Download Exam 2 Worksheet part 1 KEY

Exam 2 Review part 1
Define all terms, parts, functions, and the processes of DNA replication.
DNA replication begins at an origin of replication where the two strands of the double helix are locally
separated. This creates two “forks” where the double helix is unwound to form two single strands. The figure
shows one replicative fork. Note, because of the antiparallel nature of the DNA double helix, the two single
stranded legs of the fork have opposite polarity.
DNA polymerase requires a primer, a doubled stranded region with a single stranded extension. DNA
polymerase can only extend a free 3’ OH by matching complimentary bases with bases on a longer single
stranded template. Primers are created by an enzyme known a primase that synthesizes short stretches of RNA
complimentary to a single stranded template DNA. This creates short stretches of RNA/DNA double helix
(dotted lines in the figure) with the RNA part ending in a free 3’ OH. DNA polymerase is able to extend this
partial double helix in a 5’  3’ direction by adding deoxy-ribonucleotides complimentary to the sequence on
the template strand. DNA polymerase adds nucleotides one at a time always matching an A with a T, a T with an
A, a G with a C, and a C with a G on the template strand. The nucleotide substrates for DNA polymerase are
deoxyribonucleotide tri-phosphates. For every nucleotide incorporated into DNA two phosphates are released.
The polarity of the leading strand is such that DNA synthesis follows the fork, while on the lagging strand, the
direction of synthesis is away from the fork. This requires that new primers be periodically synthesized between
the old primer and the replicative fork. When DNA polymerase encounters an RNA primer the RNA nucleotides
are removed and replaced by DNA nucleotides. When the process encounters a DNA/DNA double helix, the two
DNA ends are linked by DNA ligase forming a continuous DNA double helix with no covalent breaks.
Define all terms, parts, functions, and the processes of transcription and mRNA processing.
Transcription is making mRNA from DNA. In eukaryotes Pre-mRNA is made and spliced. Transcription begins at
the promoter and ends at the terminator within template strand. Proteins first interact with DNA sequences in
the initiation process. RNA polymerase binds to the promoter. RNA is made in the 5’ – 3’ direction from a 3’-5’
DNA template. In eukaryotes only mRNA is processed. Intons are cut out and a cap and tail is added.
Define all terms, parts, functions, and the processes of translation.
The mRNA moves into the small subunit of the ribosome. The large subunit then connects to the small subunit,
and it has an A, P, and E site. The tRNA enters at the A site, adds on a single amino acid at the P site, and exits at
the E site. Single amino acids are encoded from mRNA starting with an initial start codon which is AUG and
ending with a stop codon which can be any one of three codes. Review your book for how to read the codons on
mRNA. This is where polypeptides are formed also known as proteins.
Define all terms, parts, functions, and the processes of gene expression.
For genes to be expressed we have a variety of ways that cells regulate that process. One way is through
hormones, also mRNA has introns that are spliced in a variety of ways by spliceosomes and this causes genetic
variability. One common way of genetic expression is when the transcription of mRNA is activated or repressed
by certain cellular chemistry including hormones, transcription factors, and secondary molecules such as cAMP
(cyclic AMP). These molecular chemical messengers and target molecules determine whether or not the RNA
polymerase in able to transcribe the DNA into mRNA. This determines the proteins that are made by the cell,
and this is the basic understanding of gene expression. Review in your book and notes the E. coli operon (which
is going to be in your exam) for a better understanding of how gene expression is regulated.
5’ AGATGTTACCGTAAATGCGTGCATGACGTAATATGCGCTAGA 3’
This is a DNA strand. What if any protein would result from it. Use the codon
chart in your book.
5’ AG AUG UUA CCG UAA AUG CGU GCA UGA CGU AAU AUG CGC UAG A 3’
MET-LEU-PRO-STOP, MET-ARG-ALA-STOP, MET-ARG-STOP
Multiple choice quiz: Choose the best answer
1.
What determines the order of amino acids in cellular proteins?
A. ATP
B. glycolysis
C. Calvin cycle
D. DNA ligase
E. the order of nucleotides in DNA
2. Where are “promoters” located?
A. On DNA
B. On mRNA
D. On tRNA molecules
C. On protein molecules
E. answers A and B are both correct
3.
Shown below is a short mRNA. What polypeptide will be produced by a cell from this mRNA? [a genetic
code table is found on page 7]
3’UCGUAACGCAGUCGGCCUUGAUUACCCGUAGUCUUAGGUUACCGUUA 5’
A. met-gly-phe
B. ile-ala-met-gly-phe
C. met-pro-ile-ser-ser-gly D. met-ala-pro-pro-arg
E. pro-ser-arg-arg
4.What does DNA ligase do?
A. covalently links DNA to protein in cellular processes
B. connects together amino acids in ribosomes during translation
C. causes recombination between circular DNA molecules
D. separates the two strands of DNA during DNA replication
E. creates a sugar phosphate bond between a free 3’OH and 5’ phosphate in one strand of double stranded DNA
5. What element of the operon does a repressor protein attach to?
A. the repressor
B. the structural gene
D. the activator
E. the operator
11. What are the inputs to the Calvin Reactions?
A. sucrose, water, and ATP
B. O2, NADP+, and ATP
C. CO2, NADPH, and ATP
D. GTP, water, and CO2
E. rubisco, glyceraldehyde-3-phosphate (G3P), and O2
C. the promoter