Download Cancer Gene Detection

1
Cancer Gene Detection
Objectives:
After completing this lab a student should be able to:
1. Describe 2 mechanisms that explain why cancer occurs.
2. Diagram the role of a single gene using Chromosome 17 and gene responsible
for the p53 protein as an example.
3. Perform a test using electrophoresis and DNA samples to detect the presence
of the gene.
4. Create a pedigree displaying the gene occurrence in a family.
5. Evaluate the potential effects of the inheritance on family members.
6. Synthesize and communicate the ramifications of the information provided by
the test to both the individual requesting the genetic analysis and the family
members.
Background Information
The Human Genome Project and recent information on molecular reactions
associated with genes have revealed new insight about how and why cancer
develops. Every human cell contains a full complement of chromosomes in its
nucleus. This full set of 23 pairs of chromosomes includes a set of 23 inherited from
the mother and 23 inherited from the father. The offspring represent a combination of
the genes on these chromosomes. This explains why children resemble their parents,
but it also elucidates why siblings are more like each other than they are like their
mother or father. Each offspring is a combination of genetic material 50% from the
mother and 50% from the father for each trait.
A gene is a segment of the DNA or chromosome that dictates a particular
characteristic, trait, or task. A gene represents a recipe, such as for a protein that
causes muscles to contact, or an enzyme that digests food, or an antibody that
protects you from disease. The gene options available for the characteristic or trait are
referred to as alleles. For instance, when buying a Corvette Stingray you have options
of getting it in a variety of colors. In the same way, the gene for hair color has options
or alleles of blonde, brown, red, etc.
The final expression of a trait depends upon the interaction of the alleles. If you
receive an allele (gene option) for tasting PTC from your mother (T) and an inability to
taste PTC from your father (t), one gene predominates over the other. For example
the tasting allele (T) will be dominant, overcoming the expression of the non-tasting
allele (t). If the offspring gets the combination of tasting and non-tasting alleles (Tt) the
child will be a taster. The t allele is present but because it is recessive, it is hidden and
overwhelmed by the instructions of the other allele. (There are options where alleles
both exert their influence resulting in shared expression, such as in AB blood types, or
where the result is mixed but that involves issues we will not deal with in this lab).
2
Tracking the Gene through a Pedigree
Before genetic analysis was available our knowledge of particular genes in
families was limited to probability as diagrammed in pedigrees. A pedigree maps the
expression of a trait within a family. Remember this is tricky when talking about
dominant and recessive traits. You can only see what trait a person expresses. But by
analyzing the family relationships you can begin to hypothesize the actual genetic
makeup of individuals.
When drawing or studying a pedigree the following symbols are used:
A person not displaying
A person displaying the
the trait
trait
Female
Male
A deceased female
Female
Male
A deceased male
A deceased child sex
unknown
A marriage
Sample marriage with offspring
The ability to taste PTC is a dominant trait. Using the tasting paper provided in class,
test the ability to taste PTC in your family members and draw a pedigree.
3
Analyzing the presence of genes
All cells contain every gene. However, cells use their genes selectively, turning
some genes off and on when they are needed, and turning other genes off
permanently if they are not required. Genes are composed of a stretch of DNA with a
particular code created by the bases A, G, T, and C. For example a stretch of DNA
may read:
AAGGCCTCGATCCATGTACGATGTAATGGGACACAACGCGCGCATACTGTCATCGTACTCA
The genes along this stretch would be much longer but just to visualize the concept
used in this experiment consider the fact that the following represent genes along that
stretch of DNA
AAGGCCTCGATCCATGTACGATGTAATGGGACACAACGCGCGCATACTGTCATCGTACTCA
Gene 1
Gene 2
9 base pairs 21 base pairs
Gene 3
30 base pairs
Now imagine that we are going to chemically split the genes and then separate the
genes by size. The genes can be split by enzymes and separated by electric currents
using a process called electrophoresis.
The pieces of DNA are multiplied using PCR (Polymerase Chain Reaction),
which amplifies or zeroxes copies the genes so that there are multiple copies of each
gene within a DNA soup.
caption: DNA underlies every aspect of human health, both
in function and dysfunction. Obtaining a detailed picture of
how genes and other DNA sequences function together and
interact with environmental factors ultimately will lead to the
discovery of pathways involved in normal processes and in
disease pathogenesis. Such knowledge will have a profound
impact on the way disorders are diagnosed, treated, and
prevented and will bring about revolutionary changes in clinical
and public health practice.
image credit: U.S. Department of Energy Human Genome Program,
http://www.ornl.gov/hgmis.
This DNA soup with many copies of a variety of genes is then
placed in a gel and electricity is passed through the gel in one direction. This
separates the pieces of the DNA by size and by components the larger chunks of DNA
stay close to the point of origin and the smaller pieces are carried further away from
the initial starting point.
4
Gene3
ACACAACGCGCGCATACTGTCATCGTACTCA
ACACAACGCGCGCATACTGTCATCGTACTCA
ACACAACGCGCGCATACTGTCATCGTACTCA
ACACAACGCGCGCATACTGTCATCGTACTCA
Gene 2
ATCCATGTACGATGTAATGGG
ATCCATGTACGATGTAATGGG
ATCCATGTACGATGTAATGGG
ATCCATGTACGATGTAATGGG
ATCCATGTACGATGTAATGGG
Gene 1
AAGGCCTCG AAGGCCTCG AAGGCCTCG
AAGGCCTCG AAGGCCTCG AAGGCCTCG
AAGGCCTCG
5
Oncogenes and Tumor Suppressor Genes
Occasionally a mutation or change in the composition of a gene may occur.
Even a small change, such as a single base change (AGA for ATA) may make a big
difference in the final product. Some mutations are passed on through inheritance.
Some are acquired when existing DNA is damaged or changed within a person due to
environmental influences such as radiation or toxic chemicals, called carcinogens.
Some mutations lead to cancer. To date two main types of genes have been identified
that play an important role in cancer: oncogenes and tumor suppressor genes.
Oncogenes
Cell growth is usually very controlled and occurs in a lock step manner. Protooncogenes are genes that control the timing of cell division and the differentiation or
specialization of cells. When a proto-oncogene is mutated it becomes an oncogenes
the result is abnormal growth and reproduction of cells. Cancer is the loss of this
control and is uncontained cell division. Some have analogized cancer to a car with
the gas pedal stuck down. Many anti-cancer drugs have been developed to try and
target the oncogenes and the uncontrolled cell division.
Tumor suppressor genes
Tumor suppressor genes slow down cell division, and correct mistakes in the DNA,
and indicate when a cell should begin apoptosis – normal cell death. When the tumor
suppressor genes do not work properly the result can be cancer. More than two dozen
tumor suppressor genes have been identified, examples include p53, BRCA1, and
BRCA2.
Details of this Lab
This experiment is a study of the cancer in a family. The goal is to determine the
potential inheritance of Li-Fraumeni Syndrome (LFS), which is an abnormality of the
p53 tumor suppressor gene. LFS produces a complicated picture because several
different types of cancers develop including bone cancer, brain tumors, breast cancer,
adrenal cancer, and leukemia. Other types of cancers can occur when environmental
effects result in a sporadic change of the p53 gene that is not inherited. These kinds of
sporadic, non-inherited cancers include lung cancer, colon cancer, and breast cancer.
Over 50% of the human cancers identified display an abnormality in the p53 gene and
it appears to be one of the most commonly mutated genes. Treatment options and
family considerations represent important concerns that stimulate people to seek out
genetic analysis for this syndrome.
Further information on this genetic syndrome are available at::
http://www.cancer.org/docroot/ETO/content/ETO_1_4x_oncogenes_and_tumor_
suppressor_genes.asp
and
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowSection&rid=gnd
6
The p53 tumor suppressor protein
The p53 gene like the Rb gene, is a tumor suppressor gene,
i.e., its activity stops the formation of tumors. If a person
inherits only one functional copy of the p53 gene from their
parents, they are predisposed to cancer and usually develop
several independent tumors in a variety of tissues in early
adulthood. This condition is rare, and is known as LiFraumeni syndrome. However, mutations in p53 are found in
most tumor types, and so contribute to the complex network
of molecular events leading to tumor formation.
The p53 gene has been mapped to chromosome 17. In the
cell, p53 protein binds DNA, which in turn stimulates another
gene to produce a protein called p21 that interacts with a cell
division-stimulating protein (cdk2). When p21 is complexed
with cdk2 the cell cannot pass through to the next stage of cell division. Mutant p53
can no longer bind DNA in an effective way, and as a consequence the p21 protein is
not made available to act as the 'stop signal' for cell division. Thus cells divide
uncontrollably, and form tumors.
Help with unraveling the molecular mechanisms of cancerous growth has come from
the use of mice as models for human cancer, in which powerful 'gene knockout'
techniques can be used. The amount of information that exists on all aspects of p53
normal function and mutant expression in human cancers is now vast, reflecting its
key role in the pathogenesis of human cancers. It is clear that p53 is just one
component of a network of events that culminate in tumor formation.
Step 1
Establish a family pedigree of the patient from the information made available as part
of the family physician and oncologist’s diagnoses concerning a young woman with
suspected Li-Fraumeni Syndrome.
Clinical History: Upon monthly breast self-exam, Valerie Brown, age 36, found a small
irregular mass. She was concerned because her mother had a mastectomy in her late
thirties. Valerie made an appointment with her doctor and was referred to an
oncologist at a local cancer center. Upon consultation with her mother Valerie found
that her father’s family was free of cancer, but several cases had occurred on her
mother’s side.
7
Construct a pedigree with the following information:
 Mother Diane – diagnosed and treated for breast cancer at age 30
 Valerie did not know her mother, Diane, had a sister, Mabel, who died a brain
tumor at age 2
 Diane’s brother, James, underwent surgery and chemotherapy for colon cancer
 Valerie’s, maternal grandmother, Elsie, died at age 42 of bilateral breast cancer
 Valerie’s maternal grandfather, Elmer, was free of cancer and 88 years old
 Valerie’s cousin, Patrick (son of James) died of brain cancer at 14
 Valerie’s cousin Jane (daughter of James – sister of Patrick) was diagnosed with
leukemia and died at the age of 2
 Patrick’s two brothers, Robert (28) and Curtis (30) are cancer free and in good
health
 Valerie’s sister, Nancy (32) and cancer free
 Nancy’s son, Michael, was diagnosed with sarcoma at age 3 and was recently
diagnosed with osteosarcoma (he is now 18)
 Nancy’s other son, Justin (12), and daughter, Jessica (8), are free of cancer
 Valerie has five children : Justin (16), Sheila (14), Robert (10), Angela (8), and
Anthony (6) show no signs of cancer at this time.
Valerie’s DNA has already been digested with restriction enzymes that recognize the
mutant sequence of the p53 gene. A comparison will be made between her normal
breast tissue, tumor tissue and blood DNA in an attempt to determine whether this
was inherited or sporadic (environmental) .The DNA has been amplified using PCR. A
control sample of DNA and a normal control of DNA are included in the test to mark
the gene locations. The DNA will be separated by gel electrophoresis, stained and
analyzed.
8
Loading the Gel
1. The gels and DNA samples have been prepared for you. Put on gloves,
goggles, and lab coats.
2. Use the sample gel and sample stain solution in the front of the class to
practice loading the submerged gel. The accuracy in loading is essential to
good clear results. Do not puncture or tear the gel in the process. Suck up a
sample of the stain. Use the sample pipettes and lower the tip into the well.
Squirt the stain into the well. A fresh gel will be used for the experiment.
3. Place the gel on its bed in the electrophoresis chamber. Be sure that the wells
are at the negative end of the electrophoresis apparatus because the DNA
fragments will migrate to the positive end.
4. Fill the electrophoresis apparatus chamber with the required volume of diluted
buffer. _____________________buffer mls
5. The gel is referred to as a submarine gel because it is completely submerged
under the buffer for the electrophoretic separation.
6. The DNA fragments need to be heated in a 65C water bath for 2 minutes to
help separate the fragments.
7. Carefully load the samples in the wells. Be sure and load sample A_E in
consecutive order in the wells (sample size 35-38l). If the samples are loaded
in the incorrect order the evaluations of the results may cause erroneous and
harmful diagnoses.
Electrophoresis
8. After all the samples are loaded, snap the cover in the electrode terminals,
making sure the negative and positive indicators on the cover and apparatus
are properly oriented.
9. Insert the black wire into the black input plug of the power source (negative
input). Insert the red wire into the red input of the power source (positive
output).
10. Set the power source at the required voltage ______________Volts for the
required time ________minutes.
11. Check for bubbles at the electrodes to assure that the current is flowing.
12. Allow the tracking dye to migrate 3.5-4 cm from the wells. This should assure
separation of DNA bands.
13. Turn off the power, unplug the power source, disconnect the leads and remove
the cover. Carefully remove the gel for staining.
Staining the gel
14. Wearing gloves moisten the surface of the gel with a few drops of the buffer.
9
Lane
Specimen
Source
Results
1
A
Standard DNA fragments
Sample fragments
2
B
Control DNA
Control with normal gene
3
C
Patient’s peripheral Blood
DNA
4
D
Patient Tumor DNA
5
E
Patient Breast Normal
DNA
What would you conclude concerning Valerie’s inheritance of the cancer?
What should she tell the family?
Do you think cancer gene analysis provided useful information for Valerie?
If you were one of her children would you want to know this information?
What can the doctor do as a result of this analysis?