Download DNA/RNA/Protein Synthesis Pre-Test

DNA/RNA/Protein Synthesis Pre-Test
Fill in the blank.
1._____________ Name the process that makes DNA
2. ____________ This molecule makes up the sides of the ladder along with phosphate.
3. ____________ These are a 3-base code for amino acids.
4. ____________ You align your chromosomes in a Karyotype according to size and ?
5. ____________ Name the process in which amino acids are assembled to make proteins
Matching
6. _________ Frederick Griffith
7. _________ Lawrence Bragg
8. _________ Rosalind Franklin
9. __________Watson and Crick
10. __________ Erwin Chargaff
A. Found that A=T and C=G
B. Found that traits of bacteria were passed
from parents to offspring
C. Used X-Ray to reveal structure of crystals
D. Found that DNA was made of more than
1 nucleotide; DNA had a backbone made
of phosphate and sugar
E. Determined that actual structure of DNA;
1 strand is complimentary to the other.
Tell me where these processes occur in the cell.
11.__________________ Transcription.
12. __________________ Translation
13. __________________ Replication
Multiple Choice
14. _______ A nucleotide contains the following three molecules
a. phosphate, deoxyribose, and base
b. phosphate, deoxyribose, and thymine
c. phosphate, sugar, base
d. all of the above
15. _______ rRNA does this
a. translates the DNA strand and codes for amino acids
b. carries amino acids to make proteins
c. uses the information from DNA to make proteins
d. makes up ribosomes and attaches to the mRNA
16. _______ DNA helicase
a. attaches to mRNA and reads it three bases at a time.
b. attaches to DNA and breaks it apart for transcription to occur
c. attaches to DNA and breaks it apart to make replication occur
d. attaches the correct bases to the DNA strand to make RNA
17. _______ tRNA does this
a. translates the DNA strand and codes for amino acids
b. carries amino acids to make proteins
c. uses the information from DNA to make proteins
d. makes up ribosomes and attaches to the mRNA
18. _______ DNA Polymerase
a. attaches to mRNA and reads it three bases at a time.
b. attaches to DNA and breaks it apart for transcription to occur
c. attaches to DNA and breaks it apart to make replication occur
d. attaches the correct bases to the DNA strand to replicate DNA
19. _______ mRNA does this
a. translates the DNA strand and codes for amino acids
b. carries amino acids to make proteins
c. uses the information from DNA to make proteins
d. makes up ribosomes and attaches to the mRNA
20.________ RNA Polymerase
a. attaches to mRNA and reads it three bases at a time.
b. attaches to DNA and breaks it apart for transcription to occur
c. attaches to DNA and breaks it apart to make replication occur
d. attaches the correct bases to the DNA strand to replicate DNA
21. ________ This the DNA strand ATCTTCGTCAT, what would its complementary
strand be
a. TAGATGCAGTA
b. TAGAAGCAGTA
c. TAGAAGCGTA
d. TAGAAGGCAGTA
22. _________ Which one of these shows an addition? DNA:: ATCTTCGTCAT
a. TAGATGCAGTA
b. TAGAAGCAGTA
c. TAGAAGCGTA
d. TAGAAGGCAGTA
23. ________ Which on of these shows a deletion DNA:: ATCTTCGTCAT
a. TAGATGCAGTA
b. TAGAAGCAGTA
c. TAGAAGCGTA
d. TAGAAGGCAGTA
TRUE or FALSE (Fix the False statements to make them true)
24.______________ Messelshon and Stahl found that one strand of DNA was
complementary to the other strand.
25. _____________ Transcription is the making of DNA
26. ______________ RNA is double stranded while DNA is single stranded
27. ______________ Translation is the assembling of amino acids to make proteins.
28. ______________ RNA contains ribose and DNA contains deoxyribose.
29. ______________ Replication is the process of replicating RNA.
30. ______________ DNA polymerases have a “proofreading” role that eliminates most
mutations.
32._____________ DNA is replicated in Prophase of Mitosis
Work out the following:
DNA: TACCCTATCCGCATATTCCGGTCTGGCTAATGCGT
mRNA:
Using your amino acid decoder, code the above mRNA strand for correct amino acids.