Download This is Option 1

W13 Biol 321
TAKE-HOME Quiz
25 pts total
This is Option 1
Answers are due to CT by 5 pm on Friday March 1
No late submissions will be accepted
☞
Please read carefully through this quiz. I will answer questions about it in
class on Mon 2/25 and Wed 2/27. I can’t take questions during office hours since I
want the entire class to have access to the same information (from me). You can
email me questions but I will only address them during class.
☞ Rules for working this quiz: This is an open-note, open-book, open-internet
quiz . You may discuss these questions with your fellow classmates BUT, you
MUST write up your answers independently. In other words, if any answers look
suspiciously similar I will divide the total possible points between the similar
answers. Also please do not consult other faculty members about the quiz.
☞ If I can’t easily read your answers, I will not grade them. Please word
process the text of your answers. Diagrams should be neatly laid out, clearly
labeled, and hand drawn.
Print out the page 2 and put your answer to 1a
directly on the quiz. Attach an extra sheet of
paper with your answers to 1b and 2.
1
Option 1 Question 1. (11 pts) Huntington disease (HD) is caused by a variable expressed but
fully penetrant autosomal dominant mutation that causes late onset (post-reproductive)
neurodegeneration. The mutations that cause HD involve an expansion of a triplet repeat located
in the coding region of the gene (HTT --see underlined sequence below). Normal alleles of this
gene have 27-35 CAG repeats. Alleles with >40 repeats confer a clear HD phenotype.
Interestingly, as the number of repeated triplets increases, the age of onset in the patient
decreases. Furthermore, because the unstable trinucleotide repeat can lengthen when passed from
parent to child, the age of onset can decrease from one generation to the next.
Homo sapiens huntingtin (HTT), mRNA (in cDNA language)
>gi|90903230|ref|NM_002111.6| Homo sapiens huntingtin (HTT), mRNA
GCTGCCGGGACGGGTCCAAGATGGACGGCCGCTCAGGTTCTGCTTTTACCTGCGGCCCAGAGCCCCATTC
ATTGCCCCGGTGCTGAGCGGCGCCGCGAGTCGGCCCGAGGCCTCCGGGGACTGCCGTGCCGGGCGGGAGA
CCGCCATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCG
CCGCCGCCGCCGCCTCCTCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCGCTGCTGCCTCAGCCGCAGC
CGCCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGTGGCTGAGGAGCCGCTGCACCGACCAAAGAA
AGAACTTTCAGCTACCAAGAAAGACCGTGTGAATCATTGTCTGACAATATGTGAAAACATAGTGGCACAG
TCTGTCAGAAATTCTCCAGAATTTCAGAAACTTCTGGGCATCGCTATGGAACTTTTTCTGCTGTGCAGTG
ATGACGCAGAGTCAGATGTCAGGATGGTGGCTGACGAATGCCTCAACAAAGTTATCAAAGCTTTGATGGA
a. The beginning of the huntintin mRNA is shown above. Circle the translation start codon.
Be sure to consult the 2/20/13 lecture notes and defend your choice here:
b. ATTACH a clearly labelled diagram to show how an increase of one CAG repeat unit can
occur as a spontaneous mistake during DNA replication:
•
Be sure to label the 5’ and 3’ ends of all DNA strands.
•
Be sure to label the parental and daughter DNA strands for every round of replication.
•
Start with the sequence shown below and but only track relevant parts of sequence
•
Hint: the initial mistake can occur during the replication of either parental strand so
follow the replication of just one of the parentals and be sure to end up with the extra repeat unit
in both strands
•
Indicate which strand would serve as template during the process of transcription
-------------- CTCAAGTCCTTCCAGCAGCAGCAG----------------------------GAGTTCAGGAAGGTCGTCGTCGTC--------------
2
Option 1 Question 2. (14 pts) Non-insulin-dependent diabetes mellitus (NIDDM) affects about
2% of the world’s population. Genetic factors are important in the etiology of this disease, and
specific genes that influence the development of NIDDM (such as the HNF-1 gene) have been
identified. Carefully examine the tables shown on the next page summarizing genetic variation
in the HNF-1 gene. The HNF-1 gene codes for a transcription factor which functions as a dimer.
Examine Table 1
a. At the DNA level, what term best describes the mutation in Family A? No explanation
needed.
b. At the protein level, what term best describes the mutation in Family A? No explanation
needed.
c. Review figure 8-15 on pg 298 of your textbook and then examine info on Family GK.
Explain how a base-pair change in an intron could affect protein function. Be very explicit and
use proper terminology. 2-3 sentences connecting the dots – starting with the mutation at the
DNA level. Don’t worry about the Designation jargon.
d. NIDDM is inherited as an autosomal dominant trait. Based on the info in Table 1, the authors
of the paper describing this work concluded that NIDDM is likely to result from loss of HNF-1
gene function. Read/review pages 212-214 of your textbook. Based on the types of mutations
seen in Table 1, it is not possible to determine which mechanism of dominance (as summarized
in Figure 6-2 of the text) is operating here.
Let’s say that after this study was completed, a normal (non-NIDDM) individual was
discovered who was heterozygous for a deletion of the HNF-1 gene that removed the entire
coding sequence. Based on this individual, which mechanism of dominance is operating in the
families listed in Table 1: haploinsufficieny or dominant negative? Defend your answer in 12 sentences.
Examine Table 2
a. Briefly explain why the changes listed in this table are called polymorphisms. One
sentence.
b. Refer to Table 2 codon 17: At the protein level, what term (from the mutation jargon)
best describes this polymorphism? No explanation necessary. More than one possibility here
– one correct answer is OK.
d. Briefly explain the importance/significance of the data in Table 2. Why was it included in
this study of mutations in the HNF-1 gene? Two sentences.
3
4