Download Barley Cbf3 Gene Identification, Expression Pattern, and Map Location

Barley Cbf3 Gene Identification, Expression Pattern, and
Map Location1
Dong-Woog Choi2, Edmundo M. Rodriguez, and Timothy J. Close*
Department of Botany and Plant Sciences, University of California, Riverside, California, 92521–0124
Although cold and drought adaptation in cereals and other plants involve the induction of a large number of genes,
inheritance studies in Triticeae (wheat [Triticum aestivum], barley [Hordeum vulgare], and rye [Secale cereale]) have revealed
only a few major loci for frost or drought tolerance that are consistent across multiple genetic backgrounds and environments. One might imagine that these loci could encode highly conserved regulatory factors that have global effects on gene
expression; therefore, genes encoding central regulators identified in other plants might be orthologs of these Triticeae stress
tolerance genes. The CBF/DREB1 regulators, identified originally in Arabidopsis as key components of cold and drought
regulation, merit this consideration. We constructed barley cDNA libraries, screened these libraries and a barley bacterial
artificial chromosome library using rice (Oryza sativa) and barley Cbf probes, found orthologs of Arabidopsis CBF/DREB1
genes, and examined the expression and genetic map location of the barley Cbf3 gene, HvCbf3. HvCbf3 was induced by a
chilling treatment. HvCbf3 is located on barley chromosome 5H between markers WG364b and saflp58 on the barley cv
Dicktoo ⫻ barley cv Morex genetic linkage map. This position is some 40 to 50 cM proximal to the winter hardiness
quantitative trait locus that includes the Vrn-1H gene, but may coincide with the wheat 5A Rcg1 locus, which governs the
threshold temperature at which cor genes are induced. From this, it remains possible that HvCbf3 is the basis of a minor
quantitative trait locus in some genetic backgrounds, though that possibility remains to be thoroughly explored.
When plants are exposed to environmental stress
such as drought, cold, or high salt, they undergo
physiological and biochemical adaptations (Bray,
1993; Ingram and Bartels, 1996; Thomashow, 1999). It
has been established that plants have at least two
major pathways, abscisic acid (ABA) dependent and
ABA independent, for the induction of moisture deficit stress-inducible genes (Shinozaki and YamaguchiShinozaki, 1997). ABA-independent gene activation
often involves a cis-acting element called a dehydration response element (DRE; also known as a C repeat
[CRT]) that responds to drought and low temperature
(Baker et al., 1994; Yamaguchi-Shinozaki and Shinozaki, 1994) and has been found in many plants
(Jiang et al., 1996; Dunn et al., 1998; Choi et al., 1999).
Stockinger et al. (1997) identified a transcription factor that binds the DRE/CRT element. This protein,
designated CBF1 (C-repeat binding factor 1), has a
potential nuclear localization sequence (NLS), an
AP2-DNA-binding domain, and an acidic activation
domain. The Arabidopsis CBF (DREB1) genes are a
small multigene family consisting of six paralogs that
1
This work was supported by the U.S. Department of Agriculture/Cooperative State Research, Education, and Extension Service (grant no. 95–37100 –1595) and by the California Agricultural
Experiment Station (Hatch grant no. 5306 –H).
2
Present address: Eugentech Inc., 52 Oun-Dong, Yousong, Taejon 305–333, Republic of Korea.
* Corresponding author; e-mail [email protected]; fax
909 –787– 4437.
Article, publication date, and citation information can be found
at www.plantphysiol.org/cgi/doi/10.1104/pp.003046.
include three intensively studied genes (CBF1/
DREB1B, CBF2/DREB1C, and CBF3/DREB1A) in an
8.7-kb region on chromosome 4 (Gilmour et al., 1998;
Liu et al., 1998), and lesser studied genes on chromosome 5 (CBF4/DREBID; Nakamura et al., 1998; Thomashow et al., 2001) and chromosome 1 (DREB1E
and DREB1F; Sakuma et al., 2002). The expression
patterns of these genes have notable differences. For
example, only the three CBF/DREB1 genes on chromosome 4 have been shown to be chilling induced
(CBF/DREB1), and there are differences when comparing root versus shoot expression (Gilmour et al.,
1998; Sakuma et al., 2002). The extent to which expression varies among alleles of individual CBF/
DREB1 genes is not yet known. The CBF/DREB1 gene
family seems not to be subject to autoregulation because no DRE/CRT element is present in the promoter region of CBF/DREB1 genes. Overexpression
of CBF/DREB1 in Arabidopsis induces expression of
several target genes and enhances freezing tolerance
(Jaglo-Ottosen et al., 1998; Kasuga et al., 1999). Liu et
al. (1998) isolated other trans-acting factors, DREB2A
and DREB2B, which also bind the DRE/CRT element. The DREB2 proteins contain a Ser-/Thr-rich
domain, and have no significant sequence similarity
to CBF/DREB1 proteins, except for the presence of
NLS and AP2 domains. The DREB2 genes are induced by dehydration and salt stress, but not cold
stress (Liu et al., 1998; Nakashima et al., 2000). In
summary, there are two different types of DRE-/
CRT-binding factors, CBF/DREB1 and DREB2, keyed
by at least somewhat separate signal transduction
pathways.
Plant Physiology, August 2002, Vol.Downloaded
129, pp. 1781–1787,
from on June
www.plantphysiol.org
15, 2017 - Published
© by
2002
www.plantphysiol.org
American Society of Plant Biologists
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
1781
Choi et al.
Table I. Gene-specific oligonucleotide sequences used in this
work
Gene
OsCbf1
HvCbf3
Dhn8
Dhn4
28S-rRNA
Primer Name
Sequence (5⬘ to 3⬘)
RCBF-1
RCBF-2
BCBF3-1
BCBF3-2
BCBF3-3
BCBF3-4
BCBF3-7
BCBF3-8
Dc18-4-5
Dc18-4-6
Dc15-108-5
Dc15-108-10
28S-RNA-1
28S-RNA-2
ACTGCTTGAGACGTCGCAC
GGTTCAGCTGCTGGACCG
GCACCATGCTCAGACTGTTC
CAACATCTTCACTCTAAAAGAGGAA
CGAACGACGCTGCCATGCTC
GGACCCAGACGACGGAGATA
TGAAATGTTCAGGCTTGACTTGTT
TGTAGTACGAGCCCAGGTCCAT
GTGGAAGAGCCCGAGGTTAAG
CACCTCACCGTTCTCATCGA
CATGAGGGACGAGCACCAGACT
GATCTTCTCCTTGATGCCCTTCT
GCGAAGCCAGAGGAAACT
GACGAACGATTTGCACGTC
We found several putative regulatory elements,
including ABA response elements and DRE/CRTs, in
the upstream regions of the barley (Hordeum vulgare)
Dhn genes (Choi et al., 1999). The presence of these
regulatory elements is consistent with Dhn gene expression patterns under dehydration, low temperature, and ABA treatment. These observations are consistent with prior observations made using the
promoter region of a wheat (Triticum aestivum) Dhn
gene (wcs120, an ortholog of barley Dhn5) that led
others (Ouellet et al., 1998) to propose the existence
of highly conserved cold response mechanisms in the
tribe Triticeae and other plants. This hypothesis was
confirmed by the appearance of numerous CBF/
DREB1 cDNA sequences in public databases and recently reinforced by further cDNA characterization
in several plant species by Jaglo et al. (2001). Here,
we describe the methods that we employed to obtain
barley genes encoding proteins that are highly similar to the Arabidopsis CBF/DREB1 family, and the
sequence, expression characteristics, and genetic map
location of the barley gene HvCbf3. Our work began
with knowledge from publicly available rice (Oryza
sativa) genome sequence data that there is a CBF1
ortholog in rice.
encoding a 27.7-kD polypeptide consisting of 252
amino acids with most significant amino acid sequence similarity to the Arabidopsis CBF/DREB1
gene CBF1. To amplify this DNA fragment from rice
cv Somegawa genomic DNA, we designed oligonucleotides from the putative 5⬘- and 3⬘-untranslated
regions flanking the open reading frame that we
identified (Table I). The PCR product was purified
and the sequence determined (Fig. 1A; GenBank
accession no. AF243384). The deduced amino acid
sequence of the PCR product from rice cv Somegawa
was identical to that predicted from the rice cv Nipponbare sequence. We refer to this rice gene as
OsCbf1.
Isolation of Barley Cbf/DREB1 Gene
We produced cDNA libraries from drought- and
cold-stressed barley cv Morex seedlings and from
developing spikes of barley cv Morex. Using OsCbf1
as a probe of these libraries, seven positive clones
were identified. Sequence data revealed that one
clone (GenBank accession no. AF239616) among
these seven encodes a polypeptide that is quite similar to Arabidopsis CBF/DREB1 protein CBF3 (Fig.
RESULTS
Isolation of the Rice Ortholog of Arabidopsis
CBF/DREB1
Using a tblastn search of the National Center for
Biotechnology Information non-redundant database,
we found a rice cv Nipponbare sequence (accession
no. AB023482) that seemed to encode a polypeptide
having significant amino acid sequence homology to
Arabidopsis CBF/DREB1. From this sequence, Sasaki
et al. (1999) predicted a reading frame consisting of
four exons encoding a polypeptide of 423 amino
acids. We analyzed this same sequence using DNASIS programs (Hitachi Software Engineering Ltd.,
San Bruno, CA) and found an open reading frame
1782
Figure 1. Comparison of CBF amino acid sequences from Arabidopsis, rice, and barley. Amino acids are designated in single-letter code.
An asterisk indicates identical, a colon indicates closely related, and
a period indicates somewhat related amino acid. Dashes indicate
where a sequence has been expanded to optimize alignment. The
NLS is in boldface and the AP2-DNA binding domain is boxed.
Alignments were performed using Clustal W. A, Arabidopsis CBF1/
DREB1B and rice OsCBF1. B, Arabidopsis CBF3/DREB1A versus
barley HvCBF3. C, Restriction map of a fragment of bacterial artificial
chromosome (BAC) clone 790P15 carrying HvCbf3. The white box
indicates the location of the HvCbf3 gene. Restriction enzyme sites
are: B, BamHI; H, HindIII; S, SalI; and Sc, SacI.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 129, 2002
Barley Cbf3 Gene
1A). We refer to this clone and gene as HvCbf3. DNA
sequence analysis of this HvCbf3 cDNA suggested
that the 5⬘ end is truncated, but it clearly carries
sequences for the typical NLS, AP2-DNA-binding,
and acidic domains present in Arabidopsis CBF/
DREB1 proteins.
To identify additional barley HvCbf cDNAs, we
rescreened barley cDNA libraries using HvCbf3 as a
probe and searched public sequence databases.
Among the other positive clones that we found, one
(GenBank accession no. AF298230) seems to be an
ortholog of Arabidopsis CBF1/DREB1B. We also
found a previously sequenced barley expressed sequence tag (GenBank accession no. BF631103) that
has very high similarity to this clone. Although the
existence of a Cbf multigene family in barley is interesting, here we confine our further considerations
only to the HvCbf3 gene.
Isolation of the HvCbf3 Gene
Because the HvCBF3 cDNA sequence was less than
full length, we wished to examine the sequence of a
HvCbf3 genomic clone to gain a complete protein
coding sequence and to examine the sequence of the
5⬘-untranslated region and flanking region. To identify HvCbf3 genomic clones, we screened a barley cv
Morex BAC library (Yu et al., 2000). From screening
1.5-genome equivalents, we isolated six positive BAC
clones (424E16, 424C17, 572K24, 745C23, 790P15, and
804E19), among which three were confirmed to carry
the HvCbf3 gene by PCR using HvCbf3-specific oligonucleotides (Table I), and by blot hybridization of
DNA restriction fragments of BAC DNA using the
HvCbf3 cDNA as a probe at high stringency (data not
shown).
To further isolate the HvCbf3 gene, we chose BAC
clone 790P15 because it contained the smallest insert
DNA fragment (approximately 98 kb). From BAC
clone 790P15, we subcloned into pTZ18R a 7.5-kb
BamHI fragment carrying the HvCbf3 gene. Figure 1C
shows the restriction map of this fragment. SacI subfragments (1.2 and 4 kb) were then subcloned and
sequenced (GenBank accession no. AF298321). These
fragments encode a 31.0-kD polypeptide consisting
of 293 amino acids (pI 7.22). The HvCBF3 polypeptide contains a high percentage of Ala (13.6%) and
Ser (15.0%). The conserved NLS, AP2 DNA-binding
domain, and acidic region are present in the HvCbf3
gene (Fig. 1B). Two additional Ser tracts, one in the
N-terminal and one in the C-terminal acidic region,
also are present. We examined the DNA sequence to
about 500 bp upstream of the putative initiation
codon of HvCbf3, but no cis-acting element (box I–IV)
typical of the Arabidopsis DREB2 gene nor any DRE
element was apparent. This suggests that the HvCbf3
gene may not be subject to autoregulation.
Plant Physiol. Vol. 129, 2002
Expression of the HvCbf3 Gene
To quantitatively determine the expression pattern
of the HvCbf3 gene, we used real-time reverse transcription PCR. Total RNA was isolated from barley
seedling shoots sampled at different times throughout a chilling or ABA treatment. For comparison,
mRNAs from the same RNA samples were amplified
with primers specific for known chilling- and ABAinducible barley genes, Dhn8 and Dhn4, respectively
(Choi et al., 1999; Zhu et al., 2000). Dhn8 encodes a
chilling-inducible, acidic SK3 dehydrin and is the
ortholog of Arabidopsis COR47, which encodes an
acidic SK3 cold-induced dehydrin. The wheat orthologs of barley Dhn8 and Arabidopsis COR47 are
the WCOR410 genes (Danyluk et al., 1994), which
also encode acidic SK3 cold-induced proteins. Dhn4
encodes a YSK2 dehydrin that is ABA inducible,
prevalent during dehydration stress and embryo development, and is the ortholog of Arabidopsis
RAB18, which is also an ABA-induced, dehydrationinduced, and embryo YSK2 dehydrin (Close, 1997).
The quantity of 28S rRNA was measured as a normalization control.
The results show that the HvCbf3 gene is transiently up-regulated by chilling treatment (Fig. 2).
HvCbf3 transcripts began to rise after 15 min of cold
treatment and reached a maximum level at 2 h, when
the amount was at least 10 times the amount at 30
min. Later, HvCbf3 transcripts declined until they
were below detection after 24 h. There was also a
small, transient induction of HvCbf3 after ABA treatment (Fig. 2), but an effect of mechanical agitation
from simply spraying the plants with water (Gilmour
et al., 1998) was not ruled out as the cause of this
small induction. A dehydration treatment also induced a rapid and transient increase of HvCbf3 transcripts (data not shown), but we also cannot rule out
mechanical agitation as the cause of that effect. As
expected, the control gene Dhn8 was strongly induced during the chilling treatment, and the Dhn4
gene was strongly induced after ABA application.
Map Location of the HvCbf3 Gene
We designed HvCbf3 gene-specific primer sets from
the DNA sequences, and used these to determine the
chromosome location of HvCbf3 by PCR amplification. The PCR results using wheat-barley disomic
addition lines indicated that HvCbf3 is on chromosome 5H (Fig. 3A). Because we identified allelespecific polymorphisms for the HvCbf3 gene, it was
possible to determine the genetic map location of this
gene using the barley cv Dicktoo ⫻ barley cv Morex
doubled-haploid (DH) mapping population. Figure
3B shows the map location determined for the
HvCbf3 gene. The HvCbf3 gene is located on 5H between the markers WG364b and saflp58.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
1783
Choi et al.
Figure 2. Expression of HvCbf3 in barley seedlings. Plant materials were 6-d-old seedlings
growing with a 16-h photoperiod at 20°C or
2°C, and greenhouse-grown 6-d-old seedlings
sprayed with 100 ␮M ABA. Total RNA was used
for standard reverse transcription PCR (A, semiquantitative) and real-time reverse transcription
PCR (B, quantitative). Gene-specific primers for
HvCbf3, the cold-inducible gene Dhn8, the
dehydration- and ABA-inducible gene Dhn4,
and 28S rRNA were used (see “Materials and
Methods”). A, PCR products were electrophoresed in 1.8% (w/v) agarose gels. B, The RNA
amount is expressed relative to the highest value
found for each gene and the values are normalized against the expression values of 28S rRNA
used as an internal control (see “Materials and
Methods”). Insets show the expression data on a
logarithmic scale during the first 2 h. Bars are
the SD of the mean of four amplifications. F,
HvCbf3; f, Dhn8; 䡺, Dhn4.
DISCUSSION
The deduced amino acid sequence of the HvCBF3
protein has important similarities to the Arabidopsis
CBF/DREB1 proteins. The NLS and AP2-DNAbinding domains and the Ala-rich acidic C-terminal
region are present in all cases, and the “signature
sequences” PKK/RPAGRxKFxETRHP and DSAWR
(Jaglo et al., 2001) are present. There are also some
notable differences between the barley and Arabidopsis proteins. Amino acid sequence identities are
not extensive in the N- and C-terminal acidic regions,
and there are additional Ser tracts in N- and
C-terminal acidic regions of HvCBF3 relative to
Arabidopsis.
The early and transient expression of HvCbf3 at
chilling temperature is reminiscent of the expression
of Arabidopsis CBF/DREB1 genes, and is generally
consistent with the temporal induction of wheat and
rye (Secale cereale) CBF genes at low temperature
(Jaglo et al., 2001), with some caveats.
Chilling-induced barley HvCbf3 expression reached
a maximum at about 2 h (Fig. 2), then declined to
levels that were below detection by 24 h. In contrast,
expression of the rye and wheat CBF genes (see Fig.
2 in Jaglo et al., 2001) seems in total to be less temporally constrained; rye CBF genes were expressed
continuously from 30 min to 24 h, and wheat CBF
genes were expressed in apparent surges in the 15min to 24-h time frame. However, the northern-blot
method used by Jaglo et al. (2001), which used a
complete rye cDNA as a hybridization probe, seems
unlikely to distinguish between individual CBF
genes. In the highly inbred hexaploid wheat cv
Norstar, one would expect 18 unique CBF genes if
1784
there are six paralogs for each of the three A, B, and
D genome haplotypes. Similarly, because rye is an
outcrossing species and therefore carries extensive
heterozygosity, the diversity of CBF genes in the
diploid rye cv Puma could include two allelic forms
of each of six CBF paralogs for a total of as many as
12 distinct versions of CBF genes. Diversity in the
expression patterns of these presumed 18 wheat cv
Norstar or 12 rye cv Puma CBF genes would then be
obscured within the signal averaging that is accomplished by the northern-blot method. It has been
shown previously in Arabidopsis that different CBF
paralogs have quite distinct differences in their spatial and temporal expression patterns (Gilmour et al.,
1998; Sakuma et al., 2002). We note that Figure 2 of
Jaglo et al. (2001) shows wheat CBF transcripts that
appear to be of more than one size and that the
different sizes of transcripts appear at different times.
We interpret the results of Jaglo et al. (2001) to be
evidence that there are differences in the expression
patterns between CBF genes in Triticeae genomes.
Our approach with HvCBF3 narrowed the gene
expression analysis to one allele of a single CBF gene
because we used fully homozygous diploid material
(barley cv Morex) and gene-specific real-time reverse
transcriptase-PCR for quantitative measurement of
HvCBF3 transcripts. We can state with confidence
that the barley cv Morex barley HvCBF3 gene is
transiently cold induced, appearing only between the
15-min to 8-h time period during the treatment conditions that we employed. We suggest that it would
be interesting to examine variation in the expression
patterns of many more barley and other Triticeae
CBF genes using gene-specific methods and to con-
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 129, 2002
Barley Cbf3 Gene
Figure 3. Map location of the HvCbf3 gene. A, PCR reactions were
performed on genomic DNA from wheat cv Chinese Spring (CS),
barley cv Betzes (BB), and six wheat-barley disomic addition lines
(carrying 2H, 3H, 4H, 5H, 6H, or 7H) using HvCbf3 gene-specific
primers (see “Materials and Methods”). Amplified DNAs were electrophoresed in a 1.2% (w/v) agarose gel. B, The genotypes of each
HvCbf3 gene in the barley cv Dicktoo ⫻ barley cv Morex mapping
population were compared with mapping data (available at http://
wheat/pw.usda.gov/ggpages/DxM/dmsor.txt). The map location of
HvCbf3 genes is boxed. The dark bar on chromosome 5H indicates
a quantitative trait locus (QTL) for vernalization requirement and
freezing tolerance (Pan et al., 1994). The same region of wheat
chromosome 5A (Galiba et al., 1995; Vagujfalvi et al., 2000) is
compared with barley chromosome 5H. Units are in cM.
sider the consequences of allelic variation in regards
to potential relationships of CBF genes to plant
phenotypes.
The genetic picture so far, from cDNA sequencing
(described in “Results”) and BAC clone contig analyses (data not shown), suggests that there are additional Cbf genes tightly linked to HvCbf3 in barley.
We have shown in this work that the HvCbf3 locus
lies between markers WG364b and saflp58 on chromosome 5H (Fig. 3B). The Triticeae group 5 chromosome contains a major QTL for winter hardiness that
includes separate, but neighboring, loci for vernalization requirement (Vrn1 or Sh2) and freezing tolerance
(Fr1; Fig. 3B; Pan et al., 1994; Galiba et al., 1995;
Dubcovsky et al., 1998). However, this winter hardiness QTL is a considerable distance (approximately
40–50 cM) from the location of HvCbf3. This means
that HvCbf3 certainly is not a component of the major
winter hardiness QTL on barley chromosome 5H that
was identified by Pan et al. (1994). However, HvCbf3
Plant Physiol. Vol. 129, 2002
does map to an intriguing position. Vagujfalvi et al.
(2000) identified two loci that are involved in the
regulation of cor14b gene expression on wheat chromosome 5A, and it remains possible that one of these
loci is HvCbf3, as follows. The cor14 genes are cold
inducible and encode 14-kD polypeptides that are
imported into the chloroplast. One cor14b regulatory
locus (Rcg2) is located near markers psr2021 (also
known as ABA2 or Dhn1) and Fr1, and the other
(Rcg1) is tightly linked to psr911, which is 60 cM
proximal to Fr1. Our HvCbf3 mapping data place it in
the same general area as Rcg1, which leaves open the
possibility that HvCbf3 may be the same locus as
Rcg1. If that is the case, then it may eventually be
shown that this or another tightly linked barley Cbf
gene can, in certain genetic backgrounds, be a determinant of freezing tolerance. The Rcg1 locus has an
effect on the threshold temperature at which cor14b
and presumably other low-temperature-induced
genes are induced, and, therefore, the threshold temperature of Triticeae Cbf gene expression would seem
to be worthy of exploration. Careful analyses of
germplasm variation, and consideration of epistatic
and genotype x environment interactions, will help
clarify the potential role of Cbf genes in freezing
tolerance in barley and other Triticeae plants.
MATERIALS AND METHODS
Plant Material
Barley (Hordeum vulgare) cv Dicktoo (winter barley) and cv Morex (spring
barley), and 100 F1-derived DH progeny from a cross between these two
parents were obtained from Dr. Patrick Hayes (Oregon State University,
Corvallis) and propagated at the University of California (Riverside). Seeds
of wheat (Triticum aestivum) cv Chinese Spring, barley cv Betzes, and the six
wheat-barley addition lines from these two parents (Islam et al., 1981) were
provided by Dr. Adam Lukaszewski (University of California, Riverside).
Plants were grown in a greenhouse and leaf tissues were cut off, rapidly
frozen in liquid nitrogen, and stored at ⫺80°C until use.
cDNA and Genomic Libraries
RNA was extracted from drought- and cold-treated barley cv Morex
seedling shoots, and developing spikes at the white, green, and yellow
anther stage. Total RNA was prepared using a hot phenol procedure described by Verwoerd et al. (1989). Poly(A⫹) RNA was purified using
PolyATract mRNA Isolation System (Promega, Madison, WI). cDNAs with
EcoRI on the 5⬘ and XhoI on the 3⬘ end were synthesized using a ZAP-cDNA
synthesis kit (Stratagene, San Diego). cDNAs larger than 0.5 kb were selected by size fractionation via gel filtration and directionally cloned into the
Uni-ZAP XR vector, and in vivo packaged using GigaPack III Gold packaging extract (Stratagene). About 5 ⫻ 104 plaques per primary library were
lifted to nylon membrane and probed by standard methods (Sambrook et
al., 1989).
The barley cv Morex BAC library has been described previously (Yu et
al., 2000). Membranes spotted with BAC clones were obtained from Andris
Kleinhofs (Washington State University, Pullman).
Sequence Analysis
DNA fragments were sequenced on both strands using the dideoxy chain
termination method at Davis Sequencing, LLC (Davis, CA). The nucleotide
and deduced amino acid sequences were analyzed with the DNASIS programs and compared with sequences in databases using BLAST. Amino acid
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
1785
Choi et al.
sequence alignments were performed using Clustal W. From the barley Cbf
gene sequences, we designed gene-specific oligonucleotides (Table I). Oligonucleotides were synthesized at Sigma-Genosys (The Woodlands, Texas).
Expression Analysis by Real-Time Reverse
Transcription PCR
Barley seedlings were treated essentially as described previously (Choi et
al., 1999; Choi and Close, 2000). For the cold treatment, 6-d-old seedlings
growing in pots with soil in an illuminated growth chamber were used. The
seedlings were first grown at 20°C, 70% relative humidity, and 16-h photoperiod, the cold treatment was initiated by changing the chamber temperature to 2°C, and green tissue from 20 seedlings was harvested at each
sampling time. Seedlings were also grown in pots with soil in a greenhouse,
sprayed 6 d after sowing with a solution of 100 ␮m ABA and 0.05% (v/v)
Tween 20, then 20 or more seedling shoots were harvested at each sampling
time for RNA extraction. In all cases leaf tissues were cut off, snap frozen in
liquid nitrogen, and stored at ⫺80°C until RNA extraction.
Total RNA was extracted from green tissue using the hot-phenol method
(Verwoerd et al., 1989) and treated with RNAse-free DNase (Life Technologies, Gaithersburg, MD) at room temperature for 15 min in reaction buffer
containing 20 mm Tris-HCl (pH 8.4), 2 mm MgCl2, and 50 mm KCl. DNaseI
was inactivated by adding EDTA (2.5 mm final concentration) and heating
to 65°C for 10 min.
A cDNA first strand was synthesized using Taq-Man Reverse Transcription Reagents (Applied Biosystems, Foster City, CA) following the manufacturer’s directions. The reaction mixture contained: 20 ng ␮L⫺1 total RNA
(DNase treated), 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 5.5 mm MgCl2, 0.5
mm each dNTP, 2.5 ␮m random hexamers, 0.4 units ␮L⫺1 RNase inhibitor,
and 1.25 units ␮L⫺1 MultiScribe Reverse Transcriptase. The mixture was
pre-incubated at 25°C for 10 min and the reaction was completed at 48°C for
30 min. The enzyme was inactivated by incubation at 95°C for 5 min. The
cDNA samples were stored at ⫺20°C. Quantitative PCR was performed in
an ABI Prism 7700 Sequence Detection System (Applied Biosystems) using
the SYBR green I master mix (Applied Biosystems) containing optimized
buffer, dATP, dGTP, dCTP, dUTP, and Amplitaq Gold DNA Polymerase.
Each 25-␮L reaction contained 2⫻ SYBR green master mix, 50 ng of cDNA,
and 100 nm forward and reverse primers (300 nm each primer for 28S rRNA
amplifications).
The primers used for quantitative PCR were designed using Primers
Design software (Applied Biosystems). Target sequences were barley cv
Morex HvCbf3 (AF239616), Dhn8 (AF181458), Dhn4 (AF181454), and 28S
rRNA. For 28S rRNA, the primers carried the same sequences used for a
study of chicken Gallus gallus bursal disease virus (Moody et al., 2000) to
measure chicken rRNA quantity; these primers can also prime the amplification of a fragment of a barley 28S rRNA sequence (BF616316), which is
highly similar to chicken rRNA. The gene-specific oligonucleotides are
shown in Table I.
Reaction conditions for thermal cycling were: 95°C for 10 min, 40 cycles
of 95°C for 15 s, 60°C for 1 min, and 73°C for 15 s. Fluorescence data
collection was done during the 73°C cycle step. Using this methodology,
detection of PCR product is monitored by measuring the increase in fluorescence caused by the binding of SYBR green dye to dsDNA (Yin et al.,
2001). For each gene, a standard curve was prepared using a serial dilution
of an experimental cDNA sample. These samples were chosen upon the
basis of having the largest amount of target cDNA according to gel electrophoresis analysis of nonquantitative PCR reactions. Data were analyzed
with the Sequence Detector version 1.7 software (Applied Biosystems). The
software calculated the threshold cycle from the plot of the increase in
intensity of fluorescence of the reporter dye versus the cycle number. The
quantity of cDNA was calculated from threshold cycle by interpolation from
the standard curve. To account for differences in total RNA present in each
sample, the cDNA amount calculated was normalized using the amount of
28S rRNA detected in the same sample.
Chromosome Assignment
Genomic DNA from wheat cv Chinese Spring, barley cv Betzes, and the
six wheat-barley addition lines derived from these two parents was purified
using DNAzol according to instructions provided by the manufacturer (Life
Technologies). Genomic DNA amplifications were performed as described
1786
previously (Choi et al., 2000). In brief, PCR reactions were performed in a
50-␮L volume containing 1.25 units of Taq DNA polymerase (Qiagen,
Hilden, Germany), 1⫻ PCR buffer (10 mm Tris-HCl, pH 8.3; 50 mm KCl2;
and 1.5 mm MgCl2), 1⫻ Q-solution, 200 ␮m of each dNTP, 0.3 ␮M of each
oligonucleotide, and 100 ng of genomic DNA. PCR reactions were initiated
at 95°C for 5 min, followed by 40 cycles at 95°C for 30 s, 61°C for 1 min, 72°C
for 30 s, and terminated at 72°C for 10 min. Amplified DNAs were electrophoresed in a 1.2% (w/v) agarose gel.
Mapping of the HvCbf3 Gene
To develop PCR product polymorphisms for the barley HvCbf3 gene, two
forward and reverse primers were designed from the barley cv Morex
HvCbf3 gene sequence using the program PRIMER-MASTER (Table I). All
four possible combinations of PCR reactions were performed using genomic
DNA from barley cv Dicktoo, cv Morex, and other parents of various barley
DH mapping populations. A presence versus absence polymorphism between barley cv Dicktoo and cv Morex was observed for one of the four
primer combinations. Using this presence versus absence polymorphism,
the genotype of each DH line in the barley cv Dicktoo ⫻ barley cv Morex
mapping population was determined, as described previously (Choi et al.,
2000). The map location of the barley HvCbf3 gene was then determined by
aligning our data with existing mapping data for the barley cv Dicktoo ⫻
barley cv Morex DH mapping population (available at http://wheat.pw.
usda.gov/ggpages/DxM/dmsor.txt). The number of recombinants between
the HvCbf3 locus and the nearest locus was divided by the number of
individuals for which genotype data was available for both markers to give
a percent recombination value.
ACKNOWLEDGMENTS
The authors thank Jorge Dubcovsky (University of California, Davis) for
comments on genetic markers near the Rcg and Vrn1/Sh2 loci, and for first
drawing our attention in March of 2000 to the similarity of the location of
HvCbf3 and the Rcg1 locus. The authors also thank Raymond Fenton, Elena
Turco, Saule Abugalieva, and Matthew Moscou (University of California,
Riverside) for assistance with the barley seedling experiments.
Received January 25, 2002; returned for revision February 14, 2002; accepted
April 19, 2002.
LITERATURE CITED
Baker SS, Wilhelm KS, Thomashow MF (1994) The 5⬘-region of Arabidopsis
thaliana cor15a has cis-acting elements that confer cold-, drought- and
ABA-regulated gene expression. Plant Mol Biol 24: 701–713
Bray EA (1993) Molecular responses to water deficit. Plant Physiol 103:
1035–1040
Choi D-W, Close TJ (2000) A newly identified barley gene, Dhn12, encodes
a YSK2 DHN, is located on chromosome 6H and has embryo-specific
expression. Theor Appl Genet 100: 1274–1278
Choi D-W, Koag MC, Close TJ (2000) Map locations of barley Dhn genes
determined by gene-specific PCR. Theor Appl Genet 101: 350–354
Choi D-W, Zhu B, Close TJ (1999) The barley (Hordeum vulgare L.) dehydrin
multigene family: sequences, allele types, chromosome assignments, and
expression characteristics of 11 Dhn genes of cv. Dicktoo. Theor Appl
Genet 98: 1234–1247
Close TJ (1997). Dehydrins: a commonality in the response of plants to
dehydration and low temperature. Physiol Plant 100: 291–296
Danyluk J, Houde M, Rassart E, Sarhan F (1994) Differential expression of
a gene encoding an acidic DHN in chilling sensitive and freezing tolerant
Gramineae species. FEBS Lett 244: 20–24
Dubcovsky J, Lijavetzky D, Appendino L, Tranquilli G (1998) Comparative RFLP mapping of Triticum monococcum genes controlling vernalization requirement. Theor Appl Genet 97: 968–975
Dunn MA, White AJ, Vural S, Hughes MA (1998) Identification of promoter element in a low-temperature-responsive gene (blt4.9) from barley
(Hordeum vulgare L.). Plant Mol Biol 38: 551–564
Galiba G, Quarrie SA, Sutka J, Morgounov A, Snape JW (1995) RFLP
mapping of the vernalization (Vrn1) and frost resistance (Fr1) genes in
chromosome 5A of wheat. Theor Appl Genet 90: 1174–1179
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 129, 2002
Barley Cbf3 Gene
Gilmour SJ, Zarke DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) Low temperature regulation of the Arabidopsis CBF
family of AP2 transcriptional activators as an early step in cold-induced
COR gene expression. Plant J 16: 433–442
Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in
plants. Annu Rev Plant Physiol Plant Mol Biol 47: 377–403
Islam AKMR, Shepherd KW, Sparrow DHB (1981) Isolation and characterization of euplasmic wheat-barely chromosome addition lines. Heredity 46: 161–174
Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T,
Thomashow MF (2001) Components of the Arabidopsis C-repeat/
dehydration-responsive element binding factor cold-responsive pathway
are conserved in Brassica napus and other plant species. Plant Physiol 127:
910–917
Jaglo-Ottosen KR, Gilmour SJ, Zark DG, Schabenberger O, Thomashow
MF (1998) Arabidopsis CBF-1 overexpression induces Cor genes and enhances freezing tolerance. Science 280: 104–106
Jiang C, Iu B, Singh J (1996) Requirement of a CCGAC cis-acting element
for cold induction of the BN115 gene from winter Brassica napus. Plant
Mol Biol 30: 679–684
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999)
Improving plant drought, salt, and freezing tolerance by gene transfer of
a single stress-inducible transcription factor. Nature Biotechnol 17:
287–291
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K,
Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with
an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low temperature-responsive gene
expression, respectively, in Arabidopsis. Plant Cell 10: 1391–1406
Moody A, Sellers S, Bumstead N (2000) Measuring infectious bursal disease
virus RNA in blood by multiplex real-time quantitative RT-PCR. J Virol
Methods 85: 55–64
Nakamura Y, Sato S, Asamizu E, Kaneko T, Kotani H, Miyajima N, Tabata
S (1998) Structural analysis of Arabidopsis thaliana chromosome 5: VII.
Sequence features of the regions of 1,013,767 bp covered by sixteen
physically assigned P1 and TAC clones. DNA Res 5: 297–308
Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K,
Yamaguchi-Shinozaki K (2000) Organization and expression of two
Arabidopsis DREB2 genes encoding DRE-binding proteins involved in
dehydration- and high-salinity-responsive gene expression. Plant Mol
Biol 42: 657–665
Ouellet F, Vazquez-Tello A, Sarhan F (1998) The wheat wcs120 promoter is
cold-inducible in both monocotyledonous and dicotyledonous species.
FEBS Lett 423: 324–328
Pan A, Hayes PM, Chen F, Chen THH, Blake T, Wright S, Karsai I, Bedo
Z (1994) Genetic analysis of the components of winter hardiness in barley
(Hordeum vulgare L.) Theor Appl Genet 89: 900–910
Plant Physiol. Vol. 129, 2002
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, YamaguchiShinozaki K (2002) DNA-binding specificity of the ERF/AP2 domain of
Arabidopsis DREBs, transcription factors involved in dehydration- and
cold-inducible gene expression. Biochem Biophys Res Commun 290:
998–1009
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY
Sasaki T, Nagamura Y, Yamamoto K (1999) Oryza sativa genomic DNA,
chromosome 6, clone P0680A03, complete sequence. GenBank accession
no. AB023482
Shinozaki K, Yamaguchi-Shinozaki K (1997) Gene expression and signal
transduction in water-stress response. Plant Physiol 115: 327–334
Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana
CBF1 encodes an AP2 domain-containing transcriptional activator that
binding to the C-repeat/DRE, a cis-acting DNA regulatory element that
stimulates transcription in response to low temperature and water deficit.
Proc Natl Acad Sci USA 94: 1035–1040
Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and
regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50:
571–599
Thomashow MF, Gilmour SJ, Stockinger EJ, Jaglo-Ottosen KR, Zarka DG
(2001) Role of Arabidopsis CBF transcriptional activators in cold acclimation. Physiol Plant 112: 171–175
Vagujfalvi A, Crosatti C, Galiba G, Dubcovsky J, Cattivelli L (2000) Two
loci on wheat chromosome 5A regulate the differential cold-dependent
expression of the cor14b gene in frost tolerant and sensitive genotypes.
Mol Gen Genet 263: 194–200
Verwoerd TC, Dekker BM, Hoekema A (1989) A small-scale procedure for
the rapid isolation of plant RNAs. Nucleic Acids Res 17: 2362
Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in
an Arabidopsis gene is involved in responsiveness to drought, lowtemperature, or high-salt stress. Plant Cell 6: 251–264
Yin JL, Shackel NA, Zekry A, McGuiness PH, Richards C, Van der Putten
K, McCaughan GW, Eris JM, Biship GA (2001) Real-time reverse
transcriptase-polymerase chain reaction (RT-PCR) for measurement of
cytokine and growth factor mRNA expression with fluorogenic probes or
SYBR Green I. Immunol Cell Biol 79: 213–221
Yu Y, Tomkins JP, Waugh R, Frisch DA, Kudrna D, Kleinhofs A, Brueggeman RS, Muehlbauer GJ, Wise RP, Wing RA (2000) A bacterial artificial
chromosome library for barley (Hordeum vulgare L.) and the identification
of clones containing putative resistance genes. Theor Appl Genet 101:
1093–1099
Zhu B, Choi DW, Fenton RD, Close TJ (2000) Expression of the barley
dehydrin multigene family and the development of freezing tolerance.
Mol Gen Genet 264: 145–153
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
1787