* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download introduction1
Oncogenomics wikipedia , lookup
Transposable element wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Human genetic variation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Genomic imprinting wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Non-coding RNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Minimal genome wikipedia , lookup
Public health genomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Genomic library wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Medical genetics wikipedia , lookup
Y chromosome wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Human genome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Primary transcript wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Genome editing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genome evolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Neocentromere wikipedia , lookup
X-inactivation wikipedia , lookup
Genome (book) wikipedia , lookup
A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7. Nov 2003 General outline Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes The basic structure of living organisms - the cell More cells Plant cell Bacterial cell Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Central dogma of information flow in genetics DNA (dideoxynucleic acid) – the double helix The structure of DNA A gene A segment of DNA that is the template for making a protein Structure of a gene regulatory region Region that acts as a template for the production of proteins Chromosomes - the packing of DNA The structure of a chromosome Telomere regions Chromosome banding p-arm of chromosome (short arm) q-arm of chromosome (long arm) p5 p4 p3 p2 p1 q1 q2 q3 q4 q5 q6 q7 E.g. linkage of a disease to 2q7.2 The human chromosome map Chromosomal abnormalities Downs syndrome – 3 copies of chr 21 Turner syndrome – only one X chromosome Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Extracting genetic information from DNA - making an RNA copy of DNA DNA to RNA to protein via the ribosome The splicing of RNA DNA template exon intron exon intron exon intron exon Unspliced RNA copy of DNA Ready-to-use mRNA intron exon Alternative splicing of RNA Different functions of different splice variants Different expression of different splice variants Dominant-negative variants Amino acids • Amino acids link together to form a long chain • R (side chain) – varies between amino acids • There are 20 different amino acids Ribosomes translate 3-base sequences into amino acid chains – the building blocks for proteins amino acid chain ribosome AAGCUGAGAUCAGUUCGGAUACCGUA Note: T in DNA becomes U in RNA RNA “copy of DNA” The importance of being in-frame In-frame: THE FAT CAT ATE THE BIG HAT 1 bp deletion: THF ATC ATA TET HEB IGH AT 1 bp added: THE FAT CCA TAT ETH EBI GHA T 3D structure of a protein Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Mitosis - a cell divides to make two identical cells – part of normal growth Meiosis – only during reproduction Egg cells from mother Sperm cell from father An offspring Half of the chr from mother, half from father Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Loci, alleles & markers A locus is any point (or region) in the genome A genetic marker is anything in the genome that is variable and can be used to compare individuals If a locus is variable, distinct alleles (forms) of the locus (e.g. a gene or marker) can be defined and analyzed A genotype is the set of alleles an individual has at a particular locus A phenotype is a visible trait in an individual (e.g. blue eyes or the presence of a disease) Gregor Mendel (1822-1884) - the austrian monk with a passion for peas •The law of segregation Each individual carries two copies (alleles) of every gene and only one of these is transmitted to each child •The law of independent assortment Alleles from unlinked loci are assorted independently Mendel´s experiment with peas S: smooth gene s: mutated smooth gene Punnet´s square: ½ Ss = smooth ¼ SS = smooth ¼ ss = Wrinkled Principles of Mendelian analysis -First law • In each individual a trait is determined by two copies (alleles) of the same gene, one paternal and one maternal • Only one of the two parental alleles is transmitted to each child but with equal probability Mother Aa Father Aa 50% A 50% a 50% A 25%AA 25%Aa 50% a 25%Aa 25%aa Principles of Mendelian analysis - Second law -The principle of independent segregation applies independently to gene pairs determining different traits - Alleles from unlinked loci are assorted independently Aa Bb 50% A 50% a 50% B 25%AB 25%aB 50% b 25%Ab 25%ab Alleles from unlinked loci segregate independently Alleles from linked loci do not segregate independently Some points to note • A child always inherits one copy of each chromosome from each of the parents (meiosis, Mendel’s fist law) • Any deviation from this can be pathogenic, e.g. Turner syndrome (only one X) and Downs syndrome (3 copies of chr 21) • A girl has two X chromosomes (one from each parent), a boy one X and one Y chromosome (X from mother, Y from father) – implications for X-linked diseases • Each chromosome is inherited independently of the other one, which copy of a parents chromosomes the child inherits is thus random (Mendel’s second law) Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Recombination of parental chromosomes - a source of variation & essential for looking at genetic distances & mapping disease Recombination pattern in a family Maternal grandparents Parental grandparents Father Mother Child Some points on recombinations • Recombinations happen only during meiosis (during the generation of egg- or spermcells). • Recombinations occur in each generation, usually at least once per chromosome • Recombinations are in theory random, but in principle the likelyhood of recombinations at a particular point in the genome is quite variable • Almost no recombination at the centrimere, higher frequency of recombinations closer to the telomeres Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Physical distance - Mb Physical maps can be divided into three general types: chromosomal or cytogenetic maps, radiation hybrid maps, and sequence maps. • The lowest-resolution physical map is the chromosomal map, based on the banding patterns observed by microscopy of stained chromosomes. • More detailed radiation hybrid maps are made by breaking the chromosomes into small pieces. If two markers map to the same small fragment they are likely to be close together. • The highest-resolution physical map is the complete sequencing of each chromosome in the genome Physical maps at NCBI Genetic distance - cM Centimorgan (cM): a unit of chromosome length, equals the length of chromosome over which crossing-over occurs with 1 per cent frequency A a B b A b Recombination between locus A and locus B If 1% of meiosis result in recombinant chromosomes => 1cM between A and B Genetic maps at NCBI Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes Uses for genetics Mapping disease Genetic tests for known diseases Microbial genomics Forensics Paternity tests Development of medicines - pharmacogenomics Breeding of animals and plants Phylogenic studies & evolution Human Genome Project Aims: To generate a high-quality reference DNA sequence for the human genome‘s 3 billion base pairs and to identify all human genes. Also to sequence the genomes of model organisms to interpret human DNA, enhance computational resources to support future research and commercial applications, explore gene function through mouse-human comparisons, study human variation, and train future scientists in genomics. Founding partners: U.S. Department of Energy National Institutes of Health (NIH) Wellcome Trust As well as groups in Japan, France, Germany, and China After the Human Genome Project •The human genome consists of 3 billion bases (A, C, T, and G). •The function of 50% of known genes is unknown. •The human genome sequence is almost (99.9%) exactly the same in all people. • A human genome is 97% like a chimp genome, 75% of the mouse genome •Over 40% of the predicted human proteins share similarity with fruit-fly or worm proteins. •Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231). The future of genetics? The human genome is like a book where each letter has been read, but there are no chapters or page numbers so you don’t really know what it all means or what to make of it....