Download RNA and Translation notes

RNA
RNA is much like DNA except:
•Nucleotides are not deoxy (that is they have a 2’ OH).
•UTP is used instead of dTTP
•Bases in RNA (especially tRNAs) are often modified (SLIDE)
•RNA is usually single stranded
•RNA can be edited by removal or addition of bases
Content of RNA in a typical E. coli cell:
Half lives: mRNA(minutes), tRNA(hrs/days), rRNA(hrs/days)
•In prokaryotes there is one RNA polymerase (RNAP ) that is responsible for
the synthesis of mRNA, tRNA and rRNA.
•Eukaryotes have 3 RNAPs:
I: synthesizes rRNA
II: synthesizes mRNA
III: synthesizes tRNA
Other differences between prokaryotic and eukaryotic transcription:
Prokaryotic
Eukaryotic
Place
cytoplasm
nucleus
Structure
polycistronic or monocistronic monocistronic
Translation coupled
separate from transcription
Transcription
There is one RNA polymerase in bacteria responsible for mRNA, tRNA and
rRNA synthesis. It is not the same as the one that is involved in priming DNA
synthesis.
Promoter structure
•Two parts -35 region and the -10 region
-For housekeeping genes the promoter is similar to:
TTGACA-N14-TATAAT
•These regions are -35 bp and -10 bp to the left of the start of the mRNA which
begins at a site called the +1 site.
Determination of important binding sites by finding consensus sequences
First consensus slide
RNAP composition:
2 x  subunit (gene: xx)--These bind regulatory sequences near promoters
2 x subunit (rpoA)-binds DNA
1 x  subunit (rpoB)- binds ribonucleotides
1 x ’ subunit (rpoC)-binds DNA
1 x  subunit-rpoZ-RNAP assembly and transc. control
1 x  subunit (rpoD, rpoH, rpoS and others)-binds -35 and -10
Sigma Factors
•RNAP binds to promoters via interaction of the  subunit with the -35 and -10
boxes. Sigma factors are elongated proteins that contact the -35 region with their
d4 domain and the -10 region with the d2 (d2.4) domain.
Alternative sigma factors recognize different promoters
(Sigma and different promoter slides, RNAP bound to promoter)
Gene: piece of DNA that encodes a protein or a functional RNA (e.g. tRNA or
rRNA)
Cistron: the coding region of a piece of DNA or RNA
*Promoter: Binding site for RNA polymerase
*Shine-Dalgarno site: Binding site for the 30S ribosomal subunit
Open reading frame: Nucleic acid that does, or might encode a protein. It
begins with a start codon (ATG, TTG, GTG) and ends with a stop codon (TAA,
TAG and TGA) and is long enough to encode a protein (usually 50 amino acids).
*Transcriptional terminator: place where RNA polymerase stops making
RNA.
*learn more about these shortly
Features of bacterial mRNA
•Prokaryotic RNA can be polycistronic (more than one gene can be found on
a transcript).
•Prokaryotic genes are often arranged in operons of genes encoding related
functions. This allows coordinated regulation of these genes.
•No intervening sequences (introns) have been found in eubacterial genes.
Some archaeal tRNA genes and some phage genes have introns.
•Transcription and translation are coupled in prokaryotes: translation occurs
while the mRNA is being made.
Translation
Ribosome structure
Ribosome structure slide
229 notes
•rRNA operon structure: promoter-16S-tRNA-23S-5S-tRNA. These are
excised by RNaseIII
•Number of rRNA operons can vary from species to species, and there is a
correlation between number and growth rate with fast-growing species having
more.
Species
rRNA
Growth rate
Number
Bradyrhizobium japonicum
1
10 hours
Sinorhizobium meliloti
3
2.5 hours
E. coli
7
20 minutes
Vibrio natriegens
13
10 minutes
tRNAs and the formation of aa-tRNA
tRNA slides
•tRNAs have two roles in translation:
1. They act as adaptors between mRNA and the ribosome. Ribosomes
can’t decode mRNA without them.
2. They carry amino acids to the ribosome.
•tRNAs need to be “charged with the proper amino acid. For example, tRNAgly
needs to be charged with glycine. If it is mischarged with then the wrong a.a. will
be incorporated into protein.
REACTION (two steps each of which happens on the aa-tRNA-synthetase):
1. glycine + ATP > AMP-Glycine + PPi (reversible editing)
2. tRNAgly + AMP-Glycine tRNAgly-Gly + AMP
•The correct aa-tRNA-synthetase must recognize both the a.a. and the tRNA.
Note: there are: 20 a.a. x 20 tRNA types x 20 aa-tRNA synth = 203=24,000
possible combinations!! If done incorrectly (~23,999 ways to mess up), then the
tRNA will be mischarged.
(tRNA synthetase slide)
•Charging is done by aminoacyl-tRNA-synthetases. Usually there is one for each
amino acid. Therefore, all tRNAs for leucine are recognized by one aa-tRNAsynthetase which is specific for leucine and all of its tRNAs.
•E. coli has 1 aa-tRNA-synthetase for each a.a., except lysine (it has 3) for a
total of 22 aa-tRNA-synthetases
tRNAs and genetic code
•mRNA has to be decoded or translated by ribosomes which looks at groups of
contiguous bases. how big are the groups?
-Need to code for 20 amino acids
-If one base was read, you could code for 41=4 amino acids (A,U,C,G)
-If two bases were read, you could code for 42=16 amino acids (AA, AU,
AC, AG…)
-If three bases were read, you could code for 43=64 amino acids
ENOUGH!
Genetic code slide, CodonUsage slide
Initiation
•The 30S subunit initiates protein sythesis by binding at the start codon such that
the initiator tRNA (tRNAfmet) is placed in the P site. This is true irrespective of
the whether the start is AUG, GUG or UUG.
ShineDalgarno
•The first AUG codon on message is often NOT the start codon. So how does
the ribosome find the true start condon?
•The 3’ end of the 16S rRNA (in the 30S sunbunit) has a sequence that binds in
an antiparallel and complimentary fashion to a seqence which is found 5-10 nt
upstream of real start codons. The sequence on the mRNA (and which can be
seen in the DNA) is the “Shine Dalgarno sequence.
•When bound to the SD sequence, the AUG start codon is correctly positioned
in the P-site of the 30S
subunit.
SD sequences slide
Elongation
•Release
•When the ribosome reaches a stop codon, there is no tRNA with a compatible
anticodon. Instead the codons are recognized by a protein release factor RF1 or
RF2.
RF1 recognizes UAA and UAG in the A-site
RF2 recognizes UAA and UGA in the A-site
•Ef-G and possibly RRF (ribosome release factor) bind and the peptide is
cleaved from the peptide from the last tRNA which is in the P site.
•RF3 binds and removes RF1 or RF2 from the ribosome.
•The ribosome dissociates and the 30S subunit can bind a new mRNA
•After release, the formyl group is usually removed from the f-met by a
deformylase.
•The reulting methionine is then often cleaved from the N-terminus of the
peptide, if the next amino acid is small: ala, pro, ser, thr, gly, cys or val.
Protein folding
•No time to cover--read in text
Gene of regulation expression
Basic idea is to make only the proteins that are
needed at any given time, and to make as many as are
needed (not too few or too many)
•Some proteins are needed all of the time and need
to be synthesized continuously at the right rate:
-ribosomes, cell wall synthesis enzymes, DNA
synthesis enz. etc.
•Some are needed only occasionally:
-amino acid biosynthesis
-proteins for degrading particular C-sources
-virulence proteins
Study of bacterial regulation of gene expression is
a good model for intersting eukaryotic questions.
(Slide)
•Regulation of expression
different places:
occurs
at
a
number
of
*=controlled here sometimes
**=most common point of control
Contol of transcription is the most important of
these--most efficient to stop the process near the
beginning rather than later.
•best use of resources
•not much sense in making proteins only to
degrade them because
they are not needed. Better to prevent their
synthesis
Hierarchry of Gene expression
Single gene
Operon (cluster of genes which share a promoter)
Regulon: group of genes and/or operons which are controlled by a common regulatory protein. eg s32
Stimulon: a group of genes operons and/or regulons which are all controlled by a common environmental
condition. E.G. the High Temperature Stimulon
Two basic modes of transcriptional control
•Negative control:
•strong promoter, ground state is “on”.
•Regulation is designed to keep it off when it
is not needed (usually using a protein repressor
that blocks RNAP)
•Positive control:
•weak promoter, ground state is “off”
•regulation is designed to turn the promoter on
when it is needed (usually by a protein activator
that helps RNAP bind at the
promoter,
or
that
helps RNAP form an open complex)
Positive control: the maltose regulon of E. coli
Positive control by 2-component systems
2 parts, usually set up as follows:
Membrane-bound sensor--called sensor kinase
DNA binding protein, often a transcriptional
activator
Two component diagram
Negative control
Need a simple example here
The DNA-binding proteins that effect positive and
negative control recognize DNA binding sites through
specific interactions between the protein and the
DNA (usually in the major groove). The specificity
give the activators and repressors the ability to
recognize certain sequences--much like sigma factors
recognize specific -35 and -10 regions.
•A common protein motif that binds DNA is called
“helix-turn-helix”
-short 7 aa -helix + a 3-4 aa turn + 10-12 aa
-helix
-the longer helix sits in the major groove and
provides much of
the specificity
-proteins with HTH often function as dimers and
recognize their
binding sites twice, in inverted
repeats:  
LacI binding site O1: AATTGTGAGCGATAACAATT
TTAACACTCGCTATTGTTAA
(See slide
repeats)
for
how
protein
dimers
bind
inverted
•Pymol on LacI binding
•Slides on other HTH proteins
•SMART database search on LacI--use HTH to find all
other HTHs in E. coli
Monitoring Gene Expression