Download biotechnology

Manipulation of organisms to make useful products
 Medical research (Cloning)
 Help people overcome genetic diseases (Gene therapy)
 Help convict criminals (Gel electrophoresis)
 Study a genome of an extinct organism such as the
wooly mammoth (PCR and sequencing)
 Create bacteria more efficient at cleaning up oil spills
and food that is larger/better/more nutritious/pest
resistant (Genetic engineering)
During an ordinary but particular cold day at THS, the fire
alarm went off. The school was evacuated and the fire
department came to check on the situation. Since it was so
cold it seemed impossible that a student would pull the fire
alarm… except a student in Ms. Tank’s class. She was giving
an extremely hard test that day and it would seem
reasonable that a student might think that she would
postpone it after the fire alarm (however, they were
wrong). There were 2 students out in the hall from her
class during that time (there names were recorded on the
sign out sheet). Furthermore, the person who pulled the
alarm must have had a cut on their finger because a little
speck of blood was left on the fire pull. Can you help solve
the case?
Student 1:
Student 2:
 Collection of DNA (from the blood on the fire alarm




and from the suspects)
Extraction of DNA (Basically destroying the nuclear
membrane so we can get at the DNA)
DNA cut by restriction enzymes
DNA fragments separated using a gel
Analysis
 Cut DNA between specific bases
 Restriction enzyme Hae III
5’ …GGCC… 3’
3’ …CCGG… 5’
 Restriction enzyme Bam HI
5’ …GGATCC… 3’
3’ …CCTAGG… 5’
 Ex. The following DNA samples are from different
people. How would the lengths of their DNA differ if
they were cut with Restriction enzyme Hae III?
5’ …GGCC… 3’
3’ …CCGG… 5’
 Person 1
 GGCCATTACATTACATTACATTACATTACATTACGGCC
 Person 2
 GGCCATTACATTACGGCCATCGATCGGCCAGTCATCC
*Notice the variable number of tandum repeats (VNTR)
between these people.
 Load the DNA in the wells in the gel
 The negatively charged DNA moves toward the positive
side of the current
 Larger DNA fragments cannot go as far as fast as the
smaller DNA fragments.
 Read gel electrophoresis in lab notebook
4. The bands of DNA traveled to the
bottom of the gel, is this side
positive or negative on the
electrode? Why?
5. What suspect(s) should be
questioned further about the crime?
Suspect 6
Suspect 5
Suspect 4
Suspect 3
Suspect 2
Suspect 1
3. Which band(s) traveled fastest?
DNA found at
crime scene
2. Which band(s) traveled slowest?
DNA
marker
1.What do the bands in the drawing of
the agarose gel represent?
 What do the bands in the drawing of the agarose gel represent?




Many DNA fragments which are the same size
Which band(s) traveled slowest?
The bands nearest the wells (containing the longest DNA
fragments) traveled the slowest.
Which band(s) traveled fastest?
The bands farthest from the wells (containing the shortest DNA
fragments) traveled the fastest.
The bands of DNA traveled to the bottom of the gel, is this side positive
or negative on the electrode? Why?
The negative pole is located closest to the wells. The positive pole
is located furtherst from the wells. DNA is negatively charged.
What suspect should be questioned further about the crime?
Suspect 2 and 4
 We are researchers who want to study what makes
hummingbirds able to metabolize so fast. We want to
sequence (find out the specific base pairs, and
therefore amino acids) of the DNA in the hemoglobin
gene and compare it to hemoglobin genes of other less
active species.
 First, we need to isolate the gene and get many copies
of it
 Gene cloning
 PCR
 Why Bacteria?
 Quick to reproduce
 Plasmids – small
circular DNA that
can be taken up by
bacteria and
replicated
 Transformation is
the uptake of the
DNA by bacteris
 Easy to grow
Gene
Cloning
 Need
 Primers (specific to the
gene you want)
 Nucleotides
 Polymerase
 Genomic DNA
 Like PCR, but with
fluorescently labeled
nucleotides
 When a labeled
nucleotide is added, it
stops further elongation
 Then run it through a
mini-gel
What if we wanted to look at how many
hemoglobin and metabolism related genes get
expressed in comparison to other organisms?
 Write on a sheet of paper
 3 things you understand
 2 things you need to understand better
 1 thing you do not understand at all
 Now, you and your group need to pick one topic and
use the book to help you better understand that topic
 We want to make insulin for people to use as medicine
for diabetes.
 How do we make this?
 DNA cloning
 Expression in a cell downstream from an active
promoter – most likely in a yeast cell because of post
translational modification.
 Gene Therapy – inserting
genes into an afflicted
individual for
therapeutic purposes
 Transgenic plants and
animals – individuals
that have introduced
genes in their genome
 Video on transgenics
3. Which band(s) traveled fastest?
4. The bands of DNA traveled to the
bottom of the gel, is this side
positive or negative on the
electrode? Why?
5. What suspect should be questioned
further about the crime?
Suspect 6
Suspect 5
Suspect 4
Suspect 3
Suspect 2
Suspect 1
DNA found at
crime scene
2. Which band(s) traveled slowest?
DNA
marker
1.What do the bands in the drawing of
the agarose gel represent?
 What do the bands in the drawing of the agarose gel represent?




Many DNA fragments which are the same size
Which band(s) traveled slowest?
The bands nearest the wells (containing the longest DNA
fragments) traveled the slowest.
Which band(s) traveled fastest?
The bands farthest from the wells (containing the shortest DNA
fragments) traveled the fastest.
The bands of DNA traveled to the bottom of the gel, is this side positive
or negative on the electrode? Why?
The negative pole is located closest to the wells. The positive pole
is located furtherst from the wells. DNA is negatively charged.
What suspect should be questioned further about the crime?
Suspect 2 and 4
 Have one student from your group grab one strip of
paper from the front (under the document camera)
and decide what biotechnological techniques you will
use to answer the given question. BE SPECIFIC!
*Note: on the next slide I will list some of the techniques
you might want to use.
 Cloning using
 Expression vector-
bacteria
 Cloning using PCR
 Nucleic acid
hybridization
 Gel electrophoresis
 DNA sequencing
 Create a genomic
library
 RFLP analysis
 RNA extraction
 Reverse transcriptase
using bacteria to
express a gene
 Restriction enzymes to
chop up DNA at specific
points
 Microarrays
 In vitro mutagenesis –
mutated forms of a gene
are reinserted into the
original species to look
for malfunctions in
gene expression
 Began in 1990, originally thought it would take 15
years, but only took 13 – Ended in 2003
 Main goals of the HGP
 Identify ~20,000-25,000 genes
 Determine sequence of all (haploid) 3 billion base pairs
(*we have 6 billion if you take into account that we are
diploid)
 Bioinformatics (Store large amounts of DNA
information)
 Address ethical issues