* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Biotechnology - clevengerscience
DNA paternity testing wikipedia , lookup
DNA sequencing wikipedia , lookup
Epigenetics wikipedia , lookup
Genome evolution wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Human genome wikipedia , lookup
Metagenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA profiling wikipedia , lookup
Primary transcript wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Point mutation wikipedia , lookup
SNP genotyping wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genetic engineering wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Designer baby wikipedia , lookup
Genome editing wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genomic library wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Epigenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Microevolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Biotechnology 2007-2008 A Brave New World Practical DNA Technology Uses • Forensics – Sequencing DNA of crime suspects • Diagnosis of disease – DNA screening for diseases • Human gene therapy – Replacing absent or faulty DNA with normal, working DNA • Pharmaceutical products (vaccines) • Transgenic organisms – Animals • Mice with human genes for animal testing • Livestock with extra copies of growth hormone genes to improve food supply • Chicken with a gene resistant to the bacteria that causes food poisoning – Plants • 52% of soybeans and 25% of corn in U.S. are transgenic. Human Genome Project Mapping the Human Genome • • • • Complete in 2003 46 chromosomes 3.2 billion DNA base pairs 19,599 protein-coding sections – Genes make up 2% of Human DNA • 98% of DNA is non-coding – Entire function is still unknown, but does play a role in gene regulation Cloning • Cloning is a term that refers to making a genetically identical copy. • Cells and Tissues can be cloned. • Organism cloning (also called reproductive cloning) refers to making a new multicellular organism, genetically identical to another. How to Clone Take a donor’s egg and remove the nucleus. Insert a nucleus from the targeted individual’s diploid cell. Dolly • In 1996, Ian Wilmut cloned Dolly from an adult sheep. CopyCat • In February 2002, researchers from Texas A & M reported the live birth of a cloned tabby. • Researchers are interested in using cloned cats in AIDS research, since feline AIDS is a good model for human AIDS. Noah (Ox Cloned in a Cow) in 2001 PCR • Polymerase Chain Reaction – method for making many, many copies of a specific segment of DNA – ~only need 1 cell of DNA to start PCR process • In tube: DNA, DNA polymerase, primer, nucleotides • Denature DNA: heat (90°C) DNA to separate strands • Anneal DNA: cool to hybridize with primers & build DNA (extension) What does 900C do to our DNA polymerase? The polymerase problem • 90°C heat destroys DNA polymerase • Need enzyme that can withstand 90°C… – Taq polymerase (Thermus aquaticus) • from hot springs bacteria Sequencing DNA • A PCR is run four times; each time with a different dideoxynucleotide, or “ddNTP,” which lack the 3'hydroxyl group. • Whenever a ddNTP is incorporated into a growing DNA chain, it stops chain growth. • The resulting pieces can be analyzed for length to determine the sequence of the DNA. Restriction enzymes • Cut DNA at specific sites – leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA Sticky ends • Cut other DNA with same enzymes – leave “sticky ends” on both – can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA Process of DNA Fingerprinting • First restriction enzymes cut the DNA into fragments • The DNA fragments are separated fragments by size with Gel Electrophoresis Gel electrophoresis • DNA is negatively charged • When it’s in an electrical field it moves toward the positive side • small pieces travel farther • large pieces travel slower DNA – “swimming through Jello” + Gel Electrophoresis DNA & restriction enzyme longer fragments wells power source gel shorter fragments + completed gel Uses: Evolutionary relationships • Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel – DNA + 1 2 3 4 5 1 2 3 4 fruitfly 5 Uses: Medical diagnostic • Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 – DNA Example: test for Huntington’s disease + Pre-Implantation Genetic Diagnosis (PGD) Removing a cell for diagnosis from a human embryo. Amniocentesis and Chorionic Villus Sampling Many new techniques for learning about individual genes rather than whole chromosomes are available or under development. Uses: Paternity • Who’s the father? – DNA + Mom F1 F2 child Uses: Forensics • Comparing DNA sample from crime scene with suspects & victim suspects S1 S2 S3 crime scene V sample –DNA + Forensic DNA fingerprinting • Any two humans have 99.9% similar DNA •0.1% of 3 billion base pairs is still 30 million. •The protein-coding sections of our DNA may lose their function if sections are repeated. •However, the non-coding sections of DNA can contain several short (2-4 bases) repeats called Short Tandem Repeats (STR). •The number of repeats changes the length of DNA. Differences at the DNA level • Two sections of “junk” DNA 3 Repeats GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 6 Repeats DNA patterns for DNA fingerprints Allele 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Cut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 – DNA allele 1 3 + Differences between people Allele 1 cut sites cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Allele 2: more repeats GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 1 2 DNA fingerprint – DNA allele 1 allele 2 3 + RFLPs • Restriction Fragment Length Polymorphism – differences in DNA between individuals Alec Jeffries 1984 change in DNA sequence affects restriction enzyme “cut” site creates different fragment sizes & different band pattern RFLP / electrophoresis use in forensics • 1st case successfully using DNA evidence – 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect “standard” How can you compare DNA from blood & from semen? RBC? “standard” semen sample from rapist blood sample from suspect “standard” Electrophoresis use in forensics • Evidence from murder trial – Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard” Bacterial genome • Single circular chromosome –haploid –~4 million base pairs • 1/1000 DNA in eukaryote How have these little guys gotten to be so diverse?? Plasmids • Small supplemental circles of DNA • 5000 - 20,000 base pairs • self-replicating – carry extra genes • 2-30 genes • genes for antibiotic resistance – can be exchanged between bacteria • bacterial sex!! – can be imported from environment Plasmids help us get new genes into bacteria • Insert new gene into plasmid • Insert plasmid into bacteria = vector • bacteria now expresses new gene and makes new protein transformed gene from other organism recombinant plasmid cut DNA + vector glue DNA plasmid DNA RNA protein trait bacteria Grow bacteria…make more transformed gene from other organism bacteria recombinant plasmid + vector plasmid grow bacteria harvest (purify) protein Plasmids are also used to genetically engineer multicellular organisms • Plasmids are DNA vectors • Genes must be inserted into the zygote to change the traits of a multicellular organisms. • DNA combined from different sources is called Recombinant DNA • An organism with Recombinant DNA is called Transgenic p-GLO Gene • The gene that makes jellyfish glow has been isolated and inserted into other organisms. Uses of genetic engineering • Genetically modified organisms (GMO) – Protect crops from insects: BT corn • corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) – Extend growing season: fishberries • strawberries with an anti-freezing gene from flounder – Improve quality of food: golden rice • rice producing vitamin A improves nutritional value Gene Therapy • Problem (disease-causing) genes can be removed and replaced with normal genes.