairpin; and that pausing can be either increased or decreased by amino acid substitutions in the Bsubunit of RNA polymerase that similarly increase or decrease transcriptional termination 418 R. Landick and C.L. Turnbough, Jr. (see Landick and Yanofsky 1987a and referenc.es therein; Landick et al. 1990). The trp pause RNA ha~ b~en detected 10 E. coli (Landick et al. 1987). Where tested, parallel fmdmgs have been made with other pau . I'Iste d ab ove. se sItes Both the RNA hairpin structure and the DNA sequence downstrea from the pause site are key determinants of pausing. Base changes from 3 to 12 nucleotides past the trp pause. site can reduce pausing by up to~ factor of 3 (Lee et al. 1990). InterestIngly, when placed after the pause site, both A+ T- and G+C-rich sequences reduce pausing; apparently interactions between the wild-type downstream DNA sequence and RNA polymerase decrease its propensity for elongation. However, the essential role of the RNA hairpin is equally clear. Replacement of either the G or C alone in G:C base pairs in the upper stem of the his pause RNA hairpin reduces transcriptional pausing, but pausing is restored to wild-type levels when two mutations are combined to produce a C:G base pair (C.L. Chan and R. Landick, in prep.). There are several possible mechanisms for the effect of RNA hairpin formation on transcriptional elongation: (1) The hairpin could disrupt a configuration of the transcript required for elongation, (2) it could interact allosterically with RNA polymerase to change its catalytic properties, (3) it could interact with RNA polymerase and block enzyme movement on the DNA template, or (4) it could obstruct the binding of nucleoside triphosphates to the active site. Recent studies suggest that the eight nucleotides of template-strand DNA immediately upstream of the active site are paired to the 3' end of the nascent transcript in transcription complexes paused at the trp and his leader pause sites and in complexes halted at non-pause sites by nucleoside triphosphate deprivation (Lee and Landick 1992). Furthermore, an analysis of the effects on pausing of base substitutions throughout the his pause hairpin suggests that only the upper 5 bp of the hairpin form in the paused transcription complex (C.L. Chan and R. Landick, in prep.). This region corresponds to the upper 6 bp of the trp 1:2 hairpin (Fig. 2). These results suggest that pause hairpin formation does not inhibit elongation by disrupting the normal configuration of the 3' proximal region of the transcript. Several explanations also are possible for NusA-enhancement of pausing: (1) NusA could interact with RNA polymerase to increase the Km for nucleoside triphosphates, (2) it could contact and stabilize the RNA hairpin, or (3) it could induce RNA polymerase to stabilize the hairpin. RNase T1 digestion studies of isolated trp paused transcription complexes revealed that NusA protects some sites in the hairpin against nuclease cleavage (Lan dick and Yanofsky 1987b). Additionally, some alterations to the pause hairpin reduce the effect of NusA on pausing (1 w et or VI aT aT tr: pi ar fc is D th al Ie Y dl hI til al TI LI U tr P tt R f( b: tl tl \\ \\ t( n l o c Transcriptional Attenuation ~renc.es therei~; Landick et al, :ted m E. colz (Lan dick et I · a. : been rna de with other pause : DNA. sequence downstrea m f pausmg. Base changes from :an reduce pausing by up to a . when placed after the pause educe pausing; apparently inam DNA sequence and RNA gation. However, the essential eplacement of either the G or of the his pause RNA hairpin ing is restored to wild-type to produce a C:G base pair for the effect of RNA hairpin ) The hairpin could disrupt a elongation, (2) it could inter:hange its catalytic properties, and block enzyme movement 'uct the binding of nucleoside tudies suggest that the eight diately upstream of the active ent transcript in transcription pause sites and in complexes ~osphate deprivation (Lee and of the effects on pausing of hairpin suggests that only the d transcription complex (C.L. m corresponds to the upper 6 llltS suggest that pause hairpin ;rupting the normal configuraript. e for NusA-enhancement of A polymerase to increase the mId contact and stabilize the \ polymerase to stabilize the lated trp paused transcription ne sites in the hairpin against r 1987b). Additionally, some ~ effect of NusA on pausing 419 (Landick and Yanofsky 1984; c.L. Chan and R. Landick, in prep.), whereas changes to the downstream DNA sequence have no effect (Lee et al. 1990). Thus, NusA appears either to interact with the pause hairpin or to stabilize an RNA polymerase/pause hairpin interaction. In summary, there is much circumstantial evidence to support the view that in vivo RNA polymerase becomes arrested at the trp pause site and equivalent sites in the leader regions of other attenuation-controlled amino acid biosynthetic operons until a ribosome approaches during translation of the leader transcript and releases the enzyme, either by physical contact or by dissociation of the 1:2 RNA hairpin. On evolutionary grounds, pausing must playa key role, since pause sites have been found at the expected locations in every case examined and since pausing is favored both by the upstream RNA hairpin and by the downstream DNA sequence. Furthermore, leader region alterations that should stall the ribosome before it can reach the paused RNA polymerase (Bartkus et al. 1991; Chen et al. 1991) or that increase the distance between the leader peptide start codon and the paused polymerase by 55 codons (C. Yanofsky, pers. comm.) do not uncouple transcription and translation during attenuation. These data all argue for the importance of pausing; however, final proof that it is required for proper regulation of attenuation, by demonstrating an effect of loss of pausing in a way that does not alter leader transcript folding, remains an un met experimental challenge. The Extent of Ribosome Release Determines Basal Level of Readthrough Transcription Until recently, it has been unclear whether a ribosome that reaches the trp leader peptide stop codon releases rapidly allowing the 1:2 RNA hairpin to reform and block formation of the read through conformation or if the ribosome releases slowly and directly blocks formation of the 2:3 RNA secondary structure. Viable models for attenuation control can be formulated using either scenario. Two lines of evidence suggest that the latter explanation is correct and that the rate of release of the ribosome at the stop codon may be responsible for the higher basal level of readthrough observed in cells growing in excess tryptophan, relative to cells where leader peptide synthesis is blocked. First, Yanofsky and coworkers found that mutations in ribosome release factors 1 or 2 increase termination at the trp attenuator only when the leader peptide stop codon matches the release factor specificity (UAA and UAG for RF1; UAA and UGA for RF2; Roesser and Yanofsky 1988; Roesser et al. 1989). Second, replacement of the second tryptophan control codon with a UGA codon increases attenuator readthrough to approximately 90% even when 420 R. Landick and C.L. Turnbough, Jr. cells are grown in excess tryptophan, apparently because the slowly releasing ribosome at the new UGA codon simulates a ribosome stalled at the tryptophan control codons in a wild-type bacterium (Landick et al. 1990). A similar result was found when an ilvGMEDA control codon was replaced with a UGA codon (Chen et al. 1991). Careful analysis of the effects of release factor mutants in strains with various altered trp leader regions led Yanofsky and co-workers to conclude that approximately 24% of ribosomes release from the leader peptide stop codon while RNA polymerase is still transcribing the leader region. Thus, the normal 15% basal level readthrough in cells growing in excess tryptophan can be accounted for by an equal probability of forming either the termination or read through conformation of the leader transcript once the ribosome has released, coupled with the approximately 3% readthrough inherent in the trp attenuator (measured in strains where leader peptide synthesis is blocked). In other enteric bacteria, different relative stabilities of the 1:2 and 2:3 RNA secondary structures appear to determine a basal level of attenuator readthrough most appropriate for the species (Yanofsky 1984). Another Example f The ermK gene from Bacillus licheniformis encodes an erythromycininducible 23S rRNA methylase that confers resistance to the macrolide, lincosamide, and streptogramin B antibiotics. Recent data indicate that ermK expression is regulated by transcriptional attenuation analogous to that described above, except that the position of the ribosome translating the leader transcript, and thus the selection of leader transcript secondary structure, is controlled by erythromycin-dependent stalling of translation (Kwak et al. 1991). ATTENUATION CONTROL OF PYRIMIDINE GENE EXPRESSION: TIGHTLY COUPLED TRANSCRIPTION AND TRANSLATION PERMIT A RIBOSOME TO DIRECTLY BLOCK THE FORMATION OF A TERMINATOR RNA HAIRPIN The discovery of similar attenuation control mechanisms regulating several amino acid biosynthetic operons raised the possibility that this type of regulation might be limited to genes involved in amino acid metabolism. The first clear indication to the contrary came from studies of pyrimidine biosynthesis in E. coli and S. typhimurium. In these bacteria, the de novo synthesis of UMP, the precursor of all pyrimidine nucleotides, is catalyzed by six enzymes encoded by six unlinked genes and small operons designated carAB, pyrBI, pyre, pyrD, pyrE, and pyrF (Net beg 2 that tiati4 puta dere pyri mec Trar The (pyl (Al seV4 (Sc: DN p-ir fan Sch of I thi~ attf lea stn dif sec Fir bir in an tel trc Ie; pr R se in ce Transcriptional Attenuation lpparently because the I . s OWly sImulates. a ribosome stalied -type bactenum (Landick . et al I livGMEDA control codo . n Was 1~91). ~areful analysis of the wIth vanous altered trp leader I conclude that approximat I 'd ey peptJ e stop codon while RNA region. Thus, the normal 15% n excess tryptophan can be ac'ming. either the termination 0 r mscnpt once the ribosome has 3% readthrough inherent in the re leader peptide synthesis is nt relative stabilities of the 1:2 . to determine a basal level of 'r the species (Yanofsky 1984). In nis encodes an erythromycinrs resistance to the macrolide tics. Recent data indicate tha~ jonal attenuation analogous to ion of the ribosome translating of leader transcript secondary :pendent stalling of translation EXPRESSION: ;LATION ntrol mechanisms regulating 'aised the possibility that this :s involved in amino acid me:ontrary came from studies of 'Phimurium. In these bacteria, precursor of all pyrimidine ncoded by six unlinked genes r, pyre, pyrD, pyrE, and pyrF 421 (Neuhard and Nygaard 1987). Studies of the regulation of these genes began in the 1960s and were dominated until the late 1970s by the idea that one or perhaps two repressor proteins controlled transcriptional initiation of all the genes. However, attempts to isolate mutants lacking the putative repressor(s) failed, and additional experiments showed that derepression of pyrimidine gene expression under conditions of pyrimidine limitation was noncoordinate, suggesting that independent mechanisms might regulate each pyrimidine gene or operon. Transcriptional Attenuation in the pyrBI Operon of E. coli The pyrB! operon of E. coli encodes the catalytic (pyrB) and regulatory (pyrl) subunits of the allosteric enzyme aspartate transcarbamylase (ATCase). Expression of this operon is negatively regulated over a several-hundredfold range by the intracellular concentration of UTP (Schwartz and Neuhard 1975; Pierard et ai. 1976; Turnbough 1983). The DNA sequence of the pyrB! promoter-leader region revealed a potential p-independent transcriptional terminator (attenuator) located 23 bp before pyrB, the first gene in the operon (Roof et ai. 1982; Navre and Schachman 1983; Turnbough et ai. 1983). Transcripts initiated at either of two potential pyrB! promoters were efficiently (-98%) terminated at this site in vitro, indicating that regulation of operon expression involved attenuation (Turnbough et ai. 1983). However, the sequence of the pyrB! leader transcript indicated that it could not adopt alternative stem-loop structures, implying that attenuation control of pyrB! expression would differ mechanistically from that of the amino acid biosynthetic operons. Two additional putative regulatory elements were identified from the sequence of the leader region and in vitro transcription experiments. First, a 44-codon open reading frame, preceded by an apparent ribosomebinding site, extends through the leader region and ends six nucleotides in front of the pyrB gene (Fig. 4). Because tight coupling of transcription and translation can block transcriptional termination at a p-independent terminator (Johnston et ai. 1980), this open reading frame suggested that transcriptional termination at the pyrB! attenuator might be regulated by modulating the relative rates of transcription and translation within the leader region. Second, a strong transcriptional pause was observed approximatel y 20 bp before the pyrB! attenuator (Turnbough et ai. 1983). RNA polymerase stalls in this region, which is within a long uridine-rich sequence in the leader transcript, at low (e.g., 20 !lM) UTP concentrations in vitro; strong pausing was not detected in the leader region at low concentrations of ATP, CTP, or GTP. These findings suggested the following model for UTP-sensitive at- 422 R. Landick and C.L. Turnbough, Jr. "Pause Hairpin" Terminator Hairpin Ly, A A ACAAUU~ 60 ~ : C Leu U=A lOG C:=G g Lys Asn A U A C 120 G;:::;G Arg Leu U=A U=A Asp ~GE G ~ C.=G IG C=G g:~GIY Ala Pro Gin G=:G G::;:C7Q ~ !e~ C=:G ~tu U Mer Val Gin C s Val HIs Phe Val Pro Phe Phe PM Pro Leu lie Thr HIS 5~/OG=C~: Phe C s Pro GI GUAUGGUUCAGU~UGUU~ACAUUUUGUCUUAC=GCCUGCCGUUUUUCUUCCCGUUGAUCACCCAUUCCCA=UUUUUUUUdCCCAG~C~~C~rL~rg SlOp 20 30 40 50 80 90 100 130 140 Mer ~AUAAAAG AUG ,~. Figure 4 Nucleotide sequence of the pyrB! leader transcript. This transcript is initiated at the more downstream of the two potential pyrB! promoters identified by in vitro transcription; the vast majority of pyrB! transcripts are initiated at this downstream promoter in vivo (Donahue and Turnbough 1990). Numbering is from the 5' end. Transcriptional initiation can occur at either of the first two A residues. Nucleotides 21-152 encode a 44-amino acid leader polypeptide, and the sequence ends with the AUG initiation codon of the pyrB cistron. The secondary structures shown are encoded by a region of dyad symmetry flanked by UTP-sensitive transcriptional pause sites (pause hairpin) and the pyrB! attenuator (terminator hairpin). The Shine-Dalgarno sequences for the leader polypeptide and pyrB are underlined. tenuation control of pyrB! expression (Fig. 5) (Turnbough et al. 1983). When the intra~ellular level of UTP is low due to pyrimidine limitation, transcribing RNA polymerase stalls in the uridine-rich region of the leader transcript. This pause provides sufficient time for a ribosome to initiate translation of the 44-codon open reading frame and translate up to the stalled RNA polymerase. When RNA polymerase eventualIy escapes the pause region and transcribes the attenuator, the terminator hairpin is precluded from forming or is disrupted by the adjacent translating ribosome, permitting RNA polymerase to continue transcribing into the pyrB! structural genes. In contrast, when the intracelIular level of UTP is high, RNA polymerase transcribes the leader region without pausing. In this case, the ribosome is unable to couple closely with RNA polymerase and the terminator hairpin consequently forms, terminating transcription before the structural genes. Fi Sf (i tt tr o 1 P Pyrimidine-mediated Regulation of pyrBI Expression Occurs Primarily by Attenuation A major prediction of the attenuation control model is that transcriptional termination at the pyrB! attenuator is sensitive to the intracelIular level of UTP. This prediction was confirmed by measuring the levels of attenuated and readthrough pyrB! transcripts under conditions of pyrimidine excess or limitation, which were achieved by growing a pyrimidine auxotroph in minimal media supplemented with either uracil 1= s ) Terminator Hairpin I Transcriptional Attenuation 1 Promoter-Regulatory Region Transcriptional Pause Sites pyrBI Promoter Asn AU A e120 G::G Afg Leu U=A [ 423 '" ~ B88l Attenuator Structural Genes ~ G;:::::G C=GGly Pro G:;:G T leader transcript. This transcript is , potential pyrBI promoters identified of pyrBI transcripts are initiated at .e and Turnbough 1990). Numbering III can occur at either of the first two 4-amino acid leader polypeptide, and ::m codon of the pyrB cistron. The , a region of dyad symmetry flanked :s (pause hairpin) and the pyrBI atDalgarno sequences for the leader :Fig. 5) (Turnbough et al. 1983). low due to pyrimidine limitation, 11 the uridine-rich region of the sufficient time for a ribosome to n reading frame and translate up RNA polymerase eventually eshe attenuator, the terminator hairrupted by the adjacent translating to continue transcribing into the 11 the intracellular level of UTP is leader region without pausing. In )le closely with RNA polymerase 1 forms, terminating transcription Expression mtrol model is that transcriptional I1sitive to the intracellular level of by measuring the levels of atanscripts under conditions of h were achieved by growing a a supplemented with either uracil Low UTP - Strong Transcriptional Pausing Readthrough Transcription ) RNA Polymerase Leader Peptide Leader Transcript ~p----------------------------~ ppp-----------Figure 5 Model for attenuation control of pyrBI operon expression. The model shows the relative positions of RNA polymerase and the translating ribosome (i.e., tightly coupled or uncoupled) when UTP levels are either low or high. Note that there is no requirement for ribosome binding or translation of the leader transcript at high UTP. or a poorly metabolized pyrimidine source, respectively (Levin et al. 1989). Approximately 99% of the transcripts initiated at the pyrBI promoter(s) were terminated at the attenuator under conditions of pyrimidine excess. In cells limited for pyrimidines, readthrough transcription past the attenuator increased in proportion to increases in ATCase levels. To determine whether attenuation control was responsible for all pyrimidine-mediated regulation of operon expression, a mutant E. coli strain was constructed that carries a 9-bp chromosomal deletion removing the run of thymidine residues at the end of the pyrBI attenuator plus one additional base pair to maintain the reading frame of the leader polypeptide (Uu and Turnbough 1989). All p-independent 424 R. Landick and C.L. Turnbough, Jr. transcriptional termination is abrogated at this mutant attenuator. Under conditions of pyrimidine excess, pyrB! expression was 51-fold higher in the mutant strain than in an isogenic pyrB!+ strain. When the mutant Was limited for pyrimidines, operon expression increased an additional 6.5fold. Growth of the pyrB!+ strain under the same pyrimidine-limiting conditions resulted in a slightly greater than 300-fold increase in operon expression. These results indicate that attenuation control is responsible for most, but not all, of the pyrimidine-mediated regulation. Recent studies indicate that the residual 6.5-fold pyrimidine-mediated regulation in the mutant strain most likely reflects two additional control mechanisms that appear to act at the level of transcriptional initiation (c. Liu and c.L. Turnbough, Jf., unpubl.). Translation of the pyrBI Leader Transcript Is Required for Attenuation Control Convincing evidence for translation of the 44-codon open reading frame in the pyrB! leader transcript was provided by fusion of the pyrB! promoter region and leader open reading frame to lacZ and detection of the predicted lea_der polypeptide/B-galactosidase fusion protein (Roland et al. 1985). The'regulatory role of translation of this open reading frame was tested with pyrB! leader mutations that alter the initiation codon and strongly inhibit translational initiation or that introduce stop codons early in the reading frame well before the attenuator (Clemmesen et al. 1985; Roland et al. 1985, 1988). Each mutation reduced operon expression to s6% of the wild-type level under conditions of pyrimidine limitation and to s30% of the wild-type level under conditions of pyrimidine excess; the latter effect presumably reflects residual coupling of transcription and translation within the wild-type leader region even in cells grown with uracil. As with attenuation in the amino acid biosynthetic operons, it is the act of translation of the pyrB! leader transcript and not the leader polypeptide itself that functions in regulation. Thus, near-normal attenuation control was observed in a mutant bearing a (+) frameshift at codon 6 of the open reading frame, which still allows translation of the entire leader region (Clemmesen et al. 1985). Based on estimates of the size of the ribosome-binding site (Steitz and Jakes 1975; Kang and Cantor 1985), translation would have to proceed to within approximately 15 nucleotides of the pyrB! attenuator-encoded terminator hairpin to interact directly with this sequence and interfere with hairpin formation. This presumption was examined by measuring attenuator function in mutants containing termination codons at various sites in the leader open reading frame (Roland et al. 1988). The results reve: nuell exprl limit code bind 64% crea: cod( OCCl term regu pyrl to CI 198' I stud pyrl tion tern ces~ sen~ psel rate seci tive res) tiOl scr rib tivi Ro lea as co op C. pe AI Ie si Transcriptional Attenuation this .mutant attenuator. Under resslOn was 51-fold higher'In . - straIn. When the mutant was . I Increased an additional 6.5~he same p~rimidine-Iimiting n 300-fold Increase in Opera n . !lUah?n control is responsible -medIated regulation. Recent rrimidine-mediated regulation N'O additional control mecha_ nscriptional initiation (c. Liu Required 44-codon open reading frame ded by fusion of the pyrB/ 'arne to lacZ and detection of ;idase fusion protein (Roland on of this open reading frame . alter the initiation codon and at introduce stop co dons early ator (Clemmesen et al. 1985; reduced operon expression to s of pyrimidine limitation and ditions of pyrimidine excess; coupling of transcription and ion even in cells grown with :id biosynthetic operons, it is transcript and not the leader In. Thus, near-normal attenuang a (+ ) frameshift at codon 6 ows translation of the entire lsome-binding site (Steitz and tion would have to proceed to he pyrB! attenuator-encoded I this sequence and interfere was examined by measuring ermination codons at various land et al. 1988). The results 425 revealed that translational termination at or before codon 24, which is 16 Ducleotides upstream of the terminator hairpin (Fig. 4), reduces operon expression to only approximately 5% of wild type under pyrimidinelimiting conditions. In contrast, when translational termination occurs at codon 25, which should be the first termination codon at which ribosome binding overlaps the sequence of the terminator hairpin, expression is 64% of the wild-type level. In general, the level of operon expression increases as the termination codon is moved further downstream from codon 25, with the highest level of expression (i. e., 91% of wild type) occurring with termination at codon 33, which is within the loop of the terminator hairpin. Interestingly, in wild-type S. typhimurium, where regulation of pyrE! expression appears to be the same as in E. coli, the pyrE! leader transcript contains a stop codon at a position corresponding to codon 34 of the E. coli 44-codon open reading frame (Michaels et al. 1987). Further support for the regulatory role of translation comes from studies on the effects of reduced rates of translational elongation on pyrE! expression (Jensen 1988). According to the model, slower translation should reduce coupling to transcription and thereby increase termination at the pyrE! attenuator under conditions of pyrimidine excess. These effetts were tested in E. coli strains that are streptomycin sensitive (Sm S , rpsL +), streptomycin resistant (Sm R, rpsL999), or pseudo-dependent on streptomycin (Sm P , rpsL); translational elongation rates in these strains are approximately 15, 10, and 5 amino acids per second per ribosome, respectively. In uracil-supplemented medium, relative operon expression in the Sm R and Sm P strains was 46% and 10%, respectively, of wild type, as predicted by the model. According to the attenuation control model, a single round of translation of the pyrE! leader transcript is sufficient to elicit readthrough transcription. Consistent with such a limited requirement for translation, the ribosome-binding site preceding the leader open reading frame is relatively weak, only 7% as efficient as the pyrE ribosome-binding site (K.L. Roland and c.L. Turnbough, Jr., unpub!'). Interestingly, mutations in the leader ribosome-binding site that increase leader translation by as much as tenfold cause less than a twofold increase in operon expression under conditions of pyrimidine excess, and they have no significant effect on operon expression under conditions of pyrimidine limitation (c. Liu and c.L. Turnbough, Jr., unpub!'). Thus, leader translational initiation appears fine-tuned to produce strong regulation with minimal translation. Additional control of leader translation is suggested by downstream leader sequences that are complementary to the leader ribosome-binding site (Navre and Schachman 1983; Roland et al. 1985). Formation of a 1 ,. \ I, 426 R. Landick and C.L. Turnbough, Jr. secondary structure by these sequences could block multiple rounds of translation of readthrough transcripts and perhaps all translation of attenuated transcripts. Transcriptional Pausing in the pyrBI Leader Region Is Required for Attenuation Control Initial in vitro experiments suggested a single UTP-sensitive pause site in the pyrE! leader region (Turnbough et al. 1983). However, recent work employing a more refined assay at 20 !AM UTP reveals pausing at nearly every uri dine residue in the leader transcript preceding the terminator hairpin, with a few sites causing a slightly longer pause (J.P. Donahue and c.L. Turnbough, Jr., in prep.). The initially identified strong pause site is actually a cluster of pause sites at positions 81-88 (Fig. 4) between the pause and terminator hairpins of the leader transcript. Pausing at all sites decreases with increasing UTP concentrations and is no longer detectable at 400 !AM. In vivo, UTP concentrations vary from approximately 50 !AM in pyrimidine-starved cells to 1 mM in cells grown under conditions of pyri~idine excess (Turnbough 1983; Neuhard and Nygaard 1987). Although initial work failed to detect pausing within the leader region at low concentrations of ATP, CTP, or GTP (Turnbough et al. 1983), recent experiments have identified a single, strong GTP-sensitive pause prior to the addition of the guanine residue at position 55 in the leader transcript (Fig. 4) (J. P. Donahue and C. L. Turnbough, Jr., in prep.). The reason for pausing uniquely at this guanine residue is unclear. This pausing may account for the fourfold increase in ATCase levels observed in a mutant strain of S. typhimurium defective in guanine nucleotide synthesis (Jensen 1979). Transversion (T to A) mutations that reduce the number of uridine residues in the leader transcript and a mutation that swaps the eleventh and twelfth codons of the leader polypeptide (which eliminates the dyad symmetry encoding the pause hairpin) were constructed to determine the role of UTP-sensitive transcriptional pausing in pyrB! attenuation control (K. Mixter-Mayne and C. L. Turnbough, Jr., in prep.). Loss of a single uridine residue at any of several positions preceding the terminator hairpin had little effect on operon expression. However, changing the 7 uridine residues between positions 81 and 88 reduces operon expression to approximately 50% of the wild-type level under conditions of pyrimidine excess and limitation. Moreover, changing all 13 uridine residues between the pause and terminator hairpins reduces expression under conditions of pyrimi'dine excess and limitation to 80% and 25% of the w range co dOI redu( to 65 fivef, tions elimi quire essel sig ni mut, the then (Nol pam the lead tion tion tent typ) pro (4 I tiv( hig SCI th( de fa p< tc v p Transcriptional Attenuation ,uld block multiple rounds of perhaps all translation of at- ~egion Is .Ie UTP-sensitive pause site in 1983). However, recent work JTP reveals pausing at nearl . d· Y npt prece mg the terminator r longer pause (J.P. Donahue itially identified strong pause itions 81-88 (Fig. 4) between ader transcript. Pausing at all :entr~tions and is no longer :ntratlOns vary from approxio 1 mM in cells grown under 1 1983; Neuhard and Nygaard using within the leader region TP (Turnbough et al. 1983), , strong GTP-sensitive pause e at position 55 in the leader Turnbough, Jr., in prep.). The residue is unclear. This pausI A TCase levels observed in a I guanine nucleotide synthesis educe the number of uridine ation that swaps the eleventh Ie (which eliminates the dyad : constructed to determine the g in pyrE! attenuation control r., in prep.). Loss of a single )receding the terminator hair1. However, changing the 7 ~8 reduces operon expression level under conditions of rer, changing all 13 uri dine . hairpins reduces expression imitation to 80% and 25% of 427 the wild-type level, respectively, resulting in a threefold decrease in the range of regulation. Approximately the same effect is observed with the codon-swap pause hairpin mutation. Combining the last two mutations reduces expression under conditions of pyrimidine excess and limitation to 65% and 15% of the wild-type level, respectively, causing a four- to fivefold decrease in the range of regulation. Examination of these mutations in vitro showed that replacing one or more uridine residues eliminates UTP-sensitive pausing at the mutated site(s). The time required to complete the synthesis of the leader transcript at 20 I..lM UTP is essentially unchanged by the single substitution mutations but decreases significantly with the more extensive substitutions. The pause hairpin mutation does not eliminate any UTP-sensitive pause sites, but it reduces the half-lives of all pause complexes downstream from the mutation, thereby reducing the time required to synthesize the leader transcript. (Note that pausing does not occur immediately after the synthesis of the pause hairpin, which is consistent with the current view on the nature of the his and trp pause hairpins described above.) The time required for leader transcript synthesis is further reduced by the combination mutation. Taken together, these results confirm that UTP-sensitive transcriptional pausing within the pyrE! leader region plays an essential role in attenuation control~ Additional support for this idea emerged from studies of a strain of S. typhimurium carrying an altered RNA polymerase that exhibits an approximately sixfold higher Km for the binding of UTP (6 mM) and ATP (4 mM) during transcriptional elongation. This mutant displays constitutive expression of the pyrE! operon and the pyrE gene (see below) at high intracellular levels of UTP (Jensen et al. 1986), indicating that transcriptional pausing during the addition of uridine (or other) residues to the pyrE! leader transcript, and not the UTP level per se, is the key determinant in attenuation control. Finally, the transcriptional elongation factor NusA enhances UTP-sensitive pausing by wild-type RNA polymerase within the pyrE! and pyrE leader regions in vitro and appears to be important in determining the level of expression of these genes in vivo (Andersen et al. 1991; J.P. Donahue and c.L. Turnbough, Jr., in prep.). Expression of the pyrE Gene of E. coli Is Also Subject to Attenuation Control The DNA sequence of the region upstream of the E. coli pyrE gene contains putative regulatory elements similar to those present in the pyrE! leader region. Indeed, pyrE expression is regulated over a 30-fold range 428 R. Landick and C.L. Turnbough, Jr. almost entirely by an attenuation control mechanism that is analogous t 0 that described for the pyrB! operon (Bonekamp et al. 1984; Poulsen et a.1 1984; Poulsen and Jensen 1987; Jensen 1988). Interestingly, the "leader open reading frame" upstream of the pyrE gene, initially designated orfE is 238 codons long. Recently, this open reading frame was found to en~ code the tRNA processing exoribonuclease RNase PH, and the Open reading frame was renamed rph (Ost and Deutscher 1991). Apparently the pyrE gene is the second gene of a bicistronic operon, and the cell ha~ usurped translation of the first cistron for the purpose of attenuation control of pyrE expression. Also noteworthy is that the rph gene ends 8 bp before the dyad symmetry of the pyrE attenuator. Due to the size of the ribosome, translation to the end of the rph cistron still permits efficient disruption of the pyrE attenuator-encoded terminator hairpin. In related studies, it has been shown that pyrE expression in S. typhimurium is essentially identical to that in E. coli and also that regulation of carAB pyrC, pyrD, and pyrF expression in these bacteria does not involve at~ tenuation control (Neuhard and Nygaard 1987). RE( In tral tral tio] latl bill is t ree fOI re! po ph wI en gIl ill Other Examples f In Bacillus subtilis, all pyrimidine biosynthetic genes appear to be included in a single operon (Quinn et al. 1991). The DNA immediately preceding the pyrB gene, the first pyrimidine gene in the operon, appears to contain regulatory elements analogous to those in the pyrB! and pyrE leader regions of E. coli and S. typhimurium, suggesting similar UTPsensitive attenuation control (Quinn et al. 1991; R.L. Switzer, pers. comm.). If such regulation were proven to occur, it would indicate that this type of control is widespread among evolutionarily diverse bacteria. Expression of the E. coli ampC gene, which encodes 13-lactamase, increases with increasing cellular growth rate. The proposed mechanism for this regulation is similar to pyrB! and pyrE attenuation control and relies on two key elements: (1) a p-independent attenuator in the ampC leader region and (2) a regulatory ribosome-binding site just upstream of the attenuator-encoded terminator hairpin (J aurin et al. 1981; Grundstrom and Normark 1985). The AUG initiation codon of this ribosomebinding site is followed immediately by an ochre codon. According to the current model, formation of a translational initiation complex at the ribosome-binding site, to an extent increasing with the growth rate, prevents the formation of the terminator hairpin, thereby permitting transcription of the ampC gene. The interesting difference in this regulatory mechanism is that there is no requirement for translational elongation within the leader region .. pr Iy Transcriptional Attenuation ,I mechanism that is analog ous to 1ekamp et al. 1984; Poulsen et I a I 1988). Interestingly, the "Ie d . ... I a er -E gene, ITIltIa Iy designated arfE I reading frame was found t o en-' :Iease RNase PH , and the Open nd. Deutscher 1991). Apparentl y, . clstromc operon, and the cell has Ir the purpose of attenuation conly is that the rph gene ends 8 b P ittenuator. Due to the size of th e . rph clstron still permits efficient led terminator hairpin. In related pression in S. typhimurium is esd also that regulation of carAB ~se bacteria does not involve at~ 1987). ;ynthetic genes appear to be in. 1991). The DNA immediately idine gene in the operon, appears IS to those in the pyrB! and pyrE !urium, suggesting similar UTPt al. 1991; R.L. Switzer, pers. I to occur, it would indicate that . evolutionarily diverse bacteria. , which encodes ~-Iactamase, inrate. The proposed mechanism nd pyrE attenuation control and ~pendent attenuator in the ampC ,me-binding site just upstream of Jin (Jaurin et al. 1981; Grundlitiation codon of this ribosomey an ochre codon. According to ational initiation complex at the ~asing with the growth rate, prelairpin, thereby permitting tranting difference in this regulatory lent for translational elongation 429 REGULATORY-FACTOR-DEPENDENT ATTENUATION CONTROL In the two classes of attenuation control described so far, regulation of transcriptional attenuation is achieved by coupling transcription and translation within a regulatory leader region. In a third type of attenuation control, called regulatory-factor-dependent attenuation, the regulatory role of translation is replaced by specialized, trans-acting RNAbinding factors. One of the best-studied examples of this type of control is the regulation of bgl operon expression in E. coli. The bgl operon of E. coli contains three genes (bgIG, bglF, and bglB) required for the utilization of aromatic ~-glucosides as a carbon source for growth (Schnetz et al. 1987). The bglG gene encodes a positive regulatory protein (BglG); bglF encodes the ~-glucoside-specific transport protein enzyme nBg\ (BglF) of the phosphoenolpyruvate-dependent phosphotransferase system, which phosphorylates ~-glucosidic sugars while transporting them through the cytoplasmic membrane; and bglB encodes phospho-~-glucosidase B, which hydrolyzes phosphorylated ~ glucosides. The bgl operon is cryptic in wild-type cells, but various mutations activate the operon by enhancing transcription from its promoter. Once activated, expression of the operon is regulated positively by ~-glucosides and by cAMP (Lopilato and Wright 1990). Transcription from the activated bgl promoter is constitutive, but in the absence of a ~-glucoside inducer, most transcripts are terminated at a p-independent attenuator located just upstream of bglG, the first gene in the operon. A second p-independent attenuator resides between bglG and the adjacent bglF gene (Mahadevan and Wright 1987; Schnetz et al. 1987). The positive regulator BglG is required to prevent transcriptional termination at the two attenuators (Mahadevan and Wright 1987; Schnetz and Rak 1988). Low levels of BgIG and BglF are synthesized in the absence of ~-glucosides, but under these conditions, BgIF inactivates BgIG by phosphorylation. Apparently, BglG is active only as a dimer, and phosphorylation disrupts or prevents dimerization. In the presence of ~ glucosides, BglF dephosphorylates BglG, allowing it to dimerize and function as an antitermination factor (Fig. 6) (Amster-Choder and Wright 1990 and pers. comm.). BglG dimers prevent transcriptional termination within the operon by binding to sequences in the bgl mRNA that precede and partially overlap the attenuator-encoded terminator hairpins. This binding blocks the formation of the terminator hairpins, allowing expression of the operon. The BglG-binding site apparently forms an alternative secondary structure that is recognized by BglG (Houman et al. 1990). Several additional examples of regulatory-factor-dependent attenuation control have emerged recently. The sacPA operon and the sacB gene I P 430 R. Landick and C.L. Turnbough, Jr. bg/ Promoter Attenuator 1 als tro Attenuator 2 SCT fie ar at! et ne 8 P8 p + Phospho~-glucoside Inactive of th b~ RI ~-glucoside p-glucoside present, BglG dephosphorylated by BgIF. No p-glucoside, BglG phosphorylated by BgIF. Figure 6 Model for attenuation control of bgl operon expression showing the effects on transcfiption of BgIF-catalyzed phosphorylation or dephosphorylation of BgIG in the absence or presence of ~-glucoside inducer, respectively. See text for additional details. of B. subtilis, which are involved in sucrose utilization, appear to be subject to regulation that is essentially the same as that of the E. coli bgl operon, although in this case the positive regulatory genes are not linked to the regulated loci. The bglG homo logs are sacT and sacY for the sacPA operon and the sacB gene, respectively; each regulates a single attenuator (Crutz et al. 1990; Debarbouille et al. 1990). The trp operon of B. subtilis, as in E, coli, is subject to attenuation control that involves formation of alternative secondary structures in a leader transcript. However, in B. subtilis the formation of the transcript secondary structures is not controlled by the position of a translating ribosome, but by the binding of a trans-acting regulatory protein (Mtr) encoded by the mtr gene. Under conditions of abundant tryptophan, Mtr binds to a segment of the leader transcript, preventing formation of a secondary structure functionally equivalent to the E. coli 2:3 hairpin and permitting formation of a terminator hairpin (Shimotsu et al. 1986; Gollnick et al. 1990). The expression of the B. subtilis pur operon (Ebbole and Zalkin 1987), encoding all the purine biosynthetic enzymes, and the E. coli S10 operon (Zengel and Lindahl 1990), which contains 11 ribosomal protein genes, A ti i~ a a a t: a Transcriptional Attenuation lenuator 2 8p8p + Inactive 431 also appears to be subject to regulatory-factor-dependent attenuation control, although these studies are preliminary. The factor that controls transcriptional termination within the pur leader region remains to be identified, whereas ribosomal protein L4 is thought to facilitate termination at a NusA-dependent attenuator in the SlO leader. A final and novel example is represented by antisense RNA-induced attenuation of staphylococcal plasmid pT181 repC transcription (Novick et al. 1989). Apparently, an antisense RNA pairs with a target sequence near the 5 ' end of the nascent repC transcript and promotes the formation of a terminator hairpin. Premature transcriptional termination prevents the synthesis of the repC-encoded replication initiator protein and thereby regulates plasmid copy number. RHO-DEPENDENT ATTENUATION CONTROL No p-glucoside, BglG phosphorylated by BgIF. ~l operon expression showing the .phorylation or dephosphorylation ide inducer, respectively. See text ,e utilization, appear to be subarne as that of the E. coli bgl 'egulatory genes are not linked ~s are sacT and sacY for the 'ely; each regulates a single at!t al. 1990). The trp operon of enuation control that involves 'es in a leader transcript. Hownscript secondary structures is ing ribosome, but by the bindlitr) encoded by the mtr gene. Mtr binds to a segment of the f a secondary structure funcin and permitting formation of Gollnick et al. 1990). The ex)ole and Zalkin 1987), encodand the E. coli S 10 operon s 11 ribosomal protein genes, A fourth class of attenuation mechanisms employs p-dependent termination at an attenuator in place of p-independent termination. This scheme is used to regulate expression of the E. coli tryptophanase (tna; Stewart and Yanofsky 1985) and LlV -I transport (liv; Landick 1984; Williamson and Oxender 1992) operons and, interestingly, rho itself (Matsumoto et al. 1986). The ntost extensively studied of these examples, summarized briefly here, is tna regulation; in general, much remains to be learned about these mechanisms. The tna operon consists of two genes: tnaA, encoding tryptophanase, and tnaB, which encodes a tryptophan permease. Operon expression is induced in E. coli by the presence of tryptophan, allowing the bacterium to use this amino acid as a sole carbon or nitrogen source. The tna mRNA has a 319-nucleotide leader region that contains an open reading frame (tnaC) for a 24-amino acid leader peptide, with a single tryptophan at residue 12, and a long, relatively unstructured sequence between tnaC and tnaA within which p-dependent termination can occur both in vivo and in vitro (Fig. 7) (Stewart et al. 1986). Addition of 0.5 mM tryptophan to cultures induces tna operon expression nearly lOO-fold by preventing p-dependent termination in the leader region (Stewart and Yanofsky 1985). Induction of tna expression by tryptophan requires translation of the tryptophan codon at position 12 in the leader peptide coding region, since mutation of the tnaC initiation codon or replacement of the tryptophan codon with a stop codon or a eGG arginine codon, even when a new tryptophan codon is present at position 13, eliminates induction (Fig. 7) (Gollnick and Yanofsky 1990). Furthermore, translation of tnaC codon 12 by tRNATrp, rather than suppressor tRNAs, is required for induction 432 R. Landick and C.L. Turnbough, Jr. -Trp"~""""""""""------ or tnaC(Met 1~UAG) or tnaC(Trp 12~Stop or Arg) _____~ +Trp_ ..............~~..~......t..~ or frameshift that extends tnaC beyond rut 1--50 bp I Ina r ---I +1 RNA promoter I boxA gl!UiJ maC 'A" , ---------t--1 '" '" C B C---·D·--- ___ ~ Ina .......... ·MetAsnIleLeuHisIleCysValThrSerLysTrpPheAsnIleAspAsn ATGAATATCTTACATATATGTGTGACCTCAAAATGGTTCAATATTGACAAC F '" +25 . A LysIleValAspHlsArgProEnd ~ AAAATTGTCGATCACCGCCCTTGATTfGCCCTTCTGTAGCCATCACCAGAG boxA rut Figure 7 Attenuation control region in the E. coli tryptophanase (tna) operon. Vertical arrows indicate positions at which pausing (A-F) or p-dependent termination (B-F) were detected during in vitro transcription (Stewart et al. 1986). Horizontal arrows indicate the approximate extent of transcription with the conditions or mutations indicated. (Gollnick and Ya,nofsky 1990). In contrast, several mutations that disrupt a boxA-like element in the tna leader region (Fig. 7) cause partially constitutive expression (Stewart and Yanofsky 1985). Finally, deletion of an apparent p-utilization sequence (rut site; Fig. 7) located immediately downstream from tnaC, as well as tnaC frameshift mutations that cause translation past the rut site, result in constitutive expression. These results suggest that attenuation in the tna leader region might involve repositioning of the ribosome translating tnaC, in a process somehow dependent on translation of tnaC codon 12 by tRNATrp, to prevent binding of p to the nascent transcript. However, frameshifting by a ribosome translating tnaC has not been detected with out-of-frame gene fusions joining the first 21 codons of tnaC to lacZ (Gollnick and Yanofsky 1990). In addition, although induction is blocked by the miaA mutation, which prevents isopentenylation of tRNA Trp and slows ribosome movement over tryptophan codons, regulatory models that involve effects on tRNA charging or utilization seem inviable, as induction occurs over a range of tryptophan concentrations far above the Km for tryptophanyl-tRNA synthetase, and tryptophan analogs such as 5-methyl tryptophan, which are very poor substrates for the synthetase, are efficient inducers. Recently, Yanofsky and co-workers have found evidence for a limiting, trans-acting factor required for the tryptophan-mediated relief of pdependent termination (c. Yanofsky, pers. comm.). A multicopy plasmid carry toph' Furtt that Stud rave ATTE Witl con1 tion Reg of t pre1 sen vin the dea 19~ Ka the sin SCI is sc: eu or is (I 1( C( a1 1 b V t1 n t Transcriptional Attenuation carrying the tna promoter-leader region prevents in~uct~on of tryptophanase, but only when the pl.asmid-borne lea?er regIOn IS translated. Furthermore, trans-acting mutations that are u?hnked to tna ~r rh~ ~nd that prevent induction of tna operon expressIOn have been Identified. Studies currently under way that exploit these findings should help unravel this apparently complex mechanism of attenuation control. beyond rut ;t--.t--_ t YSTrpPheAS;~{~~PASn 433 1F AATGGTTCAATATTGACAAC TTCTGTAGCCATCACCAGAG rur :. coli tryptophanase (tna) operon. I pausing (A-F) or p-dependent vitro transcription (Stewart et al. :imate extent of transcription with t, several mutations that disrupt on (Fig. 7) cause partially cony 1985). Finally, deletion of an ; Fig. 7) located immediately frameshift mutations that cause itutive expression. in the tna leader region might ~ranslating tnaC, in a process -; codon 12 by tRNATrp, to pret. However, frameshifting by a etected with out-of-frame gene tnaC to lacZ (Gollnick and :Iuction is blocked by the miaA tion of tRNATrp and slows ons, regulatory models that inion seem inviable, as induction ntrations far above the Km for phan analogs such as 5-methyl es for the synthetase, are effilve found evidence for a limityptophan-mediated relief of p. comm.). A multi copy plasmid ATTENUATION IN EUKARYOTES With our current knowledge of the many different types of attenuation control in prokaryotes, it would be surprising if transcriptional attenuation were not employed as a genetic regulatory mechanism in eukaryotes. Regulatory-factor-dependent attenuation has been described in the case of the viral RNA polymerase from vaccinia virus (Moss 1990). To date, premature termination (or arrest) has been reported. to occur during transcription by RNA polymerase II of SV40, adenOVIrUs type 2, polyomavirus, human immunodeficiency virus (HIV), minute virus of mice, and the c-myc, L-myc, N-myc, c-myb, c-erbB, c-fos, c-mos, and adenosine deaminase genes from humans, mice, or rats (Spencer and Groudine 1990 and references therein; Haley and Waterfield 1991; Kerppola and Kane 1991 and references therein; Xu et a1. 1991). However, in none of these cases has it been established that true termination, rather than simple arrest or pausing, is responsible for the observed block to transcriptional elongation, nor in some cases has it been shown that the block is regulated by a metabolic or developmental signal, a hallmark of transcriptional attenuation in bacteria. The most complete description of regulated transcript elongation in eukaryotes comes from studies of the murine and human c-myc protooncogenes, where nuclear run-on assays showed that the first c-myc exon is transcribed at an approximately tenfold higher rate than exons 2 and 3 (Bentley and Groudine 1986; Eick and Bornkamm 1986; Mechti et a1. 1986; Nepveu and Marcu 1986). In the human promyelocytic leukemia cell line HL60 (Bentley and Groudine 1986; Eick and Bornkamm 1986) and a mouse erythroleukemia cell line (Mechti et a1. 1986; Nepveu et a1. 1987), the block to elongation is not apparent during proliferative growth but becomes significant when the cells are triggered to differentiate. When the human c-myc gene was injected into oocytes, several c-myc transcripts were observed, the most prominent of which had 3' ends that mapped to two T-rich sequences preceding and following the junction between exon 1 and intron 1 (Tl and T2, Fig. 8). Interestingly, many somatic mutations are found within this region of the c-myc genes from some Burkitt's lymphomas, where expression of c-myc is elevated and 434 R. Landick and C.L. Turnbough, Jr. +l~A , c-myc P1 ,,,. , c-myc P2 1-100 bp-t L __________eX~~_l______ - - - -- . 350 T1 ~j~tron 1%/.ff~ T2 ---______ ~ I . . - __ _ GCTGCCAGGACACCGCTTCTCTGAAAGGCTCTCCTTGCAGCTGCTTAGACGCTGGAI I I ITTTCGGGTAGTGG . 400 I . . . . T1 450 I AAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTTAATTTATTTTTTTATCACTTTAATGCTGAGATGAGTCG exon~tron 1 T2 Figure 8 Major transcriptional stop sites in the human c-myc gene. T1 and T2 refer to the transcriptional stop sites mapped by Bentley and Groudine (1988). tiO, act (M the CO (SI Bl lyl rel BI tic the transcriptional block is alleviated (Cesarman et al. 1987). These findings, together with the proposal that alternative RNA secondary structures might form preceding site T1, suggested an attenuation mechanism involving an RNA-based transcriptional termination signal similar to the bacterial paradigm (Eick and Bornkamm 1986; Bentley and Groudine 1988). However, other results are inconsistent with this simple model. First, although purified calf thymus RNA polymerase terminates at the T2 site of c-myc, termination is unchanged under conditions in which the RNA transcript remains hybridized to the DNA template, thus precluding formation of RNA secondary structures (Kerppola and Kane 1988). Second, although fragments of the human and murine c-myc genes bearing the ex on 1/intron 1 junction produce a transcriptional block when introduced downstream from either the herpes TK or human a-globin promoters, comparable DNA fragments have no effect when placed downstream from the SV40 early or the MHC H-2'''· promoters (Miller et al. 1989; Wright and Bishop 1989). With the adenovirus major late promoter, stopping is not observed when T2 is positioned 500 bp after the initiation site (Bentley and Groudine 1988) but does occur when it is placed closer (Roberts and Bentley 1992); thus, the distance between the stop site and the promoter or properties of the intervening transcript may be important. Furthermore, it is important to note that transcripts ending at T1 and T2 have been detected only in vitro and in oocytes. Results of nuclear run-on assays using tissue culture cells indicate only that transcription stops somewhere after initiation and before or early in intron 1. Thus, it is possible that although T1 or T2 sequences can stop RNA polymerase II transcription under certain conditions, they are neither necessary nor sufficient for control of transcriptional elongation in c-myc in vivo. Recent work on the human and murine c-myc genes suggests that sequences in or near the P2 promoter (Fig. 8) affect the block to transcrip- sc sil et ac til A tt 5( CI tl n tl f c Transcriptional Attenuation T1 W7/jntron 1W0'l~ T2 ----- ________ _ GCTTAGACGCTGGAI I I I l'rTCG~~~AGTT1 GG • 450 I rTTTTTATCACTTTAATGCTGAGATGAGTCG Ie human c-myc gene. Tl and T2 , Bentley and Groudine (1988). lrman et al. 1987). These find"native RNA secondary struc;ted an attenuation mechanism rmination signal similar to the 1986; Bentley and Groudine with this simple model. First, erase terminates at the T2 site conditions in which the RNA rA template, thus precluding :erppola and Kane 1988). Sec:I murine c-myc genes bearing nscriptional block when intropes TK or human a-globin have no effect when placed HC H-2K promoters (Miller et th the adenovirus major late T2 is positioned 500 bp after ~88) but does occur when it is thus, the distance between the the intervening transcript may to note that transcripts ending itro and in oocytes. Results of cells indicate only that trannd before or early in intron 1. T2 sequences can stop RNA conditions, they are neither criptional elongation in c-myc c-myc genes suggests that se) affect the block to transcrip- 435 tion near the exonllintronl junction. Inclusion of the P2 promoter region activates the transcriptional block in MHC H-2K -murine c-myc fusions (Miller et al. 1989). In the human c-myc gene, selective inactivation of the P1 or P2 promoters by small deletions revealed that transcription complexes that initiate at P2 stop more efficiently in the Tl-T2 region (Spencer et al. 1990). Furthermore, when the mutant c-myc alleles from Burkitt's lymphomas described above were transfected into murine lymphoid cells and monitored when differentiation was induced, normal regulation was observed. Readthrough of the Tl-T2 region in the Burkitt's lymphoma cells correlates with a shift in initiation of transcription from P2 to PI (Spencer et al. 1990). The apparent increase in transcripts initiating at PI may occur because a previously undetected stop site between PI and P2 becomes abrogated in transformed cells (Wright et al. 1991). Control of transcript elongation in c-myc may thus involve two cisacting elements: a site or sites with an intrinsic tendency to block elongation and an element in or near the promoter that can potentiate the block. At least two models are consistent with the available data. It is possible that a trans-acting factor binds in the Tl-T2 region and controls transcriptional elongation. Conceivably, a promoter-region element might contribute to the binding of such a factor; if so, then promoters such as the a-globin and herpes TK promoters must contain sequences that can replace the c-myc promoter element. Alternatively, the composition of transcription complexes assembled at or modified shortly downstream from particular promoters may differ in ways that affect elongation. There are several possible modifications that could account for such differences in transcription complexes. At P2-like promoters, a factor that normally overrides stop signals could be omitted. This factor must be present in excess in HeLa nuclear extracts, since only readthrough transcription is observed in the absence of inhibitors such as sarkosyl or KCI (London et al. 1991). Several candidates for such a factor are known. Transcription factors lIS, IIF, and IIX all have been found to increase elongation by RNA polymerase in vitro (SivaRaman et al. 1990; Bengal et al. 1991; Wiest et al. 1992). Omission of one of these, or an undiscovered factor, from the transcription complex during assembly might regulate transcription in c-myc much as the A Nand Q proteins act at the nut and qut sites to control transcription antitermination in A (see Greenblatt; Roberts; both this volume). Alternatively, inclusion at P2like promoters of a factor analogous to the Nun protein of phage HK022 (Robledo et al. 1990) could predispose the transcription complex to pausing or termination. Finally, modification of RNA polymerase itself by phosphorylation of the carboxy-terminal heptapeptide repeat appears to 436 R. Landick and C.L. Turnbough, Jr. accompany the transition from initiation to elongation (Payne et al. 1989), leading Spencer and Groudine (1990) to suggest that different degrees (or sites) of phosphorylation could occur at different promoters and under different cellular conditions so that the propensity for transcrip_ tional elongation is modulated. Several important questions remain to be answered about the control of transcript elongation in c-myc and other genes. Is the apparent block to transcription a true termination event, with concomitant release of the transcript and RNA polymerase from the DNA template? Is it a processing event that results in unstable transcription past the site much as cleavage of the transcript at a polyadenylation site destabilizes the elongation complex, or does it result from strong transcriptional pausing or arrest? What trans-acting factors regulate the process, and do they act at a specific site, making the control mechanism analogous to attenuation in prokaryotes? Do they affect elongation at many sites on the template, making it more akin to antitermination? In addition to continued analysis of these phenomena in mammalian cells and in oocytes, two experimental directions deserve exploration. First, if the block to transcription occurs when appropriate sequences and genes are placed in yeast, then a genetic analysis 9f the process will become possible. Second, an in vitro transcription system that faithfully recapitulates the promoter-elementdependence of elongation control in c-myc would allow both biochemical identification of the important factors and discrimination between pausing, termination, and processing. CONCLUSIONS AND PERSPECTIVES Why Attenuation Control? An often-asked question about transcriptional attenuation is why regulatory mechanisms would evolve that require the synthesis of apparently nonfunctional transcripts and, in some cases, polypeptides. The expenditure of energy for the synthesis of these macromolecules seemingly would impair the cell's ability to grow optimally, which would be particularly deleterious for bacteria that must survive in a highly competitive environment. One answer is that transcriptional attenuation, in some cases, actually is the most efficient control mechanism available. All regulatory decisions require information and therefore, of thermodynamic necessity, require the expenditure of energy. The energetic cost for regulation by attenuation may well be less than that of controls on transcriptional initiation that require the synthesis of trans-acting repressor and activator proteins, particularly in situations where the regulatory deci tran: bios coul the dire in n olis this ic 2 the ref] cia Atl Na 01 sc pc ar 0( pI in al 'R e Transcriptional Attenuation ion to elongation (Payne 9 et al 90) to suggest that different d . I occur at different promote ers and hat the propensity for transc . npto be answered about the Control er. genes. Is the apparent block to wIth concomitant release of the e ~N~ template? Is it a process_ scnptIon past the site much deny I ·· as atIon SIte destabilizes the 1m strong transcriptional pausing date. the process, and do they act ;hamsm analogous to attenuation m at ~a.ny sites on the template, In ad~ItlOn to continued analysis ; ~nd III oocytes, two experimen_ If the block to transcription oc.enes are placed in yeast, then a Ime possible. Second, an in vitro Lpitulates the promoter-element_ vc would allow both biochemical ld discrimination between paus- ,criptional attenuation is why Lt require the synthesis of apparIme cases, polypeptides. The exh:se macromolecules seemingly JtImally, which would be particsurvive in a highly competitive criptional attenuation, in some I1trol mechanism available. All )n and therefore, of thermore of energy. The energetic cost Je less than that of controls on ,ynthesis of trans-acting repressituations where the regulatory 437 deCISIon requires information about the state of the transcriptional or translational machinery (such as regulation of amino acid or pyrimidine biosynthetic operon expression). Here, attenuation control can be coupled directly to metabolic activities dependent on the end product of the regulated genes without requiring a separate sensor protein. This direct coupling also may provide enhanced sensitivity to small changes in metabolic activity as well as a means for rapidly adjusting this metabolism in response to the needs of the cell. It is tempting to speculate that this efficient control mechanism arose early in the evolution of the genetic apparatus, perhaps in an "RNA world" before regulatory proteins and their interactive sites made their appearance. Present-day examples may reflect the adaptation of this primitive regulatory circuit to several specialized uses. Attenuation Control Uses Information in the Nascent RNA Transcript One clear advantage of deferring the regulatory decision until after transcriptional initiation is that the nascent transcript can be used as a component of the control mechanism. The ability of RNA to form complex and competing structures allows it to specify information in ways that are not readily achieved by duplex DNA. Thus, even where trans-acting proteins participate in attenuation control, they bind an RNA target and influence the conformation of the nascent transcript. Such mechanisms also may occur in eukaryotes: Binding of the HIV Tat protein to the RNA hairpin TAR element has been reported to influence transcript elongation (Kao et al. 1987). The advantage of RNA as a regulatory target may account for the striking absence of attenuation control mechanisms mediated by DNAbinding proteins. Such mechanisms clearly are possible. In prokaryotes, both the lac repressor (Deuschle et al. 1986) and an EcoRI endonuclease mutant defective in cleavage (Pavco and Steege 1990), when bound to DNA, can block transcriptional elongation, and, in eukaryotes, both DNA-bound lac repressor (Deuschle et al. 1990) and proteins bound to the CCAAT promoter element (Connelly and Manley 1989) have been shown to block elongation. Nonetheless, there are no established examples of physiologically important control of elongation by a DNAbinding protein. Perhaps such mechanisms have not been favored during evolution because they indeed would waste energy required for RNA synthesis and offer no advantage over regulation of transcriptional initiation. 438 R. Landick and C.L. Turnbough, Jr. Future Prospects In considering what directions future research on transcriptional attenua_ tion may take, we are struck by several key issues. First, despite all the evidence that RNA secondary structures function during transcription as pause signals, termination signals, and targets for regulatory factors, to date no systematic mutagenesis of an RNA hairpin involved in attenua_ tion in prokaryotes has been reported. Such analyses are long overdue and will be required to resolve important remaining questions. For example, exactly what are the requirements for stable RNA structures to form in a nascent transcript? Are the mismatched regions in some RNA hairpins important? What are the rates of RNA hairpin formation relative to the rates of transcription and translation? Do the sequences of certain loop regions affect the stability or rate of formation of hairpins? A complete understanding of transcriptional attenuation will require that we answer these questions. With the development of methods for synthesis of large amounts of any given RNA, it now is possible to determine directly the stability and rate of formation of systematically altered RNA secondary structures. Second, although models for transcriptional pausing and termination have found their way into current textbooks, in truth, we are remarkably f ignorant about the mechanisms that underlie these phenomena. Currently, the configuration of the RNA transcript within the transcription complex and the effects of RNA hairpin formation are subjects of intense debate (Reynolds et al. 1992 and references therein; von Hippel and Yager 1992). Understanding attenuation control requires first understanding these mechanisms. We anticipate that, in the coming decade, the combined results from ongoing mutational studies on RNA polymerase; the dissection of interactions between polymerase, the nascent transcript, and the DNA template by approaches such as RNA-polymerase crosslinking and chemical probing; and direct analysis of RNA polymerase structure (see Kornberg et aI., this volume) will resolve these current controversies. Finally, we are left to wonder what types of attenuation control remain to be discovered. Given that attenuation control mechanisms have evolved to use the information uniquely contained in the nascent RNA transcript and the demands for energetic efficiency in bacteria, we expect that many additional examples will emerge as the study of gene regulation in a variety of bacterial species progresses. Our present inability to explain the complicated mechanism that regulates tryptophanase operon expression shows that we have yet to fully appreciate the possible ways attenuation control can be accomplished. If attenuation was an early invention during evolution, important advances could come from a better know I thO ug1 Hi tional sugge proka tion il elong activ( semb scrip1 Oshe to reI seqw KraiJ tiona et al term (Mal the' stru< tribt bet~ will in e1 sur~ the ACt< We We Wr and REI Am a' An, c Ar1 Q Transcriptional Attenuation :h. on transcriptional att enua_ . Issues. FIrst, despite all h d . t e t· CIon unng transcriptl· On as :!ts .for. regulatory fact ors, to . h alrpm mvolved in att enua1 analyses are long ov d . . er ue lamIng questions. For exam_ ible RNA structures to £; .. onn regIOns . . . In some RNA halrhalrpm formation relative to )0 the sequences of cert . . run ·matron of hairpins? A Comuation will require that We ~nt of methods for synthes·IS • IW IS possible to determine systematically altered RNA nal pausing and termination in truth, we are remarkably these phenomena. Currentrithin the transcription comtion are subjects of intense ;s therein; von Hippel and )ntrol requires first underIt, i.n the coming decade, the tudles on RNA polymerase; ;rase, the nascent transcript, as RNA-polymerase crosslalysis of RNA polymerase , will resolve these current pes of attenuation control m control mechanisms have tained in the nascent RNA :ency in bacteria, we expect s the study of gene regulaes. Our present inability to lates tryptophanase operon Ipreciate the possible ways ttenuation was an early incould come from a better 439 knowledge of gene regulation in archaebacteria, the third kingdom thought to be most similar to early life forms. H is less clear what the existing data predict for control of transcriptional elongation in eukaryotes. However, one fascinating possibility is suggested by the parallels between the eukaryotic spliceosome and the prokaryotic ribosome. If translation is coupled to and regulates transcription in bacteria, might a similar relationship exist between transcriptional elongation and splicing in eukaryotes? Electron microscopy studies of actively transcribed Drosophila chromatin suggest that spliceosomes assemble rapidly on the nascent RNA and, on occasion, splice the transcript prior to its release from the transcription complex (Beyer and Osheim 1988). In many cases, additional RNA-binding proteins appear to regulate alternative mRNA splicing (Maniatis 1991). Furthermore, the sequence of one of these factors from humans (ASF/SF2; Ge et al. 1991; Krainer et al. 1991) is similar to a protein that accumulates in transcriptionally active regions of Drosophila polytene chromosomes (Champlin et aJ. 1991). There also is evidence that snRNPs may be involved in termination of RNA polymerase III transcripts and histone mRNAs (Manley et aJ. 1989). It is tempting to speculate that coupling between the movement of RNA polymerase, the formation of RNA secondary structure, and the binding of snRNPs or regulatory proteins might contribute both to control of transcriptional elongation and to the decision between alternative mRNA splicing patterns. Detection of such effects will require advances in techniques to analyze transcriptional elongation in eukaryotes. In any event, it seems likely that we have not seen the last surprise from investigations into the role of transcriptional attenuation in the regulation of gene expression. 7 ACKNOWLEDGMENTS We thank Joe Calvo, Don Court, Martin Freundlich, Mark Groudine, Wes Hatfield, Caroline Kane, Robert Switzer, Edwin Umbarger, Andrew Wright, and Charles Yanofsky for helpful comments on the manuscript and for discussion of results prior to publication. REFERENCES Amster-Choder, O. and A. Wright. 1990. Regulation of activity of a transcriptional antiterminator in E. coli by phosphorylation in vivo. Science 249: 540-542. Andersen, J.T., K.F. Jensen, and P. Poulsen. 1991. Role of transcription pausing in the control of the pyrE attenuator in Escherichia coli. Mol. Microbiol. 5: 327-333. Artz, S.W. and D. Holzschu. 1983. Histidine biosynthesis and its regulation. In Amino acids: biosynthesis and genetic regulation (ed. K.M. Herrmann and R.L. Somerville), 440 R. Landick and C.l. Turnbough, Jr. pp. 379-404. Addison-Wesley, Reading, Massachusetts. Bartkus, J.M., B. Tyler, and J.M. Calvo. 1991. Transcription attenuation-mediated . Control of leu operon expreSSIOn: Influence of the number of Leu control codons.l. Bacter' 173: 1634-1641. 101. bloC Donat fron Bauer, C.E., J. Carey, L.M. Kasper, S.P. Lynn, and J.F. Gardner. 1983. Attenuation' bacterial operons. In Gene function in prokaryotes (ed. J.Beckwith, et al.), pp. 65_8~n Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. . Bengal, E., O. Flores, A Krauskopf, D. Reinberg, and Y. Aloni. 1991. Role of the rna _ malian transcription factors IIF, lIS, and IIX during elongation by RNA polymerase ~ Mol. Cell. BioI. 11: 1195-1206. . Bentley, D.L. and M. Groudine. 1986. A block to elongation is largely responsible for decreased transcription of c-myc in differentiated HL60 cells. Nature 321: 702-706. - - - . 1988. Sequence requirements for premature termination of transcription in the human c-myc gene. Cell 53: 245-256. Beyer, AL. and Y.N. Osheim. 1988. Splice site selection, rate of splicing, and alternative splicing on nascent transcripts. Genes Dev. 2: 754-765. Bonekamp, F., K Clemmesen, O. KarIstriim, and KF. Jensen. 1984. Mechanism of UTPmodulated attenuation at the pyrE gene of Escherichia coli: An example of operon polarity control through the coupling of translation to transcription. EMBO 1. 3: 2857-2861. Carter, P.W., D.L. Weiss, H.L. Weith, and J.M. Calvo. 1985. Mutations that convert the four leucine residues of the Salmonella typhimurium leu leader to four threonine codons.l.Bacteriol. 162: 943-949. Cesarman, E., R. Dalla-Favera, D. Bentley, and M. Groudine. 1987. Mutations in the first exon are associated with altered transcription of c-myc in Burkitt lymphoma. Science 238: 1272-1275. Champlin, D.T., M. Frasch, H. Saumweber, and J.T. Lis. 1991. Characterization of a Drosophila protein associated with boundaries of transcriptionally active chromatin. Genes Dev. 5: 1611-1621. Chan, c.L. and R. Landick. 1989. The Salmonella typhimurium his operon leader region contains an RNA hairpin-dependent transcription pause site. 1. BioI. Chem. 264: 20796-20804. Chen, J.-W., E. Harms, and H.E. Umbarger. 1991. Mutations replacing the leucine codons or altering the length of the amino acid-coding portion of the ilvGMEDA leader region of Escherichia coli. 1. Bacteriol. 173: 2341-2353. Clemmesen, K., F. Bonekamp, O. KarIstriim, and KF. Jensen. 1985. Role of translation in the UTP-modulated attenuation at the pyrBI operon of Escherichia coli. Mol. Gen. Genet. 201: 247-251. Connelly, S. and J.L. Manley. 1989. RNA polymerase II transcription termination is mediated specifically by protein binding to a CCAA T box sequence. Mol. Cell. Bioi. 9: 5254-5259. Crutz, A-M., M. Steinmetz, S. Aymerich, R. Richter, and D. Le Coq. 1990. Induction of levansucrase in Bacillus subtilis: An antitermination mechanism negatively controlled by the phosphotransferase system. 1. Bacteriol. 172: 1043-1050. DebarbouiIIe, M., M. Arnaud, A. Fouet, A Klier, and G. Rapoport. 1990. The sacT gene regulating the sa cPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators. 1. Bacteriol. 172: 3966-3973. Deuschle, U., R. Gentz, and H. Bujard. 1986. lac repressor blocks transcribing RNA polymerase and terminates transcription. Proc. Natl. Acad. Sci. 83: 4134-4137. Deuschle, U., R.A Hipskind, and H. Bujard. 1990. RNA polymerase II transcription Ebbo i Bac Bio Eick, cor Farnl cal 56: Fishl 265 le~ N~ Ge, A: Gol! ot 3' Gol is Sl Gn a Gu c Ha H( H JI Transcriptional Attenuation :husetts. nscription attenuation-med' lated COnt I ler of Leu control codons J B ro . . acteriol. md J.F. Gardner. 1983 Att . enuatlOn . . tes (ed. J.Beckwith et al) In , . , pp 65 89 rbor, New York. . - . and Y. Aloni. 1991. Role of th . e mam mg elongation by RNA polym erase II. ) elongation is largely respo 'bl nSI e for HL60 cells. Nature 321: 702-706 ure termination of transcriptio .' n In the ection, rate of splicing, and altern . alIve ~-765. ~.F. Jensen. 1984. Mechanism of UTp_ he~ichia coli: An example of operon .JatlOn to transcription. EMBQ J. 3: alvo. 1985. Mutations that convert th . I e nurlUm eu leader to four threonine Groudine. 1987. Mutations in the first c-myc in Burkitt lymphoma. Science J.T. Lis. 1991. Characterization of a of transcriptionally active chromatin. typhimurium his operon leader region on pause site. 1. Bioi. Chem. 264: 91. Mutations replacing the leucine Iding portion of the ilvGMEDA leader -2353. C.F. Jensen. 1985. Role of translation peron of Escherichia coli. Mol. Gen. lerase II transcription termination is AT box sequence. Mol. Cell. BioI. 9: r, and D. Le Coq. 1990. Induction of on mechanism negatively controlled ~: 1043-1050. d G. Rapoport. 1990. The sacT gene ares strong homology with transcrip3. repressor blocks transcribing RNA '. Acad. Sci. 83: 4134-4137. I. RNA polymerase II transcription 441 blocked by Escherichia coli lac repressor. Science 248: 480-483. Donahue, J.P. and c.L. Turnbough, Jr. 1990. Characterization of transcriptional initiation from promoters P J and P2 of the pyrB! operon of Escherichia coli K12. J. BioI. Chem. 265: 19091-19099. Ebbol e , D.J. and H. Zalkin. 1987. Cloning and characterizati~n of a 12-g.ene cluster ~rom Bacillus subtilis encoding nine enzymes for de novo purme nucleotIde syntheSIS. 1. BioI. Chem. 262: 8274-8287. Eick, D. and G.W. Bornkamm. 1986. Transcriptional arrest within the first exon is a fast control mechanism in c-myc gene expression. Nucleic Acids Res. 14: 8331-8346. Farnham, P.J. and T. Platt. 1981. Rho-independent termination: Dyad symmetry in DNA causes RNA polymerase to pause during transcription in vitro. Nucleic Acids Res. 9: 563-577. Fisher, R. and C. Yanofsky. 1984. Use of complementary DNA oligomers to probe trp leader transcript secondary structures involved in transcription pausing and termination. Nucleic Acids Res. 12: 3295-3302. Ge, H., P. Zuo, and J.L. Manley. 1991. Primary structure of the human splicing factor ASF reveals similarities with Drosophila regulators. Cell 66: 373-382. Gollnick, P. and C. YanOfsky. 1990. tRNATrp translation of leader peptide codon 12 and other factors that regulate expression of the tryptophanase operon. 1. Bacteriol. 172: 3100-3107. Gollnick, P., S. Ishino, M.l. Kuroda, D.J. Henner, and C. Yanofsky. 1990. The mtr locus is a two-gene operon required for transcription attenuation in the trp operon of Bacillus subtilis. Proc. Natl. Acad. Sci. 87: 8726-8730. Grundstrom, T. a~d S. Normark. 1985. Initiation of translation makes attenuation of ampC in E. coli dependent on growth rate. Mol. Gen. Genet. 198: 41/-415. Gutman, G.A. and G.W. Hatfield. 1989. Nonrandom utilization of codon pairs in Escherichia coli. Proc. Natl. Acad. Sci. 86: 3699-3703. Haley, J.D. and M.D. Waterfield. 1991. Contributory effects of de novo transcription and premature transcript termination in the regulation of human epidermal growth factor receptor proto-oncogene RNA synthesis. 1. Bioi. Chem. 26: 1746-1753. Houman, F., M.R. Diaz-Torres, and A. Wright. 1990. Transcriptional antitermination in the bgl operon of E. coli is modulated by a specific RNA binding protein. Cell 62: 1153-1163. Hsu, J.-H., E. Harms, and H.E. Umbarger. 1985. Leucine regulation of the ilvGEDA operon of Serratia marcescens by attenuation is modulated by a single leucine codon. 1. Bacteriol. 164: 217-222. Jaurin, B., T. Grundstrom, T. Edlund, and S. Normark. 1981. The E. coli ~-Iactamase attenuator mediates growth rate-dependent regulation. Nature 290: 221-225. Jensen, K.F. 1979. Apparent involvement of purines in the control of expression of Salmonella typhimurium pyr genes: Analysis of a leaky guaB mutant resistant to pyrimidine analogs. 1. Bacteriol. 138: 731-738. - - - . 1988. Hyper-regulation of pyr gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo? Eur. 1. Biochem. 175: 587-593. Jensen, K.F., R. Fast, O. Karlstrom, and J.N. Larsen. 1986. Association of RNA polymerase having increased Km for ATP and UTP with hyperexpression of the pyrB and pyrE genes of Salmonella typhimurium. 1. Bacteriol. 166: 857-865. Johnston, H.M. and J.R. Roth. 1981. DNA sequence changes of mutations altering attenuation control of the histidine operon of Salmonella typhimurium. 1. Mol. BioI. 145: 735-756. 442 R. Landick and C.L. Turnbough, Jr. Johnston, H.M., W. M. Barnes, F.G. Chumley, L. Bossi, and J.R. Roth. 1980. Mod regulation of the histidine operon of Salmonella. Proc. Natl. Acad. Sci. 77: 508_51e~ for Kang, C. and C.R. Cantor. 1985. Structure of ribosome-bound messenger RNA' revealed by enzymatic accessibility studies. 1. Mol. BioI. 181: 241-251. as Kao, S.-Y., AF. CaIman, P.A Luciw, and B.M. Peterlin. 1987. Anti-termination f .. ' I repeat 0 f HIV - 1 b y tat gene product. Nature 0 transCrIptIOn wIt. h'm th e ongI termma 330' 489-493. . Kerppola, T.K. and C.M. Kane. 1988. Intrinsic sites of transcription termination a d pausing in the c-myc gene. Mol. Cell. BioI. 8: 4389-4394. n - - - . 1991. RNA polymerase: Regulation of transcript elongation and termination. FASEB 1.5: 2833-2842. Kolter, R. and C. Yanofsky. 1982. Attenuation in amino acid biosynthetic operons. Annu. Rev. Genet. 16: 113-134. - - - . 1984. Genetic analysis of the tryptophan operon regulatory region using sitedirected mutagenesis. 1. Mol. Bioi. 175: 299-312. Krainer, A., R.A. Mayeda, D. Kozak, and G. Binns. 1991. Functional expression of cloned human splicing factor SF2: Homology to RNA-binding proteins, Ul 70K, and Drosophila splicing regulators. Cell 66: 383-394. Kuroda, M.I. and C. Yanofsky. 1984. Evidence for the transcript secondary structures predicted to regulate transcription attenuation in the trp operon. 1. Bioi. Chem. 259: 12838-12843. Kwak, J.-H., E.-C. Choi, and B. Weisblum. 1991. Transcriptional attenuation control of ermK, a macrolide-Iincosamide-streptogramin B resistance determinant from Bacillus licheniformis.l. Bq.cteriol. 173: 4725-4735. Landick, R. 1984. R~gulation of LIV-I transport system gene expression. In Microbiology 1984 (ed. L. Leive and D. Schlessinger), pp. 71-74. American Society for Microbiology, Washington D.C. Landick, R. and C. Yanofsky. 1984. Stability of an RNA secondary structure affects in vitro transcription pausing in the trp operon leader region. 1. BioI. Chem. 259: 1155011555. - - - . Transcription attenuation. In Escherichia coli and Salmonella typhimurium: Cellular and molecular biology (ed. F.C. Neidhardt et al.), pp. 1276-1301. American Society for Microbiology, Washington, D.C. - - - . 1987b. Isolation and structural analysis of the Escherichia coli trp leader paused transcription complex. 1. Mol. Bioi. 196: 363-377. Landick, R., J. Carey, and C. Yanofsky. 1987. Detection of transcription-pausing in vitro in the trp operon leader region. Proc. Natl. Acad. Sci. 84: 1507-1511. Landick, R., C. Yanofsky, K. Choo, and L. Phung. 1990. Replacement of the Escherichia coli trp operon attenuation control codons alters operon expression. 1. Mol. BioI. 216: 25-37. Lee, D.N. and R. Landick. 1992. Structure of RNA and DNA chains in paused transcription complexes containing Escherichia coli RNA polymerase. 1. Mol. BioI. (in press). Lee, D.N., L. Phung, J. Stewart, and R. Landick. 1990. Transcription pausing by E. coli RNA polymerase is modulated by downstream DNA sequences. 1. Bioi. Chem. 265: 15145-15153. Levin, H.L., K. Park, and H.K. Schachman. 1989. Attenuation in the regulation of the pyrBloperon in Escherichia coli. In vivo studies of transcriptional termination. 1. Bioi. Chem. 264: 14638-14645. Liu, C. and C.L. Turnbough, Jr. 1989. Multiple control mechanisms for pyrimidine- rnt 17 Lonl du 11 Lop E: 4: Lo~ 8 Lyr tl tt LYI 1 ( M: M M M Transcriptional Attenuation ossi, and 1.R. Roth. 1980 M "., . ' odel fo oc. Hatl. Acad. SCI. 77: 508-512 r bosome-bound messenger RN . Bioi. 181: 241-251. A as :rlin. 1987. Anti-terminatio f no tran_ 1 by tat gene product. Nature 330: es of transcription termination and -4394. mscript elongation and term' . mallon. ino acid biosynthetic operons A . nnu. 'peron regulatory region using site~s. 1991. Functional expression ~NA-binding f proteins, VI 70K, a:d the transcript secondary structures he trp operon. J. BioI. Chem. 259: 'anscriptional attenuation control of sistance determinant from BaCillus tern gene expression. In Microbiol1-74. American Society for MicroRNA secondary structure affects in region. J. BioI. Chem. 259: 11550- and Salmonella typhimurium: Celet al.), pp. 1276-1301. American : Escherichia coli trp leader paused on of transcription-pausing in vitro . 84: 1507-1511. 10. Replacement of the Escherichia ~ron expression. J. Mol. BioI. 216: d DNA chains in paused transcriprmerase. J. Mol. BioI. (in press). l. Transcription pausing by E. coli A sequences. J. Bioi. Chem. 265: ttenuation in the regulation of the ranscriptional termination. J. Bioi. Itrol mechanisms for pyrimidine- 443 mediated regulation of pyrBI operon expression in Escherichia coli K-12. J. Bacterial. 171: 3337-3342. London, L., R. Keene, and R. Landick. 1991. Analysis of premature termination in c-myc during transcription by RNA polymerase II in a HeLa nuclear extracts. Mol. Cell. BioI. 11: 4599-4615. Lopilato, 1. and A. Wright. 1990. Mechanisms of activation of the cryptic bgl operon of Escherichia coli K-12. In The bacterial chromosome (ed. K. Drlica and M. Riley), pp. 435-444. American Society for Microbiology, Washington, D. C. Lovett, P.S. 1990. Translational attenuation as the regulator of inducible cat genes. J. Bacterial. 172: 1-6. Lynn, S.P., L.M. Kasper, and 1.F. Gardner. 1988. Contributions of RNA secondary structure and length of the thymidine tract to transcription termination at the thr operon attenuator. J. Bioi. Chem. 263: 472-479. Lynn, S.P., W.S. Burton, T.1. Donohue, R.M. Gould, R.I. Gumport, and 1.F. Gardner. 1987. Specificity of the attenuation response of the threonine operon of Escherichia coli is determined by the threonine and isoleucine codons in the leader transcript. J. Mol. Bio1.194: 59-69. Mahadevan, S. and A. Wright. 1987. A bacterial gene involved in transcription antitermination: Regulation at a rho-independent terminator in the bgl operon of E. coli. Cell 50: 485-494. Maniatis, T. 1991. Mechanisms of alternative pre-mRNA splicing. Science 251: 33-34. Manley, 1.L., N.l. Proudfoot, and T. Platt. 1989. RNA 3' -end formation. Genes Dev. 3: 2218-2222. Matsumoto, Y., K.,shigesada, M. Hirano, and M. Imai. 1986. Autogenous regulation of the gene for tran~cription termination factor rho in Escherichia coli: Localization and function of its attenuators. J. Bacterial. 166: 945-958. Mechti, N., M. Piechaczyk, 1.-M. Blanchard, L. Marty, A. Bonnieu, P. leanteur, and B. Lebleu. 1986. Transcriptional and post-transcriptional regulation of c-myc expression during the differentiation of murine erythroleukemia Friend cells. Nucleic Acids Res. 14: 9653-9666. Michaels, G., R.A. Kelln, and F.E. Nargang. 1987. Cloning, nucleotide sequence and expression of the pyrBI operon of Salmonella typhimurium LT2. Eur. J. Biochem. 166: 55-61. Miller, H., C. Asselin, D. Dufort, 1.-0. Yang, K. Gupta, K.B. Marcu, and A. Nepveu. 1989. A cis-acting element in the promoter region of the murine c-myc gene is necessary for transcriptional block. Mol. Cell. BioI. 9: 5340-5349 . Moss, B. 1990. Regulation of vaccinia virus transcription. Annu. Rev. Biochem. 59: 661688. Navre, M. and H.K. Schachman. 1983. Synthesis of aspartate transcarbamoylase in Escherichia coli; Transcriptional regulation of the pyrB-pyrI operon. Proc. Natl. Acad. Sci. 80:1207-1211. Nepveu, A. and K.B. Marcu. 1986. Intragenic pausing and anti-sense transcription within the murine c-myc locus. EMBO J. 5: 2859-2865. Nepveu, A., K.B. Marcu, A.I. Skoultchi, and H. Lachman. 1987. Contributions of transcriptional and post-transcriptional mechanisms to the regulation of c-myc expression in mouse erythroleukemia cells. Genes Dev. 1: 938-945. Neuhard, 1. and P. Nygaard. 1987. Purines and pyrimidines. In Escherichia coli and Salmonella typhimurium: Cellular and molecular biology (ed. F. C. Neidhardt et al.), pp. 445-473. American Society for Microbiology, Washington, D.C. Novick, R.P., S. Iordanescu, S.l. Projan, 1. Kornblum, and I. Edelman. 1989. pT181 plas- 444 R. Landick and C.L. Turnbough, Jr. mid replication is regulated by a countertranscript-driven transcriptional attenuator. Cell 59: 395-404. Ost, K.A. and M.P. Deutscher. 1991. Escherichia coli orfE (upstream of pyrE) encodes RNase PH. J. Bacterial. 173: 5589-5591. Oxender, D.L., G. Zurawski, and C. Yanofsky. 1979. Attenuation in the Escherichz' I' a co I tryptophan operon: Role of RNA secondary structure involving the tryptophan cod on region. Proc. Natl. Acad. Sci. 76: 5524-5528. Pavco, P.A. and D.A. Steege. 1990. Elongation by Escherichia coli RNA polymerase is blocked in vitro by a site-specific DNA binding protein. J. Bioi. Chern. 265: 99609969. Payne, J.M., PJ. Laybourn, and M.E. Dahmus. 1989. The transition of RNA polymerase II from initiation to elongation is associated with phosphorylation of the carboxyl_ terminal domain of subunit IIa.J. BioI. Chern. 264: 19621-19629. Pierard, A., N. G1andsdorff, D. Gigot, M. Crabeel, P. Halleux, and L. Thiry. 1976. Repression of Escherichia coli carbamoylphosphate synthase: Relationships with enzyme synthesis in the arginine and pyrimidine pathways. J. Bacterial. 127: 291-30l. Poulsen, P. and K.F. Jensen. 1987. Effect of UTP and GTP pools on attenuation at the pyrE gene of Escherichia coli. Mol. Gen. Genet. 208: 152-158. Poulsen, P., F. Bonekamp, and K.F. Jensen. 1984. Structure of the Escherichia coli pyrE operon and control of pyrE expression by a UTP modulated intercistronic attenuation. EMBOJ. 3: 1783-1790. Quinn, C.L., B.T. Stephenson, and R.L. Switzer. 1991. Functional organization and nucleotide sequenc.e of the Bacillus subtilis pyrimidine biosynthetic operon. J. Bioi. Chern. 266: 9113-~127. Reynolds, R., R.M. Bermudez-Cruz, and MJ. Chamberlin. 1992. Parameters affecting transcription termination by Escherichia coli RNA polymerase. I. Analysis of 13 rhoindependent terminators. J. Mol. Bioi. 224: 31-51. Roberts, S. and D. Bentley. 1992. Distinct modes of transcription read through or terminate at the c-myc terminator. EMBO J. 11: 1085-1093. Robledo, R., M.E. Gottesman, and R.A. Weisberg. 1990. Lambda nutR mutations convert HK022 Nun protein from a transcription termination factor to a suppressor of termination. J. Mol. Bioi. 212: 635-643. Roesser, J.R. and C. Yanofsky. 1988. Ribosome release modulates basal level expression of the trp operon of Escherichia coli. J. BioI. Chern. 263: 14251-14255. Roesser, J.R., Y. Nakamura, and C. Yanofsky. 1989. Regulation of basal level expression of the tryptophan operon of Escherichia coli. J. BioI. Chern. 264: 12284-12288. Roghani, A., R.l. Gumport, and J.F. Gardner. 1985. Site-directed mutagenesis in the study of the molecular mechanism of attenuation in the threonine operon of Escherichia coli. UCLA Syrnp. Mol. Cell. BioI. 30: 553-564. Roland, K.L., C. Liu, and c.L. Turnbough, Jr. 1988. Role of the ribosome in suppressing transcriptional termination at the pyrBl attenuator of Escherichia coli K-12. Proc. Natl. Acad. Sci. 85: 7149-7153. Roland, K.L., F.E. Powell, and C.L. Turnbough, Jr. 1985. Role of translation and attenuation in the control of pyrBl operon expression in Escherichia coli K-12. J. Bacterial. 163: 991-999. Roof, W.D., K.F. Foltermann, and J.R. Wild. 1982. The organization and regulation of the pyrBl operon in E. coli includes a rho-independent attenuator sequence. Mol. Gen. Genet. 187: 391-400. Ryan, T. and MJ. Chamberlin. 1983. Transcription analyses with heteroduplex trp at- tenU~ term seh nel seri~ Sehne coli tion 257 Sehw typl teTI Shim ser 8a Siva cit sil Spe re Spe b I~ Ste ( Stt St S 1 Transcriptional Attenuation iven transcriptional att fE (upstream of pyrE) enuator. enCOdes ~nuation in the Escher' h' • nvolvmg the tryptoph coli an codon lC La 'richia coli RNA polym . . erase IS In. J. BioI. Chem. 265: 9960_ ~ transition of RNA poly me rase CJsphory lation of the carb I ~1-19629. oxy_ Halleux, and L. Thiry. 197 nthase: Relationships with e:~ J. Bacteriol. 127: 291-301. TP pools on attenuation at th 2-158. e re of ~he E~cherichia coli pyrE lated mterclstronic attenuation. . Functional organization and e biosynthetic operon. J. BioI. in. 1992. Parameters affecting 'merase. I. Analysis of 13 rhotranscription read through or 193. ,ambda nutR mutations convert ;tor to a suppressor of term ina- odulates basal level expression 14251-14255. lation of basal level expression ~m. 264: 12284-12288. e-directed mutagenesis in the the threonine operon of Es- )f the ribosome in suppressing !erichia coli K-12. Proc. Natl. ,ole of translation and attenua'ichia coli K-12. J. Bacteriol. rganization and regulation of tenuator sequence. Mol. Gen. ;es with heteroduplex trp at- 445 tenuator templates indicate that the transcript stem and loop structure serves as the termination signal. J. BioI. Chem. 258: 4690-4693. schnetz, K and B. Rak. 1988. Regulation of the bgl operon of Escherichia coli by transcriptional antitermination. EMBO J. 7: 3271-3277. Schnetz, K., C. Toloczyki, and B. Rak. 1987. f3-Glucoside (bgl) operon of Escherichia coli K-12: Nucleotide sequence, genetic organization, and possible evolutionary relationship to regulatory components of two Bacillus subtilis genes. J. Bacteriol. 169: 2579-2590. Schwartz, M. and J. Neuhard. 1975. Control of expression of the pyr genes in Salmonella typhimurium: Effects of variations in uridine and cytidine nucleotide pools. J. Bacteriol. 121: 814-822. Shimotsu, H., M.1. Kuroda, C. Yanofsky, and D.J. Henner. 1986. Novel form of transcription attenuation regulates expression of the Bacillus subtilis tryptophan operon. J. Bacteriol. 166: 461-471. SivaRaman, L., D. Reines, and C.M. Kane. 1990. Purified elongation factor SII is sufficient to promote read-through by purified RNA polymerase II at specific termination sites in the human histone H3.3 gene.J. BioI. Chem. 265: 14554-14560. Spencer, C.A. and M. Groudine. 1990. Transcription elongation and eukaryotic gene regulation. Oncogene 5: 777-785. Spencer, C.A., R.C. LeStrange, U. Novak, W.S. Hayward, and M. Groudine. 1990. The block to transcription elongation is promoter dependent in normal and Burkitt's lymphoma c-myc alleles. Genes Dev. 4: 75-88. Steitz, J.A. and K. Jakes. 1975. How ribosomes select initiator regions in mRNA: Base pair formation betweep the 3' terminus of 16S rRNA and the mRNA during initiation of protein synthesis in Escherichia coli. Proc. Natl. Acad. Sci. 72: 4734-4738. Stewart, V. and C. Yanofsky. 1985. Evidence for transcription antitermination control of tryptophanase operon expression in Escherichia coli K-12. J. Bacteriol. 164: 731-740. Stewart, V., R. Landick, and C. Yanofsky. 1986. Rho-dependent transcription termination in the tryptophanase operon leader region of Escherichia coli K-12. J. Bacteriol. 166: 217-223. Stroynowski, I. and C. Yanofsky. 1982. Transcript secondary structures regulate transcription termination at the attenuator of the Serratia marcescens tryptophan operon. Nature 298: 34-38. Turnbough, c.L., Jr. 1983. Regulation of Escherichia coli aspartate transcarbamylase synthesis by guanosine tetraphosphate and pyrimidine ribonucleoside triphosphates. J. Bacteriol. 153: 998-1007. Turnbough, c.L., Jr., KL. Hicks, and J.P. Donahue. 1983. Attenuation control of pyrBI operon expression in Escherichia coli K-12. Proc. Natl. A cad. Sci. 80: 368-372. von Hippel, P.H. and T.D. Yager. 1992. The elongation-termination decision in transcription. Science 255: 809-812. Weisblum, B. 1983. Inducible resistance to macrolides, lincosamides, and streptogramin type-B antibiotics: The resistance phenotype, its biological diversity, and structural elements that regulate expression. In Gene function in prokaryotes (ed. J. Beckwith et al.) pp. 91-121. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Wiest, D.K., D. Wang, and D.K Hawley. 1992. Transcription arrest of purified RNA polymerase II and washed elongation complexes at the adenovirus major late attenuation site. J. BioI. Chem. 267: 7733-7744. Williamson, R.M. and D.L. Oxender. 1992. Premature termination of in vivo transcription of a gene encoding a branched-chain amino acid transport protein in Escherichia coli. J. Bacteriol. 174: 1777-] 782. , 'r 446 R. Landick and C.L. Turnbough. Jr. Winkler, M.E. and C. Yanofsky. 1981. Pausing of RNA polymerase during in vitro tran_ scription of the tryptophan operon leader region. Biochemistry 20: 3738-3744. Wright, S. and J.M. Bishop. 1989. DNA sequences that mediate attenuation of trans . cnp_ tion from the mouse protooncogene myc. Proc. Nat!. A cad. Sci. 86: 505-509. Wright, S., L.F. Mirels, M.e.B. Calayag, and J.M. Bishop. 1991. Premature term,' . natIon of transcription from the PI promoter of the mouse c-myc gene. Proc. Nat!. Acad S . 88: 11383-11387. . Cl. Xu, L., S.D. Morgenbesser, and R.A. DePinho. 1991. Complex transcriptional regulatio of myc family gene expression in the developing mouse brain and liver. Mol. Cell. Bio~ 11: 6007-6015. Yager, T.D. and P.H. von Hippel. 1987. Transcript elongation and termination in Escherichia coli. In Escherichia coli and Salmonella typhirnurium: Cellular and molecular biology (ed. F.e. Neidhardt et al.), pp. 1241-1275. American Society for Microbiology, Washington, D.e. Yang, M.-T. and J.F. Gardner. 1989. Transcription termination directed by heteroduplex thr attenuator templates. J. Bioi. Chem. 264: 2634-2639. Yanofsky, C. 1984. Comparison of regulatory and structural regions of genes of tryptophan metabolism. Mol. Bioi. Evol. 1: 143-161. Yanofsky, e., R.L. Kelley, and V. Horn. 1984. Repression is relieved before attenuation in the trp operon of Escherichia coli as tryptophan starvation becomes increaSingly severe. J. Bacterial. 158: 1018-1024. Zengel, 1.M. and L. Lindahl. 1990. Ribosomal protein L4 stimulates in vitro termination of transcription at a NusA-dependent terminator in the S10 operon leader. Proc. Natl. Acad. Sci. 87: 2675,2679. --~--- 51