Download Restriction enzyme

Restriction Enzyme Digestion &
Southern Blotting
of DNA
Experiment Goals
Digestion of DNA by restriction enzyme
Analyze digested DNA by electrophoresis
Transfer digested DNA to nitrocellulose
filters (Southern blotting)
– Procedure of setting up a Southern blotting
Restriction Enzymes
Definition:
• A restriction enzyme (or restriction endonuclease) is
an enzyme that cuts double-stranded DNA at specific
sites that it recognizes.
• The enzyme makes two incisions, one through each of
the sugar-phosphate backbones (i.e., each strand) of
the double helix without damaging the nitrogenous
bases.
Restriction enzyme
The enzyme EcoRI cutting DNA at its recognition sequence
• Different restriction enzymes have different recognition
sequences.
• This makes it possible to create a wide variety of different
gene fragments.
Function of Restriction Enzymes in
microorganisms
Provide microorganisms with resistance to
invading organisms or foreign DNA.
Endonucleases in bacterial cells resist infections
by viruses, by destroying foreign DNA
molecules.
consist of a related pair of enzymes
– Endonuclease – cuts foreign DNA
– Methylase – protects host DNA
Methylase Enzymes
Restriction enzymes usually occur in combination with
one or two modification enzymes (DNAmethyltransferases)
Protect the cell’s own DNA from cleavage by the
restriction enzyme.
Modification enzymes recognize the same DNA
sequence as the restriction enzyme that they
accompany,
Instead of cleaving the sequence, they methylate one of
the bases in each of the DNA strands.
The methyl groups protrude into the major groove of
DNA at the binding site and prevent the restriction
enzyme from acting upon it.
Naming
Restriction enzymes are named based on
the bacteria in which they are isolated in
the following manner: example “EcoRI”
E
Escherichia (genus)
co
coli (species)
R
RY13(strain)
I
First identified Order
Restriction Enzyme
There are hundreds of different REs from
different microorganisms
Each RE cuts DNA at a specific “recognition
sequence” of nucleotides. Examples:
EcoRI-- GAATTC;
AluI -- AGCT
Each recognizes its specific “recognition
sequence” and cuts both strands of DNA
wherever that sequence is found, but nowhere
else.
Restriction Enzyme Uses
Recombinant DNA technology
Cloning
– Replicates a sequence inserted into a host
cell
DNA restriction mapping
– A rough map of a DNA fragment
DNA fingerprints
Types of Restriction Enzymes
Restriction enzymes are traditionally
classified into three types on the basis of
–
–
–
–
subunit composition,
cleavage position,
sequence-specificity
and cofactor-requirements
Types of Restriction Enzymes
Type I - Recognize specific sequences and cut
DNA at a nonspecific site > than 1,000 bp away
Type II - Recognize palindromic sequences and
cut within the palindrome
Type III - Recognize specific 5-7 bp sequences
and cut 24-27 bp down stream of the site.
Type II restriction enzymes are the most useful
class as they recognize specific palindomic
sequences in DNA and cut the sugar phosphate
backbone within the palindrome
Restriction Enzymes and DNA fragments
A restriction enzyme functions by "scanning" the length
of a DNA molecule.
Once it encounters its particular specific recognition
sequence,
– it will bind to the DNA molecule
– and makes one cut in each of the two sugar-phosphate
backbones of the double helix.
Endonucleases and DNA fragments
Blunt ends
Sticky ends
Unit Determination Assay
One unit of restriction endonuclease is
defined as the amount of enzyme required
to digest one microgram of the appropriate
substrate DNA completely in 60 minutes
under the conditions specified for that
enzyme.
Set up of a restriction enzyme
reaction
A RE reaction contains the DNA to be
analyzed,
A restriction enzyme,
A restriction enzyme buffer mix.
– contains a buffering agent to maintain
constant pH,
– and Mg++ (from MgCl2) as a necessary
cofactor for enzyme activity.
HinfI Restriction Enzyme
Recognition Site:
Electrophoresis of Genomic DNA
Odd numbered lanes contain undigested genomic DNA
Even numbered lanes contain digested genomic DNA
Southern Blotting
Southern Blotting
The technique was developed by
E.M. Southern in 1975.
What Is Southern Blotting?
A technique used in molecular biology
to check for the presence of a particular
DNA sequence in a DNA sample.
Southern Blot
The Southern Blot takes advantage of the fact that
DNA fragments will stick to a nylon or nitrocellulose
membrane.
The membrane is laid on top of the agarose gel and
absorbent material (e.g. paper towels or a sponge)
is placed on top.
With time, the DNA fragments will travel from the gel
to the membrane by capillary action as surrounding
liquid is drawn up to the absorbent material on top.
The membrane is now a mirror image of the agarose
gel.
Uses of Southern Blotting
Identify mutations, deletions, and gene
rearrangements
Used in prognosis of cancer and in prenatal
diagnosis of genetic diseases
diagnosis of Leukemias
detect variations in gene structure
identify homologous genes among different
species
Performing Southern Blotting
1. DNA Digestion with an appropriate restriction
enzyme.
2. Gel Electrophoresis run the digest on an
agarose gel.
3. Denature the DNA (usually while it is still on the
gel).
4. Transfer the denatured DNA to the membrane
(blotting)
5. Preparing the probe
6. Hybridization Probe the membrane with
labeled ssDNA.
7. Detection Visualize your radioactively labeled
target sequence.
1- DNA Digestion
Cut the DNA into different sized
pieces.
HinfI restriction enzyme is used
2- Gel Electrophoresis
Sorts the DNA pieces by size
Agarose or polyacrimide
Electrophoresis of Genomic DNA
Odd numbered lanes contain undigested genomic DNA
Even numbered lanes contain digested genomic DNA
3- Denature the DNA
DNA is then denatured with an alkaline
solution such as NAOH.
This causes the double stranded to
become single-stranded.
4- Blotting
Transfer the DNA from the gel to a
solid support.
The blot is usually done on a sheet of
nitrocellulose paper or nylon.
Transferred by either electrophoresis or
capillary blotting.
4- Blotting
1) Electrophoresis- takes advantage of the
molecules negative charge.
4- Blotting
2) Capillary blotting-fragments are eluted from the gel and
deposited onto the membrane by buffer that is drawn
through the gel by capillary action.
Agar gel with DNA
Weight
Wick (filter paper)
Paper towel stack
Buffer
Filter paper
Membrane
4- Blot Fixation
The blot is made permanent by:
– Drying at ~80°C
– Exposing to UV irradiation
5- Preparing the probe
It is a fragment of DNA of variable length
(usually 100-1000 bases long), which is used to
detect in DNA the presence of nucleotide
sequences that are complementary to the
sequence in the probe
Must be labeled to be visualized
Usually prepared by making a radioactive copy
of a DNA fragment. Probing is often done with
32P labeled ATP, biotin/streptavidin or a
bioluminescent probe.
6- Hybridization
Hybridization-process of forming a doublestranded DNA molecule between a singlestranded DNA probe and a single-stranded
target patient DNA.
6- Hybridization
Steps for hybridization
1. The labeled probe is added to the matrix incubated
for several hours to allow the probe molecules to
find their targets
2. Any unbound probes are then removed.
3. The place where the probe is connected
corresponds to the location of the immobilized
target molecule.
probes
add probe 3’ –
*ATCTCGGGAATC – 5’
hybridization
5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’
* ATCTCGGGAATC
7- Detection
Visualize your labeled target sequence.
If radiolabeled 32P probe is used, then you
would visualize by autoradiography.
Biotin/streptavidin detection is done by
colorimetric methods,
and bioluminescent visualization uses
luminescence.
Steps in Southern Blotting
DNA
extraction
Disease gene
Fragments of
DNA appear
as a smear
DNA digestion
Gel electrophoresis
Blot dismantled
Paper towels
Chromatography
paper support
Nylon filter
Gel
10x SSC
Denaturation of patient’s DNA in gel
Gel in
NaOH
Southern blot
Autoradiography
X ray film
Hybridisation:
Stringency washes
Radioactive probe
added to filter
filter
cassette
filter
Southern Blot of same DNA (final result on x-ray film)
Southern Blotting Animation