Download Molecular evidence for the existence of additional members of the

Microbiology (1999), 145, 41 1-417
Printed in Great Britain
Molecular evidence for the existence of
additional members of the order Chlamydiales
Jacobus M. Ossewaarde and Adam Meijer
Author for correspondence: Jacobus M. Ossewaarde. Tel: +31 30 274 3942. Fax: +31 30 274 4449.
e-mail : [email protected]
Research Laboratory for
Infectious Diseases,
National Institute of Public
Health and the
Environment, PO Box 1,
3720 BA Bilthoven,
The Netherlands
Respiratory tract infections in man may be caused by several members of the
genus Chlamydia and also b y two Chlamydia-like strains, 'Simkania
negewensis' (2-agent) and 'Parachlamydia acanthamoebae ' (Bn,). T o facilitate
diagnostic procedures a PCR assay able to detect all known Chlamydiaceae
sequences in one reaction was developed. For this purpose, primers were
selected to amplify a fragment of the 165 rRNA gene. Characterization of the
amplified fragments was done by hybridization with specific probes and by
sequencing. PCR assays were carried out using DNA isolated from nosekhroat
specimens or from peripheral blood mononuclear cells of patients with
respiratory tract infections, and from vessel wall specimens of abdominal
aneurysms. Six of the 42 nosekhroat swab specimens analysed yielded strong
bands and one yielded a faint band. Three of these bands were identified as
Chlamydia pneumoniae and one as Chlamydia trachomatis b y sequencing.
Analysis of the three other bands yielded two different new sequences. DNA
isolated from peripheral blood mononuclear cells of one patient yielded a
third new sequence. DNA isolated from peripheral blood mononuclear cells of
four healthy controls was negative. One of the abdominal aneurysm specimens
also yielded a strong band. Sequencing revealed a fourth new sequence. All
negative controls included during specimen processing and PCR analysis
remained negative. The typical secondary structure of microbial 165 genes was
present in all four new sequences indicating the validity of the sequence data.
All four new sequences were distinct from other bacteria and clustered
together with known Chlamydiaceae sequences. Phylogenetic analysis
suggested a new lineage, separating the four new sequences, '5. negewensis'
and 'P. acanthamoebae ' from the genus Chlamydia with the four known
chlamydia1 species. In conclusion, this study provides evidence for the
existence of several new members of the order Chlamydiales. Since the source
of the Chlamydia-like strains has not been identified and serological and/or
molecular cross-reactivities may be expected, results of identification of
infecting recognized organisms should be interpreted cautiously.
Keywords : Chlamydia, Parachlamydia, 16s rDNA, phylogeny
INTRODUCTION
Currently, four species are recognized within the genus
Chlamydia in the family Chlamydiaceae in the order
Chlamydiales. T w o of these four species, Chlamydia
....,.......,....,......,..........,...,.......,..............,..........,,......................................................................
Abbreviation: i.f.u., inclusion-forming units.
The GenBank accession numbers for the Chlamydia-like strains are
AF097184 (Chlamydia Research Group 1; CRGl), AF097185 (CRGZ),
AF097186 (CRG3) and AF097187 (CRG4).
0002-2861 0 1999 SGM
trachomatis and Chlamydia pneumoniae, naturally
infect humans. C . trachomatis is the leading cause of
preventable blindness in developing countries (Schachter
& Dawson, 1990),a major cause of sexually transmitted
diseases throughout the world (Centers for Disease
Control and Prevention, 1993 ; Taylor-Robinson, 1993;
World Health Organization Working Group, 1989) and
a cause of respiratory tract infections in infants. C .
pneumoniae is a major cause of upper and lower
respiratory tract infections and has been associated with
cardiovascular diseases (Danesh et al., 1997; Gupta &
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
41 1
J . M. O S S E W A A R D E a n d A. M E I J E R
Camm, 1997; Kuo et al., 1995; Saikku, 1997).
Chlamydia psittaci mainly infects animals, including
birds, and is a cause of zoonotic respiratory tract
infections. Chlamydia pecorum is not known to infect
humans. Recently, two Chlamydia-like strains,
‘Simkania negevensis ’, or Z-agent (Kahane et al., 1993),
and ‘ Parachlamydia acanthamoebae ’, or Bn, (Amann et
al., 1997), have been described. Nucleic acid sequence
analysis indicates that they probably belong to the
family Chlamydiaceae, but not within one of the four
currently recognized species. Both strains seem to be
able to infect humans, causing respiratory tract infections (Birtles et al., 1997; Lieberman et al., 1997).
Thus, many different Chlamydia species may cause
respiratory tract infections in humans. Since isolation in
cell culture of the Chlamydia-like strains is probably
difficult, we decided to use amplification techniques to
study the epidemiology of human chlamydia1 respiratory
tract infections. The use of broad range bacterial primers
and nucleotide sequencing for identification is only
useful when one species is expected (Goldenberger et al.,
1997; Greisen et al., 1994). The presence of more than
one species would necessitate lengthy cloning and
sequencing procedures. Therefore, this approach cannot
be applied to detect bacteria in swabs from mucosal
sites. Application of specific probes might identify
specific pathogens (Monstein et al., 1996), but interference of other bacteria is likely to result in a low
sensitivity for detection of some pathogens. Therefore,
we developed a Chlamydiaceae-specific PCR assay able
to detect all known Chlamydiaceae sequences in one
reaction, including those of the recently described
Chlamydia-like strains. Here we describe the design of
the primers and probes used in this PCR assay and
report on the analysis of the first results.
METHODS
Reference strains. C. pecorum strain E58 (ATCC, Manassas,
VA, USA), C. psittaci (avian type, isolated from a human lung
biopsy, typed by RFLP of the ompl gene) and C. trachomatis
serovar L2 strain 434-B were propagated in monolayers of
HeLa 229 (ATCC CCL2.1) cells. C. pneumoniae strain TW183
(Washington Research Foundation, Seattle, WA, USA) was
propagated in monolayers of HEp2 cells (ATCC CCL23).
Each monolayer was sonicated in 2 ml 0.4 M sucrose-phosphate buffer (4SP) and stored aliquoted at - 70 “C. Batches of
C. pneumoniae and C. trachomatis were titrated by inoculating a tenfold serial dilution series onto 1-d-old monolayers in 96-well microtitre plates. After 2 or 3 d incubation
the monolayers were fixed with methanol, stained with FITClabelled anti-LPS monoclonal antibodies, and the number of
inclusions was counted. Results were expressed as inclusionforming units (i.f.u.) m1-I.
Clinical specimens. Specimens were collected from a general
practitioner’s surveillance of respiratory tract infections : 42
nose/throat swabs were collected in transport medium (5ml)
during the first 3 weeks of January 1997. Aliquots (1ml) were
centrifuged in a microcentrifuge, and the pellet was lysed in a
buffer with proteinase K (Ossewaarde et al., 1992). After
heating for 10 min at 100 “C, the specimens were used directly
in the PCR assay. Peripheral blood mononuclear cells from
one patient with acute bronchitis (from the acute and the
41 2
convalescent phases) and from four healthy controls working
in the same workplace were collected. Mononuclear cells
purified from 2.5 ml blood using Histopaque (Sigma-Aldrich)
were centrifuged in a microcentrifuge and the pellet was
processed as described above. Vessel wall tissue was obtained
from six patients during surgical treatment of their abdominal
aneurysms. DNA was isolated from three specimens taken
from different locations of the aneurysm of each patient using
a PCR-inhibitor-free procedure as described previously
(Meijer et al., 1998).
Design of primers and probes. The 16s rRNA gene was
chosen as the target, since it was the only gene of which the
sequence was available for all known members of the
Chlamydiaceae. All sequences were downloaded from
GenBank and aligned. Possible primer and probe locations
compatible with all known Chlamydiaceae sequences were
selected by comparing this alignment with a quantitative map
of nucleotide substitution rates (Van de Peer et al., 1996).
Next, the 3’ ends of the primers were analysed for their
homology with human sequences using the K-tuple frequency
method included in the computer program PC-Rare (Griffais
et al., 1996). Thermodynamic properties of the primers and
probes were analysed by the computer program Oligo 4.1
(Rychlik & Rhoads, 1989). Finally, the primers and probes
were analysed for similarity with other DNA sequences using
the output of the BLAST server (Altschul et al., 1990). Out of
several sets, one set of primers and probes (Table 1) was
selected according to the following criteria : compatibility
with all known Chlamydiaceae sequences, lowest homology
with human DNA at the 3’ ends of the primers, thermodynamic suitability, and no significant similarity with other
DNA sequences. A general family-specific Chlamydiaceae
probe was designed using all known Chlamydiaceae sequences
and the sequences obtained in this study.
PCR reaction and hybridization. The PCR reaction mixture
was as described previously including the dUTP-uracil-Nglycosylase contamination prevention system and anti-Taq
antibodies (Meijer et al., 1998). The PCR assay was carried
out in separate rooms using dedicated equipment (Ossewaarde
et al., 1992).Negative controls were included after every three
to five specimens during specimen processing and PCR
analysis. The final volume was 25 p1 including 5 pl of the
specimen. Ten picomoles of each of the eight primers (two
forward and six reverse primers) was used. After amplification
using a ‘touch-down’ protocol, 10 pl reaction mixture was
electrophoresed in a 2 % agarose gel (Meijer et al., 1998). The
gels were transferred to nylon membranes by vacuum blotting.
The biotin-labelled probes were hybridized at 60 or 65 “C.
Binding of the probes was detected by chemiluminescence
using the ECL system (Amersham). Since this assay was
originally developed to detect known respiratory tract pathogens, only the probes for ‘S. negevensis’, C. pneumoniae and
C. psittaci were used for screening the clinical samples. In
addition, the probe for ‘ P . acanthamoebae’ and the general
Chlamydiaceae probe were used to characterize the new
sequences.
Sequence analysis. Strong bands in the agarose gels at or close
to the expected length were sequenced directly using either the
forward primer CHL16SFOR2 or the general sequencing
forward primer in the sequencing reaction with the Thermo
Sequenase Dye Terminator Cycle Sequencing Pre-Mix kit
(Amersham) or the Big Dye Terminator Cycle Sequencing
Ready Reaction kit (ABI) on an automated sequencer. Reverse
sequencing was carried out using either the resolved reverse
primer or the general sequencing reverse primer. Specimens
yielding faint bands were amplified from either the original
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
New members in the order Chlarnydiales
Table 1. Oligonucleotide sequences selected for primers and probes
...............................................................................................................................................................
..................................................................................................................................................
Positioning of the oligonucleotideswas based on the alignment of complete 16s rDNA gene sequences.
Name
Forward primers
CHL16SFOR1
Sequence (5’-+3’)
Specificity
GTGGATGAGGCATGCGAGTCGA
CGTGGATGAGGCATGCAAGTCGA
‘S . negevensis ’
All others
CTCTCAGCCCGCCTAGACGTCTTAG
CAATCTCTCAATCCGCCTAGACGTCTTAG
ATCTCTCAATCCGCCTAGACGTCAAAG
ATCTCTCAATCCGCCTAGACGTCAAAA
CAATCTCTCAATCCGCCTAGACGTCATAG
‘S. negevensis ’
CHL16SREV2
CHL16SREV3
CHL16SREV4
CHLlGSREVS
CHL16SREV6
CTCTCAATCCGCCTAGACGTCATCG
CHL16SFOR2
Reverse primers
CHL 16SREV 1
Probes
‘ P . acanthamoebae’
C. psittaci
C. psittaci
C. trachomatis
C. pecorum
C . pneumoniae
CHL16SPROBEOl
CHL16SPROBE02
CHL16SPROBE03
CHL16SPROBE07
General 1
BIO*AGCTGGGGTAGCCTGGTTTCTT
BI0”AAATGTGGTGGGGGTAATTAAATTTAC
BIO*CGAATGTGGTATGTTTAGGCATCTAAAAC
BIO*CCGAATGTAGTGTAATTAGGCATCTAATATATAT
‘S. negevensis ’
‘ P. acanthamoebae ’
BIO*TAGTGGCGGAAGGGTTAGTAATACAT
Chlamydiaceae
General sequencing primers
Forward
Reverse
GTGGATGAGGCATGC(G/A)AGTCGA
CTCTCAATCCGCCTAGACGTC
Chlamydiaceae
Chlamydiaceae
C. psittaci
C. pneumoniae
amount of DNA equivalent t o 0.1 i.f.u. always yielded a
clearly visible band of approximately 270 bp after
agarose gel electrophoresis, and DNA equivalent to
0.01 i.f.u. yielded a clearly visible band in some experiments. DNA isolated from C. psittaci and C. pecorum
reference strains equivalent to 0.1 i.f.u. also yielded a
clearly visible band. In each run during this study,
positive controls always confirmed this lower limit.
Further optimization of the PCR assay was not
attempted.
specimen or the band recovered from the gel. The obtained
sequences were compared with the sequences available in
GenBank using the BLAST server (Altschul et al., 1990). The
‘Suggest Tree’ option of the Ribosomal Database Project
(University of Illinois, Urbana-Champaign, USA) was used to
add the new sequences to the existing tree of the Ribosomal
Database Project. The ‘Check Chimera’ option was used to
check for possible chimeric sequences created during amplification. All sequences were aligned manually taking into
account the secondary structure obtained from the SSU
database available at the Antwerp Ribosomal RNA Database
(Universityof Antwerp, Antwerp, Belgium; Van de Peer et al.,
1998). Phylogenetic analysis was carried out using the
neighbour-joining method with a distance matrix calculated
by the method of Jukes & Cantor (1969) using TREECON for
Windows version 1.3b (Van de Peer & De Wachter, 1994).
The corresponding sequence of the related bacterium
Rickettsia prowazekii (GenBank M21789) was used to construct a root. The following sequences from GenBank were
included: M83313, C. trachomatis (hamster); D85718, C.
trachomatis (mouse); U73110, C. trachomatis (swine);
D85721, C. trachomatis (man); D85717, C. pecorum (koala);
D88317, C. pecorum (calf); D85708, C. psittaci (guinea pig) ;
D85713, C. psittaci (bird); D85703, C. psittaci (cat); U73784,
C. pneumoniae (horse); 249873, C. pneumoniae (man);
L27666, ‘S. negevensis ’ ; Y07556, ‘P. acanthamoebae ’ ;
AF097184, Chlamydia Research Group 1 (CRG1);AF097185,
CRG2; AF097186, CRG3; AF097187, CRG4.
Forty-two patients with upper respiratory tract infections were studied. Six nose/throat swab specimens
yielded a strong band in agarose electrophoresis after
amplification of the DNA. One specimen yielded a faint
band. The first series of hybridization experiments did
not result in definite identification of all positive
reactions. Using a hybridization temperature lower than
optimal (60 “C vs 65 “C), five bands reacted weakly with
the C. pneumoniae-specific probe, but none reacted with
the C. psittaci-specific probe or with the ‘ S. negevensis ’specific probe (data not shown). Therefore, all six strong
amplification products were sequenced directly. The
seventh specimen was re-amplified from the original
specimen and subsequently sequenced. T w o of these
specimens were identified as C. pneurnoniae and the
third specimen as C. trachomatis. The fourth specimen
yielded a mixture of sequences that could not be
resolved. After re-isolation of the DNA from the original
specimen and subsequent amplification in the PCR
assay, the sequence obtained was identified as that of C.
pneumoniae. T h e other three specimens yielded two
RESULTS
First, the lower limit of the PCR assay was determined
using a dilution series of DNA isolated from C.
pneumoniae and C. trachomatis reference strains. T h e
~
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
413
J. M. O S S E W A A R D E a n d A. M E I J E R
Tabre 2. Reactivity in hybridization of four biotin-labelled species-specific oligonucleotide probes and one biotinlabelled general Chlarnydiaceae oligonucleotide probe with eight amplification products
+,
Strong reaction, expected for the size of the band in the gel; f,weak reaction, less than expected for the size of the band in the
gel ; - , no reaction in the hybridization assay.
Probe specificity
Hybridization
temperature
(“C)
60
65
60
65
60
65
60
65
60
C . pneumoniae
C. psittaci
‘S.negevensts ’
‘P. acanthamoebae’
Chlarnydiaceae
<-
Reaction with amplified product of:
C. pneurnoniae
C. trachornatis
C . psittaci
C. pecorurn
CRGl
CRG2
CRG3
CRG4
+
+
+
-
-
-
-
-
*-
f
k
-
k
f
-
-
-
-
+
+
f
-
f
-
+
- - - - -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
k
+
+
-
- -
-
.....
..
...
.....
.....
.....
....
....
....
....
...
..
+
-1
C. t r a c h o m a t i s
ACGGAGCAATTGT----- TTCG-----ACGATTGTTTAGTGGC
C. pecorum
AT. ..G.C---------G.T A.........
C. p s i t t a c i
.....AT ...GAC--------- GTTG A.........
C. pneurnoniae
AT...GAC----- ....----- GTTG..A
‘S. n e g e v e n s i s ’
...A..T.G.AA------ C.T.------ TT.C.AC ........
‘P. acanthamoebae’ .A.A.GG--------- GCM--------- cc....... ...
AG.T.GCA.G-----GCAA----- CTTGC.AC........
CRGl
--------- GGA
ATCC--------CRG2
CATG.GA.TTGCT....GGTAG.TC..ATG........
CRG3
---------GG- ..C..
A-CC--------CRG4
.....
+
-
-
-
+
helix 6
+
-
.........
.........
....
[-
-_ ..,
_-..,
..,z
..,-
..,_
z
*
-
_..,
-
+
- -
-
+
helix 11 -
-
-
-
+
- -1
GAAGGGGATC--TTAG--GACCTTTC
. . . . . . . . .--. . .c.--........
. . . . . . . . .--. . .c.-- ........
. . . . . . . . .--. . .c.--........
.TT......TCTGC.AAGA.....G.
.TG.......--GC.A--.....CG.
.T........TCG..AGA.....CG.
.TG.......--G..A--.....CG.
.T........TAG.GATA......A.
.TG.......--G..A--.....CG.
Fig. 7. Alignment of helices 6 and 11 (numbers and location from Van de Peer eta/., 1996) of the four recognized species
of the family Chlamydiaceae, both Chlamydia-like strains and the four new sequences, taking into account the secondary
structure obtained from the SSU database available at the Antwerp Ribosomal RNA Database. Dots represent nucleotides
identical to the nucleotide in same position in the C. trachomatis sequence. Dashes represent gaps in the alignment.
different new sequences not present in GenBank that
clustered together with the Chlamydia-like strains.
These sequences were designated
CRG2 and CRG3.
The DNA isolated from the peripheral blood mononuclear cells from a patient with acute bronchitis yielded
a third new sequence not present in GenBank that
clustered together with the Chlamydia-like strains. This
sequence was designated CRG4. The convalescent
specimens were negative. Two of the four healthy
controls yielded a faint band slightly longer than the
specific chlamydial bands. After re-amplification one
contained a mixture of sequences and the other contained another bacterial sequence.
One abdominal aneurysm specimen of one patient
yielded a strong band, while four specimens of three
other patients yielded a faint band. The strong band
yielded a fourth new sequence not present in GenBank
that clustered together with the Chlamydia-like strains.
This sequence was designated CRG1. T w o of the faint
bands yielded human sequences; the other faint bands
could not be resolved. All faint bands differed in size
from the specific chlamydial bands.
Reference strains and positive specimens were freshly
amplified and at suboptimal and optimal hybridization
41 4
temperatures the reactivity of five different probes was
determined for the four recognized species and for all
four new sequences (Table 2). The probes derived from
the sequence of ‘S. negevensis’ - and of ‘ P . acanthamoebae’ did not react with any of the amplified
fragments. The C. psittaci-specific probe showed weak
cross-reactions with C. pneumoniae and C. pecorum. In
all hybridization experiments, strong reactions were
always reproducible, but weak reactions were not
always reproducible. When applied to blots of bands of
non-Chlamydiaceae sequences such as the human sequences described above, the Chlamydiaceae-specific
probe discriminated clearly between chlamydial sequences and sequences from other origins.
The validity of the sequence data was tested by
constructing the secondary structure typical of all 16s
molecules. This typical secondary structure could be
produced for all four new sequences. Substantial differences in length were observed in helices 6 and 11 (Fig.
1).Nucleotide substitutions were observed throughout
the sequence. The ‘Suggest Tree’ option of the Ribosomal Database Project suggested a phylogenetic tree in
which all new seauences were ioined in one branch
together with ‘S. negevensis’ and close to other
Chlamydia sequences, but distinct from other bacterial
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
I
New members in the order Chlamydiales
-
C. rruchomutis (hamster)
Distance 0.1
C. trachomais (swine)
C. truchomutis (man)
C.psittuci (guinea pig)
C.psiftuci (bird)
1Wh
C. psittuci (cat)
I
C. pneumoniae (horse)
C. pneumoniae (man)
98%
‘
I
?
ucunthmoebae’
CRG3
S. negevensis’
CRG I
I
R.prowazekii
Fig. 2. Phylogenetic analysis of the
amplified region (216-224 bp) of the four
recognized
species
of
the
family
Chlamydiaceae, both Chlamydia-like strains
and the four new sequences obtained in this
study. The sequence CRGl was obtained
from a vascular specimen; CRGZ and CRG3
from respiratory specimens; and CRG4 from
a peripheral blood mononuclear cell
specimen.
Percentages represent the
number of times the branch appeared in a
tree during 1000 bootstrap samples. The
genetic distance is represented as fixed
mutations per site.
Table 3. Percentage nucleotide similarity of the four new sequences, the two Chlamydia-like strains and example
sequences of the four recognized Chlamydia species
C. pecorttm
C. psrttacr
C. trachomatis
C. pneumoniae
‘ S . negevensrs ’
* P. acanthamoebae‘
CRG 1
CRGZ
CRG3
CRG4
C. pecorum
C. psittaci
C. trachomatis
C. pneumoniae
‘S. negeuenris’
‘D.acanthamoebae’
CRGl
CRGZ
CRG3
CRG4
100.0
93.5
1000
88%
865
100.0
89.0
93.5
8 41
100.0
71.0
70.6
71.0
7 1-4
1000
73.9
73.5
71.8
735
75.5
100.0
702
722
71.8
73.9
78.8
7.53
100.0
76.7
78.4
747
79.6
75.1
a37
75.5
1000
66.9
678
67.3
69.0
72.7
67.8
72.’’
70.6
1000
73.9
75.5
74.7
76.3
74.3
82.4
727
91.4
71.0
100.0
sequences. The ‘Check Chimera’ option did not show
evidence for chimeric sequences. All new sequences and
example sequences from the four recognized Chlamydia
species, ‘ S. negevensis ’ and ‘P. acanthamoebae ’ were
manually aligned taking into account the secondary
structure obtained from the SSU database available at
the Antwerp Ribosomal RNA Database. Fig. 2 shows
the phylogenetic analysis carried out using the
neighbour-joining method with a distance matrix calculated by the method of Jukes & Cantor (1969) using
TREECON for Windows. The percentage similarity between sequences of the order Chlamydiales ranged
between approximately 65 and 95 YO. Percentage similarities of type strains are listed in Table 3.
DISCUSSION
Using a new Chlamydiaceae-specific PCR we have
obtained molecular evidence for the existence of at least
four new strains. Sequence analysis showed that these
strains were distinct from all other known bacteria and
clustered together with ‘S. negevensis’ and ‘ P . acanthamoebae’ in a separate lineage in the order
Chlamydiales.
Currently, four species are recognized within a single
genus Chlamydia belonging to the only family,
Chlamydiaceae, within the order Chlamydiales : C .
pecorum, C . pneumoniae, C. psittaci and C. trachomatis. Molecular, microbiological and immunological
analyses have improved this classification by reclassifying several strains; for example, a horse strain and
a koala bear strain are now classified as C. pneumoniae
(Kaltenboeck et al., 1993; Storey et al., 1993). The
species C. psittaci is very heterogeneous. Microbiological studies have defined eight biotypes (Spears &
Storz, 1979) and serological studies have defined nine
immunotypes (Perez-Martinez & Storz, 1985). The type
strains of both C. pneumoniae and C. pecorum were
originally classified as C . psittaci. Detailed molecular
analysis of the nucleotide sequences of the 16s rRNA
gene and of the ribosomal intergenic spacer has now
revealed several sub-groups within C. psittaci and C.
trachomatis (Everett & Andersen, 1997; Pudjiatmoko et
al., 1997). Human C. trachornatis is subdivided into
three biovars: the mouse biovar with one serotype (the
mouse pneumonitis agent) ; the trachoma biovar consisting of the serovars A-K; and the lymphogranuloma
venereum biovar consisting of the serovars Ll-L3.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
41 5
J. M. O S S E W A A R D E a n d A. MEIJER
Currently, 19 different human serovars of C . trachomatis
are recognized (Grayston & Wang, 1975; Ossewaarde
et al., 1994; Wang & Grayston, 1991). Recent evidence
suggests that some strains isolated from swine and
hamsters may also be classified as C . trachomatis
(Everett & Andersen, 1997; Fox et al., 1993; Kaltenboeck & Storz, 1992; Pudjiatmoko et af., 1997). Two
recently identified Chlamydia-like strains, ‘S. negeuensis’ and ‘ P . acanthamoebae’, have not been definitely
classified yet. Using phylogenetic analysis they appear to
be in a sub-branch distinct from, but closely related to,
all other Chlamydia strains. Genetic analysis suggested
that ‘S. negevensis’ might belong to a new genus within
the family ChZamydiaceae (Kahane et af., 1995).
The new sequences cluster together with known
Chlamydia sequences apart from other bacteria using
data from large 16s sequence databases. The genetic
distances between all Chlamydia sequences suggest a
division in two lineages : the four recognized Chlamydia
species in one lineage and the Chlamydia-like strains in
a second lineage. The phylogenetic branch separating
these lineages was highly significant by bootstrap
analysis.
Although all our samples were from clinically ill
patients, it is still too early to draw any conclusions on
the pathogenicity of these new strains. One of the new
sequences was derived from mononuclear cells of a
patient with bronchitis. One and two weeks later
comparable specimens from the same person were
negative. In addition, four healthy controls, volunteers
from the same workplace, were negative. These data
suggest the involvement of this new Chlamydia strain in
respiratory tract infections, but pathogenicity of these
new strains has to be established in more extensive
studies. O n the other hand, both ‘S. negevensis’ and ‘ P .
acanthamoebae ’ could be considered environmental
contaminants : ‘S. negevensis ’ was originally found as a
cell culture contaminant and ‘ P . acanthamoebae’ as an
intracellular parasite of possibly free-living amoebae.
Therefore, we cannot exclude the possibility that these
new strains caused positive PCR assay results by
contamination somewhere in the diagnostic chain, either
in the patient or during specimen processing.
However, the existence of these new organisms might
have significant consequences for serological and molecular laboratory diagnosis of chlamydia1 respiratory
tract infections. So far, there are no data suggesting
antigenic cross-reactions between the new strains and
recognized species. If such cross-reactions exist, however, serological data should be more carefully interpreted. For example, serological cross-reactions between
C. pneumoniae and C . trachomatis are well-documented
(Kern et al., 1993; Moss et al., 1993). This study shows
the existence of three regions of highly conserved
sequences in the 16s rRNA gene within the family
Chlamydiaceae. The existence of more regions can be
expected in the remaining part of the 16s rRNA gene. If
primers and probes have been chosen from these
locations during the design of PCR assays, positive
reactions might be incorrectly interpreted as a positive
416
diagnosis of a C . pneumoniae infection. At least, the
possible existence of serological or molecular biological
cross-reactions should be taken into account when
interpreting already published data.
In conclusion, we have identified four new previously
unrecognized Chfamydiaceae sequences. Phylogenetic
analysis strongly suggests that they belong to a separate
lineage within the order Chfamydiales.
ACKNOWLEDGEMENTS
T h e authors thank J. de Jong and J. A . van der Vliet for
providing the patient specimens and T. M. Bestebroer for
assistance in DNA sequencing.
REFERENCES
Altschul, 5. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J.
(1990). Basic local alignment search tool. J Mol Biol215,403410.
Amann, R., Springer, N., Schanhuber, W., Ludwig, W., Schmid,
E. N., MUller, K. D. & Michel, R. (1997). Obligate intracellular
bacterial parasites of Acanthamoebae related to Chlamydia spp.
Appl Environ Microbiol63, 115-121.
Birtles, R. J., Rowbotham, T. J., Storey, C., Marrie, T. 1. & Raoult,
D. (1997). Chlamydia-like obligate parasite of free-living
amoebae. Lancet 349,925-926.
Centers for Disease Control and Prevention (1993). Recom-
mendations for the prevention and management of Chlamydia
trachomatis infections. Morb Mortal W k l y Rep 42, 1-9.
Danesh, J., Collins, R. & Peto, R. (1997). Chronic infections and
coronary heart disease: is there a link? Lancet 350, 430-436.
Everett, K. D. E. & Andersen, A. A. (1997). The ribosomal
intergenic spacer and domain I of the 23s rRNA gene are
phylogenetic markers for Chlamydia spp. lnt ] Syst Bacteriol47,
461473.
Fox, 1. G., Stills, H. F., Paster, B. 1.. Dewhirst, F. E., Yan, L., Palley,
L. & Prostak, K. (1993). Antigenic specificity and morphologic
characteristics of Chlamydia trachomatis, strain SFPD, isolated
from hamsters with proliferative ileitis. Lab Anim Sci 43,405-410.
Goldenberger, D., KUnzli, A., Vogt, P., Zbinden, R. &Altwegg, M.
(1997). Molecular diagnosis of bacterial endocarditis by broad-
range PCR amplification and direct sequencing. J Clin Microbiol
35,2733-2739.
Grayston, 1. T. & Wang, 5. P. (1975). New knowledge of
Chlamydiae and the diseases they cause. J lnfect Dis 132,87-105.
Greisen, K., Loeffelholz, M., Purohit, A. & Leong, D. (1994). PCR
primers and probes for the 16s rRNA gene of most species of
pathogenic bacteria, including bacteria found in cerebrospinal
fluid. ] Clin Microbiol 32, 335-351.
Griffais, R., AndrB, P. M. & Thibon, M. (1996). K-tuple frequency
in the human genome and polymerase chain reaction. Nucleic
Acids Res 19, 3887-3891.
Gupta, 5. & Camm, A. 1. (1997). Chlamydia pneumoniae and
coronary heart disease : coincidence, association, or causation ? BY
Med ] 314, 1778-1779.
Jukes, T. H. & Cantor, C. R. (1969). Evolution of protein molecules.
In Mammalian Protein Metabolism, pp. 21-132. Edited by H. H.
Munro. New York: Academic Press.
Kahane, S., Gonen, R., Sayada, C., Elion, J. & Friedman, M. G.
(1993). Description and partial characterization of a new
chlamydia-like microorganism. FEMS Microbiol Lett 109,
329-334.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
New members in the order Chlamydiales
Kahane, S., Metzer, E. & Friedman, M. G. (1995). Evidence that the
novel microorganism 'Z' may belong to a new genus in the family
Chlamydiaceae. FEMS Microbiol Lett 126, 203-208.
Perez-Martinez, 1. A. & Storz, J. (1985). Antigenic diversity of
Chlamydia psittaci of mammalian origin determined by microimmunofluorescence. Infect Immun 50, 905-910.
Kaltenboeck, B. & Storz, J. (1992). Biological properties and
genetic analysis of the o m p A locus in Chlamydiae isolated from
swine. Am J Vet Res 53, 1482-1487.
Pudjiatmoko, Fukushi, H., Ochiai, Y., Yamaguchi, T. & Hirai, K.
(1997). Phylogenetic analysis of the genus Chlamydia based on
Kaltenboeck, B., Kousoulas, K. G. & Storz, 1. (1993). Structures of
Rychlik, W. & Rhoads, R. E. (1989). A computer program for
and allelic diversity and relationships among the major outer
membrane protein (ompA)genes of the four chlamydial species.
J Bacteriol 175, 487-502.
Kern, D. G., Neill, M.A. & Schachter, 1. (1993). A seroepidemiologic study of Chlamydia pneumoniae in Rhode Island.
Chest 104, 208-2 13.
Kuo, C. C., Jackson, L. A., Campbell, L. A. & Grayston, 1. T. (1995).
Chlamydia pneumoniae (TWAR).Clin Microbiol Rev 8,451-461.
Lieberman, D., Kahane, S., Lieberman, D. & Friedman, M. G.
(1997). Pneumonia with serological evidence of acute infection
with the chlamydia-like microorganism " Z". Am J Respir Crit
Care Med 156,578-582.
Meijer, A,, Van der Vliet, 1. A., Schouls, L. M., De Vries, A., Roholl,
P. J. M. & Ossewaarde, 1. M. (1998). Detection of microorganisms
in vessel wall specimens of the abdominal aorta : development of
a PCR assay in the absence of a gold standard. Res Microbioll49,
577-583.
Monstein, H. J., Kihlstrom, E. & Tiveljung, A. (1996). Detection
and identification of bacteria using in-house broad range 16s
rDNA PCR amplification and genus-specific DNA hybridization
probes, located within variable regions of 16s rRNA genes.
APMIS 104,451458.
Moss, T. R., Darougar, S., Woodland, R. M., Nathan, M., Dines,
R. 1. & Cathrine, V. (1993). Antibodies to Chlamydia species in
patients attending a genitourinary clinic and the impact of
antibodies to C. pnetlmoniae and C . psittaci on the sensitivity and
the specificity of C . trachomatis serology tests. Sex Transm Dis
20, 61-65.
Ossewaarde, J. M., Rieffe, M., Rozenberg-Arska, M., Ossenkoppele, P. M., Nawrocki, R. P. & Van Loon, A. M. (1992).
Development and clinical evaluation of a polymerase chain
reaction test for detection of Chlamydia trachomatis. J Clin
Microbiol30, 2122-2128.
Ossewaarde, J. M., Rieffe, M., De Vries, A., Derksen-Nawrocki,
R. P., Hooft, H. J., Van Doornum, G. 1. J. &Van Loon, A. M. (1994).
Comparison of two panels of monoclonal antibodies for determination of Chlamydia trachomatis serovars. J Clin Microbiol
32,2968-2974.
16s rRNA gene sequences. lnt J Syst Bacteriol47, 425431.
choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids Res
17, 8543-8551.
Saikku, P. (1997). Chlamydia pneumoniae and atherosclerosis an update. Scand J Infect Dis 104 (Suppl.), 53-56.
Schachter, J. & Dawson, C. R. (1990). The epidemiology of
trachoma predicts more blindness in the future. Scand J Infect Dis
69 (Suppl.), 55-62.
Spears, P. & Storz, J. (1979). Biotyping of Chlamydia psittaci
based on inclusion morphology and response to diethylaminoethyl-dextran and cycloheximide. lnfect Immun 24,
224-23 2.
Storey, C., Lusher, M., Yates, P. & Richmond, 5. (1993). Evidence
for Chlamydia pneumoniae of non-human origin. J Gen
Microbiol 139, 2621-2626.
Taylor-Robinson, D. (1993). Chlamydia trachomatis and sexually
transmitted disease. What do we know and what shall we d o ? Br
Med J 308, 150-151.
Van de Peer, Y. & De Wachter, R. (1994). TREECON for Windows:
a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput
Appl Biosci 10, 569-570.
Van de Peer, Y., Chapelle, S. & De Wachter, R. (1996). A
quantitative map of nucleotide substitution rates in bacterial
rRNA. Nucleic Acids Res 24, 3381-3391.
Van de Peer, Y., Caers, A., De Rijk, P. & De Wachter, R. (1998).
Database on the structure of small ribosomal subunit RNA.
Nucleic Acids Res 26, 179-182.
Wang, 5. P. & Grayston, 1. T. (1991). Three new serovars of
Chlamydia trachomatis: Da, Ia, and L2a. J Infect Dis 163,
403-405.
World Health Organization Working Group (1989). Guidelines
for the prevention of genital chlamydial infections. WHO Report
EUR/ICP/CDS 199. Geneva : WHO.
Received 3 August 1998; revised 14 October 1998; accepted 22 October
1998.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 08:57:04
417