* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download biotechnology
DNA barcoding wikipedia , lookup
Epigenetics wikipedia , lookup
Genome evolution wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA sequencing wikipedia , lookup
Human genome wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Metagenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA polymerase wikipedia , lookup
Primary transcript wikipedia , lookup
Genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA profiling wikipedia , lookup
Cancer epigenetics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genomic library wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Designer baby wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genome editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Microevolution wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Molecular cloning wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Helitron (biology) wikipedia , lookup
Manipulation of organisms to make useful products Medical research (Cloning) Help people overcome genetic diseases (Gene therapy) Help convict criminals (Gel electrophoresis) Study a genome of an extinct organism such as the wooly mammoth (PCR and sequencing) Create bacteria more efficient at cleaning up oil spills and food that is larger/better/more nutritious/pest resistant (Genetic engineering) During an ordinary but particular cold day at THS, the fire alarm went off. The school was evacuated and the fire department came to check on the situation. Since it was so cold it seemed impossible that a student would pull the fire alarm… except a student in Ms. Tank’s class. She was giving an extremely hard test that day and it would seem reasonable that a student might think that she would postpone it after the fire alarm (however, they were wrong). There were 2 students out in the hall from her class during that time (there names were recorded on the sign out sheet). Furthermore, the person who pulled the alarm must have had a cut on their finger because a little speck of blood was left on the fire pull. Can you help solve the case? Student 1: Student 2: Collection of DNA (from the blood on the fire alarm and from the suspects) Extraction of DNA (Basically destroying the nuclear membrane so we can get at the DNA) DNA cut by restriction enzymes DNA fragments separated using a gel Analysis Cut DNA between specific bases Restriction enzyme Hae III 5’ …GGCC… 3’ 3’ …CCGG… 5’ Restriction enzyme Bam HI 5’ …GGATCC… 3’ 3’ …CCTAGG… 5’ Ex. The following DNA samples are from different people. How would the lengths of their DNA differ if they were cut with Restriction enzyme Hae III? 5’ …GGCC… 3’ 3’ …CCGG… 5’ Person 1 GGCCATTACATTACATTACATTACATTACATTACGGCC Person 2 GGCCATTACATTACGGCCATCGATCGGCCAGTCATCC *Notice the variable number of tandum repeats (VNTR) between these people. Load the DNA in the wells in the gel The negatively charged DNA moves toward the positive side of the current Larger DNA fragments cannot go as far as fast as the smaller DNA fragments. Read gel electrophoresis in lab notebook 4. The bands of DNA traveled to the bottom of the gel, is this side positive or negative on the electrode? Why? 5. What suspect(s) should be questioned further about the crime? Suspect 6 Suspect 5 Suspect 4 Suspect 3 Suspect 2 Suspect 1 3. Which band(s) traveled fastest? DNA found at crime scene 2. Which band(s) traveled slowest? DNA marker 1.What do the bands in the drawing of the agarose gel represent? What do the bands in the drawing of the agarose gel represent? Many DNA fragments which are the same size Which band(s) traveled slowest? The bands nearest the wells (containing the longest DNA fragments) traveled the slowest. Which band(s) traveled fastest? The bands farthest from the wells (containing the shortest DNA fragments) traveled the fastest. The bands of DNA traveled to the bottom of the gel, is this side positive or negative on the electrode? Why? The negative pole is located closest to the wells. The positive pole is located furtherst from the wells. DNA is negatively charged. What suspect should be questioned further about the crime? Suspect 2 and 4 We are researchers who want to study what makes hummingbirds able to metabolize so fast. We want to sequence (find out the specific base pairs, and therefore amino acids) of the DNA in the hemoglobin gene and compare it to hemoglobin genes of other less active species. First, we need to isolate the gene and get many copies of it Gene cloning PCR Why Bacteria? Quick to reproduce Plasmids – small circular DNA that can be taken up by bacteria and replicated Transformation is the uptake of the DNA by bacteris Easy to grow Gene Cloning Need Primers (specific to the gene you want) Nucleotides Polymerase Genomic DNA Like PCR, but with fluorescently labeled nucleotides When a labeled nucleotide is added, it stops further elongation Then run it through a mini-gel What if we wanted to look at how many hemoglobin and metabolism related genes get expressed in comparison to other organisms? Write on a sheet of paper 3 things you understand 2 things you need to understand better 1 thing you do not understand at all Now, you and your group need to pick one topic and use the book to help you better understand that topic We want to make insulin for people to use as medicine for diabetes. How do we make this? DNA cloning Expression in a cell downstream from an active promoter – most likely in a yeast cell because of post translational modification. Gene Therapy – inserting genes into an afflicted individual for therapeutic purposes Transgenic plants and animals – individuals that have introduced genes in their genome Video on transgenics 3. Which band(s) traveled fastest? 4. The bands of DNA traveled to the bottom of the gel, is this side positive or negative on the electrode? Why? 5. What suspect should be questioned further about the crime? Suspect 6 Suspect 5 Suspect 4 Suspect 3 Suspect 2 Suspect 1 DNA found at crime scene 2. Which band(s) traveled slowest? DNA marker 1.What do the bands in the drawing of the agarose gel represent? What do the bands in the drawing of the agarose gel represent? Many DNA fragments which are the same size Which band(s) traveled slowest? The bands nearest the wells (containing the longest DNA fragments) traveled the slowest. Which band(s) traveled fastest? The bands farthest from the wells (containing the shortest DNA fragments) traveled the fastest. The bands of DNA traveled to the bottom of the gel, is this side positive or negative on the electrode? Why? The negative pole is located closest to the wells. The positive pole is located furtherst from the wells. DNA is negatively charged. What suspect should be questioned further about the crime? Suspect 2 and 4 Have one student from your group grab one strip of paper from the front (under the document camera) and decide what biotechnological techniques you will use to answer the given question. BE SPECIFIC! *Note: on the next slide I will list some of the techniques you might want to use. Cloning using Expression vector- bacteria Cloning using PCR Nucleic acid hybridization Gel electrophoresis DNA sequencing Create a genomic library RFLP analysis RNA extraction Reverse transcriptase using bacteria to express a gene Restriction enzymes to chop up DNA at specific points Microarrays In vitro mutagenesis – mutated forms of a gene are reinserted into the original species to look for malfunctions in gene expression Began in 1990, originally thought it would take 15 years, but only took 13 – Ended in 2003 Main goals of the HGP Identify ~20,000-25,000 genes Determine sequence of all (haploid) 3 billion base pairs (*we have 6 billion if you take into account that we are diploid) Bioinformatics (Store large amounts of DNA information) Address ethical issues