* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download POLYMERASE-CHAIN-REACTION (PCR) ANALYSIS OF
Dominance (genetics) wikipedia , lookup
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Metagenomics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Primary transcript wikipedia , lookup
Human genome wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA paternity testing wikipedia , lookup
Designer baby wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic library wikipedia , lookup
DNA profiling wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA vaccination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Molecular cloning wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
SNP genotyping wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
DNA supercoil wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
History of genetic engineering wikipedia , lookup
Deoxyribozyme wikipedia , lookup
The Auk 109(4):886-895, 1992 POLYMERASE-CHAIN-REACTION MICROSATELLITES--A GENETIC NEW RELATIONSHIPS HANS (PCR) ANALYSIS OF APPROACH TO STUDIES OF IN BIRDS ELLEGREN Departmentof AnimalBreedingandGenetics, SwedishUniversityof AgriculturalSciences, Box7055,S-75007 Uppsala,Sweden A13STRACT.--Genomic DNA libraries of the Barn Swallow (Hirundo rustica) and the Pied Flycatcher(Ficedulahypoleuca) were screenedfor the presenceof dinucleotidemicrosatellite repeats.Two thymine-guanine repeats,"(TG),," and two thymine-cytosinerepeats,"(TC),," were isolatedand sequencedfrom the two species,respectively.Polymerase-chain-reaction (PCR)analysisof 25 unrelatedBarn Swallowsand 10 unrelatedPied Flycatchersrevealed3 to 15 allelesper locusand heterozygosities in the rangeof 0.46to 0.89.Mendelianinheritance was confirmedfor all four loci in 10 Pied Flycatcherand 2 Barn Swallow families comprising a total of 240 meioses.The occurrenceof nonparentalalleles in offspringfrom two Barn Swallow families was consistentwith extrapair fertilization as revealed by a parallel DNAfingerprinting analysis.A DNA amount approximatelycorrespondingto 0.01/•1 blood was used for PCR analysis.DNA was also prepared from feathersand approximately1% of a preparation from a single remex or rectrix was sufficient for PCR amplification. One of the primer pairsfrom the Barn Swallow alsoamplified a polymorphiclocusin the House Martin (Delichonurbica)and in the Bank Swallow (R. riparia).Received 3 October1991,accepted 16 June 1992. DURINGTHElast 10 to 15 years,moleculargenetictechniqueshaveopenednew perspectives in biological research. Several ornithological fields provide good illustrations.For example, DNA-DNA hybridization has clearly contributed to avian systematics(Sibley and Ahlquist 1990), polymorphicpatternsof mitochondrial DNA (mtDNA) have aided in differentiation studiesof speciesand populations(Kesslerand Avise 1985),and polymorphismsof randomgenomic DNA segmentshave been usedto resolve questionsabout parentage (Quinn et al. 1987). Perhapsmost spectacularly,DNA fingerprinting, using minisatellite (Burkeand Bruford 1987, ments in eukaryoticgenomes.The most abundant dinucleotide variant in mammals, thymine-guanine repeats "(TG),," shows copy numbers in the order of 105 (Hamada et al. 1984a),on averageoccurringevery 30 kb (kilobasepairs) in the human genome(Stallingset al. 1991).Consideringall possiblesimple motifs there is probably one microsatelliteevery 6 kb in man (Beckmannand Weber 1992).Although their evolutionary conservation indicates a functional or structuralsignificance,there is yet no conclusiveevidencefor suggestedroles as hot-spot regions for recombination (Pardue et al. 1987),gene regulators(Hamada et al. 1984b), Wetton et al. 1987)or syntheticsimple-repeat or sequencesstimulating packing and conprobes(Ellegren 1991a),has proved to be the densing of chromosomes(Stallingset al. 1991). mostsensitivemethod for determiningthe geThe allelic variability at microsatelliteloci is netic relationshipsof individuals in a popula- usuallyhigh, with heterozygosities approach- tion (Burke 1989). Moreover, the isolation of ing 90%. As for minisatellites, the polymorphismis due to varying numberof repeatunits fied suchstudies(Gyllenstenet al. 1989,Hanot- (typically in range of 10-50), which can be rete et al. 1991). vealedby in vitroamplificationof the DNA segRecently,a new type of genetic marker, mi- ment of interest using the polymerasechain crosatellites, has received considerable attenreaction(PCR;Saiki et al. 1988)and subsequent tion in genome analyses(Litt and Luty 1989, gel electrophoresis(reviewedby Beckmannand Tautz 1989, Weber and May 1989). Microsatel- Soller 1990, Weber 1990, Litt 1991). In humans, locus-specific minisatelliteprobeshas simpli- lites are tandem stretches of mono-, di-, tri- or microsatellites tetranucleotidesequencemotifsthat frequently occur as randomly dispersed repetitive ele- serving as genetic markers in the human genome (HUGO) project,for instancefacilitating 886 have become invaluable tools October1992] AvianMicrosatellites the localizationof geneswith impactson genetic diseases(Froguel et al. 1992, Goto et al. 1992).The hypervariablenature of thesemarkersalsomakesthem highly suitablefor identity or parentagetesting (Edwardset al. 1991, 1992, Ellegren et al. 1992). In addition to work on humans, microsatel- 887 servedas a positive control. A negative control involving PCR mastermix without added DNA was alwaysincluded. DNA preparation.--DNAwas either preparedfrom venousbloodor from singlefeathers.In the former case,1 #1blood (frozen in EDTA capillarsand newly thawed) was diluted to 1 ml with water and incubated at room temperaturefor 15 min. After centrifugation at 10,000x g for 2 min, the supernatantwascarefully lites have been analyzed in the mouse (Mus musculus; e.g. Love et al. 1990),somedomestic removed(leavingabout25 #1)and discarded.A 5% animals(e.g. Fries et al. 1990, Crawford et al. Chelex (Biorad) solution was added to a final volume 1990, Ellegren et al. 1992, Wintere et al. 1992), of 200 #1 and incubated at 56øCfor 15 min. The mixand whales (Tautz 1989, Sch16tterer et al. 1991). ture was vortexed for 10 s, boiled for 8 rain and then In this study,I report the molecularcloning of avian microsatellites.Four dinucleotiderepeats vortexedagain.Followingcentrifugationasabove,1 were isolated from the Barn Swallow (Hirundo rustica)and the Pied Flycatcher(Ficedulahypoleuca),and the polymorphismwas investigated by PCR amplificationof DNA from unrelated individuals and families. to 5 #1of the supernatantwere taken to PCR and the remainderfrozen. Beforebeing usedagain,the sam- ple wasvortexedand centrifugated.Chelexis a chelatingstyrenedivinylbenzeneresinthatformsmulticoordinatedcomplexeswith bivalent metal ions that otherwisemay catalyzethe breakdownof DNA during boiling (cf. Ellegren 1992). Various types of feathers (primaries,secondaries and remiges)were usedfor DNA preparation.Feath- METHODS ers were collected from adult birds one to three weeks Cloneisolation.--The procedure followed Ellegren et al. (1992). Shortly, size-fractionated(200-500 base pairs)genomiclibrarieswere constructedfrom Barn Swallow DNA digestedwith AluI, HaeIII and HinfI in the plasmid vector pBluescriptSKII+, and from Pied FlycatcherDNA digestedwith the same enzymes in the phage vector M13mp18. The libraries were transferredto nylon membranesand screened with radioactivelylabelledpolynucleotide(TG),and poly(thymine-cytosine), (TC),, probesfor the presence of microsatellite-containingclones. Positive beforeanalysisand were storedat room temperature betweenwhen they were collectedandanalyzed.Approximately5 mm of the root part of a single shaft was cut into a few pieceswith a surgicalblade and transferred to 200 #1 5% Chelex and 2.5 #1 proteinase K (8 mg/ml). The mixturewasincubatedat 56øCfor at least4 h, and an additionalportion of proteinase K was addedone-halfway through the incubation step.After this treatmentthe samplewashandledas above(vortexing,boiling, vortexingand centrifugation) and 1 to 5 #1was taken to PCR. When handling and preparingthe feathersthe possiblerisk of concloneswere isolated and sequenced. Polymerase-chain-reaction analysis.--Microsatellite- taminationwas carefully avoidedby using a separate flanking PCR primers were synthesizedon the basis surgicalbladefor eachfeather.Unlessotherwisestated, datawill refer to analysisof DNA preparedfrom of the derived sequenceinformation.Primer labelling blood. (end-labelling with gamma-32p-dATP) and PCR reagentswere as previouslydescribed(Ellegrenet al. RESULTS 1992).PCR (10 #1)wascarriedout with approximately 50 ng templateDNA and 2 pmol primer (one primer labelled) in small Eppendorf tubes or in microtiter plate wells using a thermal cycler (Coy Laboratory Products,Inc., or Techne) in the following way: 1 cycle of 95øCfor 2 min, 55øCfor 30 s and 72øCfor 1 min; 25 to 29 cyclesof 94øCfor 1 min, 55øCfor 30 s and 72øCfor ! min. After the final cycle,a prolonged extensionstep of 5 min was added. I mixed 1 #1 of the product from the amplification reactionwith 95%formamideand dye, heatedto 75øC and separatedin 6% denaturingpolyacrylamidegels (standard"sequencing"gels). After electrophoresis, gelswere dried and amplificationproductsvisualized by autoradiographyfor 2 to 24 h. The sizesof alleles were determined by electrophoresisof an accompanying sequence reaction. Amplification of the cloned alleles also aided in size determination and Isolationof microsatellites.--Screening of about 2,000recombinantplasmidclonesfrom the Barn Swallow library with (TG), and (TC), probes yielded two TG-positive clones (STG1 and STG4). Sequenceanalysis of these clones revealed one perfect stretchof 12 TG repeatsand one compound structure of GA-GT repeats. Screeningof approximately the same number of phageclonesfrom the PiedFlycatcherlibrary yielded two TC-positive clones (PTC2 and PTC3).Theseconsistedof eight and 12 perfect TC-repeats,respectively,and were derivedfrom different loci. Primers (21 or 24 bp) for PCR amplificationwere synthesizedaccordingto the DNA sequencesflanking the repeat regions, 888 HANSELLEGREN [Auk,Vol. 109 TABLE1. Repeat structure and primer sequencesat two Barn Swallow (STG! and STG4) and two Pied Flycatcher (PTC2 and PTC3) microsatellite loci. Locus STG1 STG4 PTC2 PTC5 Primer A (5'-3') Repeatstructure TGAACAATGAGAGAACTGATGCAA ( GT) • CATCAAGAGAGGGATGGAAAGAGG ( GA) • ( GT)?A( TG) • TGATCGAAAGACCTGTAAGAT ( TC) • GTGTTCTTAAAACATGCCTGGAGG ( CT) • Primer B (5'-3') CATCACTCAGATGAGAAACTGGAA GAAAAGATTATTTTTCTTTCTCCC ATCAGCGTTAGACCAATACTCTTA GCACAGGTAAATATTTGCTGGGCC following recommendationsgiven by Luty et al. (1990). Repeat structuresand primer com- size differencescorrespondingto one and two repeat units, respectively).This situation did positions are indicated in Table 1. not prevent scoring since the occurrence of an PCR amplification andvariability.--PCRanaly- adjacentand slightly shorter allele was recogsis of Barn Swallow and Pied FlycatcherDNA nized asa strongsignal causedby the combined using primers designedto flank the microsatel- radiation from an extra band and a main band. Inheritancepattern.--To investigatethe inherlites gaveamplificationproductsof varying but approximately expectedsize. No individual ex- itancepattern of the avian microsatellites, they hibited more than two intense bands consistent were applied to families previously analyzed with a locus-specificamplification. Each"main" by DNA fingerprinting (data and DNA kindly band was associated with one or a few fainter bandsappearingimmediately below (i.e. being shorter than the main product; Fig. 1). These "extra" bands seem to be inevitable artifacts in provided by H•kan Tegelstr•Sm,Department of Genetics,Uppsala University). In 10 Pied Flycatcher (n = 52 offspring) and 2 Barn Swallow (n = 8 offspring) families, DNA fingerprinting PCR amplification of dinucleotide microsatellites, and are presumed to be the result of slippage events as the Taqpolymerasesynthesizes the complementarystrand of the repeat region (e.g. Litt and Luty 1989,Weber and May 1989, Luty et al. 1990). Cloning experiments have using the Jeffreys33.15 probe (Jeffreyset al. 1985)had failed to detectany illegitimateoffspring (the probe revealshighly variable DNA demonstrated allele at the PTC2, PTC3, STG1 and STG4 loci that extra bands lack one or a few fingerprints in the two species;Gelther et al. 1992, Smith et al. 1991). In microsatellite am- plifications of these families, every offspring repeat units (Luty et al. 1990, Riesset al. 1990), was also present in either of the parents; for a situationsupportedby the factthat extrabands homozygousoffspring,the allele was found in occur with multiples of the length of the repeat both parents (Fig. 2). Data were consistentwith unit. The possibilitythat the extrabandswould every parent transmitting one allele to eachoffreflecta geneticheterogeneityat the genomic spring and, thus, autosomalinheritance was inlevel can be ruled out by noting that amplifi- dicated in a total of 240 meioses (208 for Pied cationsof cloned microsatellitealleles display Flycatcherand 32 for BarnSwallow).However, extra band patterns identical to genomic am- sex linkage could not be completely excluded for STG1 since offspring were unsexedand the plifications (e.g. Ellegren et al. 1992). Analysis of unrelated individuals revealed femaleappearedto be homozygousin both famextensivepolymorphismat all four avian micro- ilies. satellite loci (e.g. Fig. 1). Ten Pied Flycatchers Detectionof extrapairfertilization.--Given the showed four different alleles at the PTC2 locus assumption that microsatellites are stably in(expectedheterozygosity[Hexp] = 0.49)and eight herited, the hypervariable nature of these allelesat the PTC3 locus(H•xp= 0.76). A more markerssuggests that they couldbe usefulfor extensivescreeningof 25 unrelated Barn Swal- detecting extrapair paternity or intraspecific lows revealed heterozygositiesof 0.89 and 0.46 brood parasitismin birds. In two Barn Swallow at the STG1and STG4loci,respectively.As many families, DNA fingerprinting had demonstratas 15 alleles were found at STG1. The observed ed two (of three) and four (all) illegitimate offallele frequenciesat the Barn Swallow loci are spring, respectively(Tegelstr•Smunpubl. data; summarized in Table 2. extrapairpaternityis known from previousDNA The extra bands of one allele sometimes were studiesof the BarnSwallow [Smith et al. 1991]). in juxtapositionto the other allele (e.g. hetero- An analysis of the segregationpattern at the zygousindividuals 2 and 6 in Fig. 1 show allele STG1 and STG4 microsatellite loci in these two October1992] AvianMicrosatellites 889 TABLE2. Estimatedallele frequenciesat the Barn Swallow STG1 and STG4 microsatellite loci (n = 25 individuals). Allele size (bp) Frequency STG1 200 228 230 232 234 236 238 240 242 244 252 256 260 262 268 0.02 0.05 0.16 0.11 0.05 0.04 0.07 0.11 0.20 0.02 0.02 0.05 0.05 0.07 0.02 STG4 135 137 139 Fig. 1. PCR amplificationof the STG1 microsatellite locus in eight unrelated Barn Swallows. Alleles 0.14 0.70 0.16 indicatedby arrows. obtainedafter overnight exposure(Fig. 4). The strengthof the signalsvaried between individuals suggestingdifferent DNA yields from the families revealednonparentalalleles in all six illegitimate offspring.One of the female alleles was present in all offspring, whereas the two malesapparentlydid not transmitallelesto any offspring (Fig. 3). The presence of nonparental microsatellite allelesmay either be due to falseparentageand/ or to mutation.Here, falseparentagewasknown from previous experimentsand, thus, it is reasonable that the observed microsatellite patternsresultedfrom it. The lack of male-specific alleles suggeststhat all offspring in these families were the outcomeof cuckoldry.Sincethe preparations. mutation rate at microsatellite loci seem to be Cross-species analysis.--Primersflanking the BarnSwallow microsatellites were alsoapplied to DNA preparedfrom the House Martin (Delichonurbica)and from the Bank Swallow (R. ri- paria;in both cases,feather preparationsused). The annealing temperaturein the PCR reaction was decreased to 45øC to allow a certain mis- matchbetween the primers and the heterogenous sequences.Whereas no specificampliftcation product was obtained at STG1, the STG4 locus yielded a distinct two-allele polymorphism in six unrelated individuals of both species (data not shown). The House Martin and Bank Swallow alleles were identical to two of significantly lower than at minisatellite loci (Kwiatkowskiet al. 1992),the presenceof a non~ parental microsatelliteallele may in practicebe used as a marker of false parentage (see Dis- the BarnSwallow alleles,but the 135 bp allele that showeda frequencyof just 0.14 in the Barn Swallow was presentin 10 of 12 chromosomes cussion). in the other species.Whether these shared al- Analysisoffeathers.--Asan alternativeto blood sampling,featherswere evaluatedfor their suitability in serving asa DNA sourcefor PCR analysis. By a simple protease/boiling procedure, DNA was preparedfrom about5 mm of the root part of single remex and rectrix from the Barn Swallow. Using approximately 1% of a preparation asstartingmaterial in PCR reactions,autoradiographysignalsof suitablestrengthwere lelesreflecta commonancestryof allelesor are due to a denovogeneration of alleles of the same size cannot be resolved. DISCUSSION Previous hybridization studies have indicated the frequent occurrenceof dinucleotide repeats in avian genomes (Hamada et al. 1982), 890 HANS ELLEGREN [Auk, VoL 109 b F M F ½ M F M Fig. 2. PCR amplification of avian microsatelliteloci in families with parentageconfirmedby DNA fingerprinting.F is female,M ismale,arrowson eachsideindicateallelesof femaleandmale origin,respectively. Analysisof: (a) a Pied Flycatcherfamily at PTC3 locus,(b) a different Pied Flycatcherfamily at PTC2 locus, and (c) a Barn Swallow family at STG1 locus. be useful for monitoring the geneticvariability in populations aswell asfor investigating close show that microsatellites in the Barn Swallow geneticrelationships(e.g. parentage). In the latter casean important prerequisite is and the Pied Flycatcherdisplay a considerable degreeof polymorphism(i.e. hypervariability), that alleles are stably inherited without a siga factsuggestingthat this type of markercould nificant elementof mutation to new length albut this constitutesthe first report of the molecularcloning of suchsequences. Presentdata a M b F M F Fig.3. Detectionof extrapairfertilizationin two BarnSwallowfamilieswith aid of PCR-analyzed microsatellitepolymorphisms. M (male)is putativefather,F (female)is putativemother,solidarrowson eachside refer to maleand femalealleles,respectively,and openarrowsindicatenonparentalalleles.(a) Analysisof a BarnSwallowfamilyat STG1locus,and (b) analysisof a differentfamilyat STG4locus.DNA fingerprinting had revealedthat all offspringin family a and offspring1 and 3 in familyb were illegitimate. October 1992] AvianMicrosatellites 891 leles. I found no mutation among 240 meioses (with parentage confirmed by DNA fingerprinting), indicating that mutation events should be rare at these dinucleotide repeats.In humans,an extensivebody of literatureon microsatellitestabilityhasemergedin recentyears. Thus far, only a single report describeslength mutations (two) at dinucleotide microsatellite loci (Kwiatkowski et al. 1992). These mutations were found in a sampleof 4,480meiosesleading to an estimated mutation rate of 4.5 x 10-4 per meiosis.This figure should however be related to numerousreportswhich have failed to detect any spontaneousmutation to new length alleles. For example, completely stable inheritancehasbeen found in samplesof a few hundred to thousands of meioses,as investigated by Dracopoliand Meisler (1990), Love et al. (1990; mouse data), Kwiatkowski et al. (1991), Morral et al. (1991), Oudet et al. (1991), Petersen et al. (1990), Richards et al. (1991), Small et al. (1991), Todd et al. (1991; mousedata), Weber et al. (1991), Decker et al. (1992), Edwards et al. (1992),Fornageet al. (1992),Froguelet al. (1992), Fig. 4. PCR amplificationof STG1 microsatellite locusin six unrelated BarnSwallowsusingDNA pre- pared from single feathers.N is a negativecontrol with PCR master mix, but without added DNA. Ar- rows refer to interpreted alleles. Goto et al. (1992), Hazan et al. (1992), and Wilkie et al. (1992). Moreover, documented data sets with 20 to 100 stable meioses exceed 100 (for hybridization with one multilocus DNA fingerprinting probe. However, severalmicrosatinstance, see recent issues of Nucleic Acids Reellite loci can be analyzed simultaneouslyin search).Altogether, there may be in the order multiplex PCR reactionsand also separatedin of 50,000 human microsatellite meioses pub- the same gel (Luty et al. 1990, Edwards et al. lished and still only two mutationshave been 1991, Ellegren et al. 1992, Hazan et al. 1992). found (i.e. mutation rate of about 10-4 to 10-5). ApplyingJamieson's (1965)formulaefor excluClearly, this givesevidencefor a significantly sionpower,a combinationof five microsatellite more stable situation than the high mutation loci each having a heterozygosityof about 0.8 rate characterizingminisatellite loci (Jeffreyset yieldsan efficiencyof 0.98 to 0.99for detection al. 1988;reportedratesof 1.1 x 10-2 to 2 x 10-3 of falsepaternity (given known maternity). The in birds, Burke and Bruford 1987, Westneat samepoweris reachedwith only threeloci hav1990).Furthermore, observationsof very strong ing a polymorphismcorrespondingto the Barn linkage disequilibrium between microsatellite Swallow STG1 locus. The efficiency given by loci and adjacentpolymorphicmarkersare like- this combination of markers would imply that, ly to reflect stability even on an evolutionary if there is a match between the alleles of an time scale(Chehab et al. 1991, Oudet et al. 1991). offspringand its putative father, paternity will Although it remainsto be shown,using ped- be incorrectlyassignedin 1 or 2 casesof 100. igree material with parentage confirmed by However, as soon as the alleles of an offspring DNA fingerprinting, that avian microsatellites and either of its putative parentsdo not match, are as stable as in humans, it is difficult from a an illegitimate mating can almost certainly be molecularpoint of view to seewhy they would concluded due to the apparent stability of the behave in a different manner. Thus, it is likely systems.To properly distinguish between exthat avian microsatellites will serve as effective trapair fertilization and intraspecificbrood parasitismin caseswhen offspringlackallelesfrom tools for the detection of extrapair parentage. Practicalaspectsof microsatellites in parentage their putative father but display allelespresent testing.--With regard to parentage testing, an in their putative mother, probability estimates analysisof the polymorphismat onemicrosatel- establishedon the basisof allele frequenciesin lite locus will not of course be as effective as the population need to be considered. 892 HANSEL•.EGREN [Auk,Vol. 109 If the extremevariability producedby DNA ysisallows samplesto be collectedeven when fingerprinting can be dispensedwith, locus- birdsare absent.For example,featherscollected specificsystemsoffer the generaladvantageof at nests or from areas where birds have been a simplergeneticinterpretation.This is further moltingare likely to give necessary DNA yields. accentuatedin microsatellite analysis since:(a) Sinceabout 1%of the preparationsfrom single alleles can be distinguished(which may not be remiges and rectrices was sufficient for PCR the case in agarose electrophoresisof large analysis,smaller feathers (e.g. covertsor body minisatellite alleles of similar size; Devlin et al. feathers)also would probably be suitable for 1991)and definedby size, thusallowing com- analysis. puterization and the exchange of data or colOne promisingpossibilitywith feathersas a laborative studiesbetween laboratories;(b) re- DNA sourceand PCR as a hypersensitivedecent advanceswith "sequencinginstruments" tection method is to DNA type specimensof and softwaredesignedto registratemicrosatel- birds in museums.Although old DNA generlite polymorphismspermit an automatedand ally is degradedto someextent,relatively short nonradioactive assay for these markers (Ed- microsatelliteregionsmay be intact (cf. Hagelwards et al. 1991); and (c) even with manual berg et al. 1991). Using the microsatelliteloci handling the time schedulefrom DNA prepa- describedin this study,I have typed more than ration to result need not be longer than 24 h. 100-year-oldBarnSwallowsand Pied FlycatchAn obviouslimitation,however,to the prac- ers stored as museum skins (Ellegren 1991b, tical value of microsatellitepolymorphismsis 1992).The obviousbenefit of suchan approach that primersdesignedfor one specieswill only is that the geneticvariability may be monitored amplify a correspondinglocusin closelyrelated overtime. Thiscanhavemajorsignificancewhen species. This has been shown for some mamdesigningconservation strategiesfollowing,for mals(Moore et al. 1991),including somewhales example, an extensive population bottleneck. (SchliSttereret al. 1991). In the latter case, miFurthermore,thisapproachwould allow the gecrosatellite-flanking primerscouldamplifyhet- netic analysisof extinct species(cf. Thomaset erologoussequencesin speciesthought to have al. 1989). been separatedfor 20 million years. The Barn Swallow STG4 primers also amplified a polyACKNOWLEDGMENTS morphic locusin the HouseMartin and the Bank Swallow (estimatedsplit 5-10 million yearsago; Sibley and Ahlquist 1990), showing that amplification of microsatellitesin closelyrelated speciesholds true for birds as well. Generalconsiderations of PCRanalysis.--PCRis most efficiently performed with sequences shorter than 1 to 2 kb. Thus, microsatellites are more adaptableto PCR than minisatellitesdue to their smallersize.Regardingthe minute template-DNA requirements,I useda DNA amount approximatelycorrespondingto a blood vol- ume of 0.01 /•1 for each PCR reaction.Using conventionalblood-samplingtechniques,this would imply that the DNA amount will not limit the possibility of performing repeated DNA analyses. Moreover, the demonstration that feathersmaybe usedfor DNA typing adds a new perspectiveto the sampling routines in genetic studies of birds. First, collecting feathers is obviously easier than collecting blood. Second,sincefeathersmaybe storedat ambient temperaturebefore DNA preparation,there is I am grateful to: Hfikan Tegestr/Sm for generously providing DNA, blood samplesand unpublished DNA-fingerprinting datanecessaryfor investigating the inheritance of the microsatellites; Rauno Alatalo, Arne Lundberg,Anders Pape Moller and Jan Petterssonfor collectingsamples;and Leif Andersson for valuablecommentson the manuscript.This study was given financialsupportby the Uddenberg-Nordingskaand Nilsson-Ehlefoundations. LITERATURE CITED BECKMANN,J. S., AND M. SOLLER. 1990. Towards a unifiedapproachto geneticmappingof eukaryotesbasedon sequence taggedmicrosatellite sites. Biotechnology8:930-932. BECKMANN, J. S., ANDJ. L. WEBER.1992. Survey of human and rat microsatellites. Genomics 12:627- 631. BURKE, T. 1989. DNA fingerprinting and other methodsfor the studyof mating success. TrendsEcol. & Evol. 4:139-144. BURKE, T., ANDM. W. BRUFORD. 1987. DNA fingerprinting in birds. Nature (Lond.) 327:149-152. no need for freezingfacilitieswhen sampling CHEHAB,F. F., J. JOHNSON,E. LOUIE,M. GOOSSENS, E. or transporting specimens.Third, feather anal- KAWASAKI, ANDH. ERLICH.1991. A dimorphic October1992] AvianMicrosatellites 4-bp repeat in the cysticfibrosisgene is in absolute linkage disequilibrium with the /•F508 mutation:Implicationsfor prenataldiagnosisand mutation origin. Am. J. Hum. Genet. 48:223-226. CRAWFORD, A. g., F. C. BUCHANAN,AND P. A. $WAR- BRICK. 1990. Ovine dinucleotide repeat polymorphism at the MAF 18 locus.Anim. Genet. 21: 433-434. 893 CollaredflycatchersFicedula hypoleuca x albicollis. Ibis 134:62-68. GOTO, g., g. RUBENSTEIN,J. WEBER,K. WOODS, AND D. DRAYNA.1992. Geneticlinkage of Werner's syndrome to five markers on chromosome8. Nature (Lond.) 355:735-738. GYLLENSTEN, U. B., S. JAKOBSSON, H. TEMRIN,AND A. C. WILSON. 1989. Nucleotide sequenceand Be- DECKER, R. A., J. MOORE,g. PONDER,ANDJ. L. WEBER. nomicorganizationof bird minisatellites.Nucl. Acids Res. 17:2203-2214. 1992. Linkagemapping of human chromosome 10 microsatellitepolymorphisms.Genomics12: HAGELBERG, E., I. C. GRAY, AND A. J. JEFFREYS.1991. 604-606. Identification DEVLIN, B., N. Pasco, AND K. ROEDER. 1991. Esti- mation of allele frequenciesfor VNTR loci. Am. J. Hum. Genet. 48:662-676. DRACOPOLI, N. C., AND M. H. MEISLER. 1990. Map- ping the human amylasegene cluster on the proximal short arm of chromosome i using a highly informative(CA)nrepeat.Genomics7:97102. T. CASKEY.1991. DNA typing and genetic mapping with trimeric and tetramericrepeats.Am. J. Genet. 49:746-756. of a murder 429. HAMADA, H., M. G. PETRINO, AND T. KAKANUGA. 1982. A novel repeatedelement with Z-DNA-forming potentialis widely found in evolutionarydiverse eukaryoticgenomes.Proc. Natl. Acad. Sci. USA 79:6465-6469. AND R. CHAKRABORTY. MAN, AND g. D. $TOLLAR. 1992. Genetic variation at five trimeric and tetramerictandemrepeatloci in four humanpopulationgroups.Genomics12: 241-253. 1984a. Characteriza- tion of genomic poly (dT-dG) poly (dC-dA) sequences:Structure, organization, and conformation. EDWARDS,A., H. A. HAMMOND, L. JIN, C. T. CASKEY, Mol. Cell. Biol. 4:2610-2621. HAMADA, H., g. SEIDMAN,g. H. HOWARD, AND C. g. GORMAN.1984b. Enhancedgene expressionby the poly (dT-dG) poly (dC-dA) sequences.Mol. Cell. Biol. 4:2622-2630. HANOTTE,O., T. BURKE,J. A. L. ARMOUR,AND A. J. ELLEGREN, H. 1991a. Fingerprintingbirds'DNA with a polynucleotideprobe (TG)n.Auk 108:956-958. ELLEGREN, H. 1991b. DNA typing of museum specimens of birds. Nature (Lond.) 354:113. ELLEGREN,H. 1992. Genomic DNA from museum feathers. In Ancient DNA (B. Herrmann and S. Hemmel, Eds.).New York, Springer-Verlag.In JEFFREYS. 1991. HypervariableminisatelliteDNA sequencesin the Indian Peafowl Pavo cristatus. Genomics 9:587-597. HAZAN, J., C. DUBAY, M-P. PANKOWIAK, N. BECUWE, AND J. WEISSENBACH. 1992. A genetic linkage map of human chromosome20 composedentirely of microsatellite markers. Genomics 12:183189. press. ELLEGREN,H., M. JOHANSSON,K. SANDBERG,AND L. ANDERSSON. 1992. Cloning of highly polymorphic equine microsatellites.Anim. Genet. 22:133142. FORNAGE,g., L. CHAN, G. $IEST,AND E. BOERWINKLE. 1992. Allele frequency distribution of the (TG)n(AG)mmicrosatellitein the apolipoprotein C-II gene. Genomics 12:63-68. FRIES,R., A. EGGEN,AND G. $TRANZINGER. 1990. The bovine genomecontainspolymorphic microsatellites. remains HAMADA,H., M. G. PETRINO,T. KAKANUGA,M. SEID- EDWARDS,A., A. CIVITELLO, H. A. HAMMOND, AND C. Hum. of the skeletal victim by DNA analysis.Nature (Lond.) 352:427- Genomics 8:403-406. FROGUEL,P. H., g. VAXILLAIRE, F. SUN, G. VELHO, H. ZOUALI, M. O. BUTEL, $. LESAGE, N. VIONNE•, K. JAMIESON, A. 1965. The geneticsof transfertins in cattle. Heredity 20:419-441. JEFFREYS, A. J., N. J. ROYLE,V. WILSON,AND Z. WONG. 1988. Spontaneous mutationratesto new length allelesat tandem-repetitivehypervariableloci in human DNA. Nature (Lond.) 332:278-281. JEFFREYS, A. J., V. WILSON, AND $. L. THEIN. 1985. Hypervariable'minisatellite'regionsin human DNA. Nature (Lond.) 314:67-73. KESSLER, L. G., ANDJ. C. AVISE. 1985. A comparative description of mitochondrial DNA differentia- tion in selectedavian and other vertebrategenera. Mol. Biol. Evol. 2:109-125. CLEMENT, F. FOURGEROUSSE,Y. TANIZAWA, J. WEISSENBACH, J. S. BECKMANN,G. g. LATHROP,P. H. PASSA,M. A. PERMUTT, AND D. COHEN. 1992. KWIATKOWSKI,D. J., T. G. NYGAARD, D. E. SCHUBACK, $. PERMAN,J. M. TRUGMAN, $. B. BRESSMAN,R. E. BURKE,M. F. BRIN, L. OZELIUS,X. O. BREAKEFIELD, Close linkage of glucokinaselocus on chromosome 7p to early-onset non-insulin-dependent S. FAHN, AND P. L. KRAMER. 1991. Identification diabetes mellitus. Nature (Lond.) 356:162-164. GELTHER,H. P., H. TEGELSTR•M,AND L. GUSTAVSSON. 1992. Evidencefrom hatchingsuccess and DNA fingerprintingfor the fertility of hybrid Pied x of a highly polymorphic microsatellite VNTR within the argininosuccinatesynthetaselocus: Exclusionof the dystoniageneon 9q32-34asthe causeof dopa-responsivedystoniain a large kindred. Am. J. Hum. Genet. 48:121-128. 894 H•NS ELLEGREN KWIATKOWSKI,D. J., E. P. HENSKE,K. WEIMER, L. OZELIUS, J. F. GUSELLA,AND J. HAINES. 1992. Con- structionof a GT polymorphismmap of human 9q. Genomics 12:229-240. Lrrr, M. 1991. PCR of TG microsatellites.Pages8599 in PCR: A practical approach (M. C. McPherson,P. Quirke, and G. Taylor, Eds.).Oxford Univ. Press, Oxford. Lrrr, M., ANDJ. A. LUTY. 1989. A hypervariablemicrosatelliterevealed by in vitro amplification of a dinucleotide repeat within the cardiacmuscle actin gene. Am. J. Hum. Genet. 44:397-401. LOVE, J. M., A.M. KNIGHT, M. A. MCALEER,AND J. A. TODD. 1990. Towardsconstructionof a high resolution map of the mouse genome using PCR- [Auk, Vol. 109 RIESS,O., C. KAMMERBAUER, L. ROEWER,V. STEIMLE,g. ANDREAS,E. ALBERT,T. NAGAI, AND J. T. EPPLEN. 1990. Hypervariability of intronic simple (gt)n(ga)mrepeatsin HLA-DRB genes. Immunogenetics32:110-116. SAIKI,R. K., D. H. GELFLAND, S. STOFFEL, S. J. SCHARF, R. HIGUCHI, G. T. HORN, K. g. MULLIS, AND H. A. ERLICH. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.Science239:487-491. SCHL•TTERER,C., B. AMOS, AND D. TAUTZ. 1991. Con- servation of polymorphic simple sequence loci in cetaceanspecies.Nature (Lond.) 354:63-65. SIBLEY, C. G., AND J. E. AHLQUIS•r.1990. Phylogeny and classificationof birds: A study in molecular evolution. Yale Univ. Press, New Haven. SMALL,K. W., J. L. WEBER,W-Y. HUNG, J. VANCE, A. ROSES,ANDM. PERICAK-VANCE.1991. North CarLutY, J. A., Z. Guo, H. F. WILLARD,D. H. LEDBETTER, analysedmicrosatellites.Nucl. AcidsRes.18:4123- 4130. S. LEDBETTER, ANDM. LITT. 1990. Five polymorphic microsatelliteVNTRs on the human X chromosome. Am. J. Hum. Genet. 46:776-783. MOORE,S. S., L. L. SARGEANT, T. J. KING, J. S. MATTICK, M. GEORGES, AND D. J. S. HETZEL. 1991. The con- olina macular dystrophy:Exclusionmap using RFLPs and microsatellites. Genomics 11:763-766. SMITH, H. G., R. MONTGOMERIE,T. POLDMAA, B. N. WHITE,ANDP. T. BOAG. 1991. DNA fingerprinting reveals relation between tail ornaments and cuckoldryin Barn Swallows,Hirundorustica.Be- servationof dinucleotidemicrosatellitesamong hav. Ecol. 2:90-98. mammalian genomesallows the use of heterologousPCRprimer pairsin closelyrelatedspecies. STALLINGS,R. L., A. F. FORD,D. NELSON,D. C. TORNEY, Genomics 10:654-660. C. E. HILDEBRAND,AND R. K. MOYZIS. 1991. Evo- MORRAL, N., V. NUNES, T. CASALS,AND X. ESTIVILL. 1991. CA/GT microsatellite alleles within the lution and distribution of (GT)n repetitive sequencesin mammalian genomes.GenomicsI0: cysticfibrosistransmembraneconductanceregulator (CFTR)gene are not generatedby unequal crossingover. Genomics10:692-698. TAUTZ,D. 1989. Hypervariability of simplesequences as a general source for polymorphic DNA OUDET,C., R. HEILIG,A. HANAUER,AND J-L. MANDEL. 1991. Nonradioactiveassayfor new microsatellite polymorphismsat the 5' end of the dystrophin gene, and estimationof intragenicrecombination. Am. J. Hum. Genet. 49:311-319. PARDUE, M. L., K. LOWENHAUPT, A. RICH, AND A. 807-815. markers. Nucl. Acids Res. 17:6463-6471. THOMAS, R. H., W. SCHAFFNER,A. C. WILSON, AND S. P'./d•BO.1989. DNA phylogeny of the extinct marsupial wolf. Nature (Lond.) 340:465-467. TODD,J. A., T. J. AITMAN, R. J. CORNALL,S. GHOSH,J. R. S. HALL, C. M. HEARNE,A. M. KNIGHT,J. M. NORDHEIM.1987. (dC-dA)n(dG-dT)nsequences have evolutionary conservedlocationsin drosophila with implications for roles in chromo- LOVE, M. A. MCALEER,J-B. PRINS, N. RODRIGUES, some structure and function. EMBO (Eur. Mol. ysis of autoimmune type I diabetesmellitus in M. LATHROP, A. PRESSEY,N. H. DELARATO, L. B. PETERSEN,AND L. S. WICKER. 1991. Genetic anal- mice. Nature (Lond.) 351:542-547. PETERSEN, M. B., E. P. ECONOMOU,S. A. SLAUGENHAUPT, WEBER, J.L. 1990. Human DNA polymorphismsand A. CHAKRAVARTI,AND S. A. ANTONARAKIS. 1990. methods of analysis. Curt. Opin. Biotechnol. Biol. Organ.) J. 6:1781-1789. Linkage analysisof the human HMGI4 gene on chromosome21 using a GT dinucleotiderepeat as polymorphicmarker. Genomics7:136-138. QUINN, T. W., J. S. QUINN, F. COOKE,AND B. N. WHITE. 1987. DNA marker analysisdetectsmultiple maternity and paternity in singlebroodsof the Lesser Snow Goose. Nature (Lond.) 326:392-394. RICHARDS,R. I., K. HOLMAN, Y. SHEN, H. KOZMAN, H. HARLEY, D. BROOK, AND D. SHAW. 1991. Human glandular kallikrein genes:Geneticand physical mappingof the KLK1locususinga highly polymorphic microsatellitePCR marker. Genomics! 1: 77-82. 1:166-171. WEBER,J. L., AND P. E. MAY. 1989. Abundant class of human DNA polymorphismswhich can be typed using the polymeraBechain reaction. Am. J. Hum. Genet. 44:388-396. WEBER,J. L., M. H. POLYMEROPOULOS, P. E. MAY, A. E. KWITEK, H. XIAO, J. D. MCPHERSON,AND J. J. WASMUZH. 1991. Mapping of human chromosome 5 microsatelliteDNA polymorphisms.Genomics 11:695-700. WESTNEAT, D. F. 1990. Genetic parentagein the Indigo Bunting: A study using DNA fingerprinting. Behav. Ecol. Sociobiol.27:67-76. October1992] AvianMicrosatellites WET'tON, J. H., R. E. CARTER,D. T. PARKIN, AND D. WALTERS.1987. Demographic study of a wild HouseSparrowpopulationby DNA fingerprinting. Nature (Lond.) 327:147-149. WILKIE,P. J., D. B. KRIZMAN,AND J. L. WEBER.1992. Linkage map of human chromosome9 microsatellite polymorphisms.Genomics 12:607-609. WINTERO, A-K., 895 M. FREDHOLM, AND P. DYBDAHL THOMSEN.1992. Variable (dG-dT)n (dC-dA)n se- quencesin the porcine genome.Genomics12: 281-288.