* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Brooker Chapter 16
Mitochondrial DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Primary transcript wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genetic code wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenomics wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Population genetics wikipedia , lookup
Molecular cloning wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Genome evolution wikipedia , lookup
Genome (book) wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Koinophilia wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Designer baby wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Microsatellite wikipedia , lookup
Oncogenomics wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Frameshift mutation wikipedia , lookup
LECTURE 5 Gene Mutation (Chapter 16.1-16.2) Slides 1-37 On your own: Slides 38-45 1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. INTRODUCTION • The term mutation refers to a heritable change in the genetic material • Mutations provide allelic variations – On the positive side, mutations are the foundation for evolutionary change needed for a species to adapt to changes in the environment – On the negative side, new mutations are much more likely to be harmful than beneficial to the individual and often are the cause of diseases • Understanding the molecular nature of mutations is a deeply compelling area of research. • Since mutations can be quite harmful, organisms have developed ways to repair damaged DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 2 16.1 CONSEQUENCES OF MUTATIONS • Mutations can be divided into three main types – 1. Chromosome mutations • Changes in chromosome structure – 2. Genome mutations • Changes in chromosome number – 3. Gene mutations • Relatively small change in DNA structure that affects a single gene – Type 3 will be discussed in this chapter 3 Gene Mutations Change the Sequence DNA A point mutation is a change in a single base pair It can involve a base substitution 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’ A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine A transversion is a change of a pyrimidine to a purine or vice versa Transitions are more common than transversions Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 4 Gene Mutations Change the Sequence DNA Mutations may also involve the addition or deletion of short sequences of DNA 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCTC 3’ 3’ TTGCGAG 5’ Deletion of four base pairs 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’ Addition of four base pairs Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 5 Gene Mutations Can Alter the Coding Sequence Within a Gene Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide Due to the degeneracy of the genetic code Missense mutations are those base substitutions in which an amino acid change does occur Example: Sickle-cell anemia (Refer to Figure 16.1) If the substituted amino acid has no detectable effect on protein function, the mutation is said to be neutral. This can occur if the new amino acid has similar chemistry to the amino acid it replaced Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 6 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. © Phototake/Alamy Normal red blood cells © Phototake/Alamy 10 μm Sickled red blood cells 10 μm (a) Micrographs of red blood cells NORMAL : NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID... SICKLE : NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID... CELL (b) A comparison of the amino acid sequence between normal b-globin and sickle-cell b-globin Figure 16.1 7 Gene Mutations Can Alter the Coding Sequence Within a Gene Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Nonsense mutations are those base substitutions that change a normal codon to a stop codon Frameshift mutations involve the addition or deletion of a number of nucleotides that is not divisible by three This shifts the reading frame so that translation of the mRNA results in a completely different amino acid sequence downstream of the mutation Table 16.1 describes all of the above mutations Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 8 9 Gene Mutations outside of coding sequences can still affect phenotype Mutations in the core promoter can change levels of gene expression Up mutations increase expression. Down mutations decrease expression Other important non-coding mutations are in Table 16.2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 10 Gene Mutations and Their Effects on Genotype and Phenotype In a natural population, the wild-type is the relatively prevalent genotype. Genes with multiple alleles may have two or more wild-types. A forward mutation changes the wild-type genotype into some new variation A reverse mutation changes a mutant allele back to the wild-type It is also termed a reversion Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 11 Mutations can also be described based on their effects on the wild-type phenotype They are often characterized by their differential ability to survive Deleterious mutations decrease the chances of survival The most extreme are lethal mutations Beneficial mutations enhance the survival or reproductive success of an organism The environment can affect whether a given mutation is deleterious or beneficial Some mutations are conditional They affect the phenotype only under a defined set of conditions An example is a temperature-sensitive mutation Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 12 13 Changes in Chromosome Structure Can Affect Gene Expression A chromosomal rearrangement may affect a gene because the chromosomal breakpoint occurs within the gene A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect There are two common reasons for position effects: 1. Movement to a position next to regulatory sequences Refer to Figure 16.2a 2. Movement to a heterochromatic region Refer to Figure 16.2b AND 16.3 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 14 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. B A Coding sequence Core promoter B Gene B A Regulatory sequence Coding sequence Core promoter Regulatory sequences are often bidirectional Inversion Core promoter for gene A is moved next to regulatory sequence of gene B. Gene A (a) Position effect due to regulatory sequences Active gene Gene is now inactive. Translocation Heterochromatic chromosome (more compacted) Euchromatic chromosome Translocated heterochromatic chromosome Shortened euchromatic chromosome (b) Position effect due to translocation to a heterochromatic chromosome Figure 16.2 15 Mutations Can Occur in Germ-Line or Somatic Cells Geneticists classify animal cells into two types Germ-line cells Somatic cells All other cells Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells Cells that give rise to gametes such as eggs and sperm Refer to Figure 16.4a Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells Refer to Figure 16.4b AND 16.5 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Germ-line mutation Gametes Embryo Somatic mutation The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch Therefore, the mutation can be passed on to future generations Mutation is found throughout the entire body. Mature individual An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations Half of the gametes carry the mutation. Figure 16.4 Patch of affected area (a) Germ-line mutation None of the gametes carry the mutation. (b) Somatic cell mutation 17 18 16.2 OCCURRENCE AND CAUSES OF MUTATION • Mutations can occur spontaneously or be induced • Spontaneous mutations – Result from abnormalities in cellular/biological processes • Errors in DNA replication, for example – Underlying cause originates within the cell • Induced mutations – Caused by environmental agents – Agents that are known to alter DNA structure are termed mutagens • These can be chemical or physical agents • Refer to Table 16.4 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 19 20 Spontaneous Mutations Are Random Events Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked themselves for a long time Jean Baptiste Lamarck: Physiological adaptation theory Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring Charles Darwin: Random mutation theory Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms 21 Random Mutations Can Give an Organism a Survival Advantage Joshua and Ester Lederberg(1950s) devised an ingenious way to test these alterative theories experimentally Studied the resistance of E. coli to infection by bacteriophage T1 tonr (T one resistance) Hypothesis: E. coli cells that survive T1 infection were already resistant to the phage prior to exposure Due to random mutations "Replica plating" 22 The Lederbergs' experiment: A few tonr colonies were observed at the same location on both plates!!! This indicates that mutations conferring tonr occurred randomly on the primary (nonselective plate) The presence of T1 in the secondary plates simply selected for previously occurring tonr mutants This supports the random mutation theory Figure 16.7 Replica plating Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Master plate containing many colonies that were grown in the absence of T1 phage A velvet cloth (wrapped over a cylinder) is pressed gently onto the master plate and then lifted. A little bit of each bacterial colony adheres to the velvet cloth, thereby creating a replica of the arrangement of colonies on the master plate. Velvet cloth The replica is then gently pressed onto 2 secondary plates that contain T1 phage. Petri plate with T1 phage Petri plate with T1 phage Incubate overnight to allow bacterial growth. 23 Mutation Rate The term mutation rate is the likelihood that a gene will be altered by a new mutation The mutation rate for a given gene is not constant It is commonly expressed as the number of new mutations in a given gene per cell generation It is in the range of 10-5 to 10-9 per generation It can be increased by the presence of mutagens Mutation rates vary substantially between species and even within different strains of the same species 24 Mutation Rates and Frequencies Within the same individual, some genes mutate at a much higher rate than other genes Some genes are larger than others Some genes have locations within the chromosome that make them more susceptible to mutation This provides a greater chance for mutation These are termed hot spots Note: Hot spots can be also found within a single gene Specific bases or regions that are more likely to be the site of a mutation within a gene 25 Causes of Spontaneous Mutations Spontaneous mutations can arise by three types of chemical changes 1. Depurination 2. Deamination 3. Tautomeric shift The most common; We will focus here Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 26 Causes of Spontaneous Mutations Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine base is somewhat unstable It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar This is termed an apurinic site Fortunately, apurinic sites can be repaired However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 27 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 3′ 5′ C G A T T A C G G C C G A T T A C G C Depurination 5′ 3′ 3′ Apurinic site 3′ 5′ 5′ 3′ (a) Depurination 3′ 5′ C G A T T A C G C 3′ DNA replication 3′ 5′ 5 3′ C G A T T A X G C 5′ (b) Replication over an apurinic site Figure 16.8 Three out of four (A, T and G) are the incorrect nucleotide C G A T T A C G G C 3′ Spontaneous depurination There’s a 75% chance of a mutation X could be A, T, G, or C 5′ 28 Mutations Due to Trinucleotide Repeats Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) These diseases include The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next Huntington disease (HD) Fragile X syndrome (FRAXA) Refer to Table 16.5 for these and other examples Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 29 30 Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted from parent to offspring without mutation However, in persons with TNRE disorders, the length of a trinucleotide repeat has increased above a certain critical size Disease symptoms occur In some diseases, it also becomes prone to expansion This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 18 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 31 In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease In other cases, the expansions are located in noncoding regions of genes Some of these expansions are hypothesized to cause abnormal changes in RNA structure Some produce methylated CpG islands which may silence the gene Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 32 There are two particularly unusual features that some TNRE disorders have in common 1. The severity of the disease tends to worsen in future generations This phenomenon is called anticipation 2. Anticipation usually depends on whether the disease is inherited from the father or mother In Huntington disease, the TNRE is more likely to occur if inherited from the father In myotonic muscular dystrophy, the TNRE is more likely to occur if inherited from the mother This suggests that TNRE can occur more frequently during oogenesis or spermatogenesis, depending on the gene involved. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 33 The “DNA” cause of TNRE is not fully understood TNREs contain at least one C and one G This allows formation of a hairpin During DNA replication, a hairpin can lead to an increase or decrease in the length of the DNA Polymerase can slip off DNA Hairpin forms and pulls strand back DNA polymerase hops back on See Figure 16.12 for details These changes can occur during gamete formation Begins synthesis from new location offspring will have very different numbers of repeats Can also increase repeats in somatic cells This can increase severity of the disease with age Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 34 Mechanisms of trinucleotide repeat expansion or deletion One DNA template strand prior to DNA replication One DNA template strand prior to DNA replication TNRE TNRE DNA replication begins and goes just past the TNRE. Hairpin forms in template strand prior to DNA replication. DNA polymerase DNA polymerase slips off the template strand and a hairpin forms. DNA replication occurs and DNA polymerase slips over the hairpin. DNA polymerase resumes DNA replication. DNA repair occurs. DNA repair occurs. TNRE is longer. TNRE is shorter. OR TNRE is the same length. (b) Mechanism of trinucleotide repeat expansion OR TNRE is the same length. (c) Mechanism of trinucleotide repeat deletion Figure 16.12b and c Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 35 Types of Mutagens An enormous array of agents can act as mutagens that permanently alter the structure of DNA The public is concerned about mutagens for two main reasons: 1. Mutagens are often involved in the development of human cancers 2. Mutagens can cause gene mutations that may have harmful effects in future generations Mutagenic agents are usually classified as chemical or physical mutagens Refer to Table 16.6 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 36 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 37 Mutagens Alter DNA Structure in Different Ways Chemical mutagens come into three main types 1. Base modifiers 2. Intercalating agents 3. Base analogues Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 38 Base modifiers covalently modify the structure of a nucleotide For example, nitrous acid, replaces amino groups with keto groups (–NH2 to =O) This can change cytosine to uracil and adenine to hypoxanthine These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication Refer to Figure 16.15 Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA Examples: Nitrogen mustards and ethyl methanesulfonate (EMS) Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 39 Template strand H After replication H NH2 O N H N N H HNO2 N N N Sugar O Sugar H Cytosine N N H Sugar N O H Uracil These mispairings create mutations in the newly replicated strand Adenine H N H N H NH2 O H H N HNO2 N N Sugar N Sugar N N H H N N H Adenine N H Hypoxanthine O Sugar Cytosine Figure 16.15 Mispairing of modified bases Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 40 Intercalating agents contain flat planar structures that intercalate themselves into the double helix This distorts the helical structure When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions resulting in frameshifts Examples: Acridine dyes Proflavin Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 41 Base analogues become incorporated into daughter strands during DNA replication For example, 5-bromouracil is a thymine analogue It can be incorporated into DNA instead of thymine Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. H O Br N H H N O 5-bromouracil (keto form) O N N Sugar Sugar H H H N O O This tautomeric shift occurs at a relatively high rate H H N N N 5-bromouracil (enol form) Adenine Normal pairing Figure 16.16 Br H N N N Sugar N N Sugar N H Guanine Mispairing (a) Base pairing of 5BU with adenine or guanine Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 42 In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 5′ 3′ A 5BU 3′ 3′ A T DNA replication 3′ 5′ 5′ 5′ 5′ 3′ G 5BU 3′ 5′ 3′ G C DNA replication 3′ 5′ 5′ 3′ G or A 5BU 3′ 5′ (b) How 5BU causes a mutation in a base pair during DNA replication Figure 16.16 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 43 Physical mutagens come into two main types 1. Ionizing radiation 2. Nonionizing radiation Ionizing radiation Includes X-rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free radicals Can cause Base deletions Oxidized bases Single nicks in DNA strands Cross-linking Chromosomal breaks Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 44 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. H O Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply into biological molecules Causes the formation of cross-linked thymine dimers Thymine dimers may cause mutations when that DNA strand is replicated O P O CH2 O– H H H N CH3 H H Thymine CH3 O O P O CH2 O– H H O O H H N N H H O Thymine H Ultraviolet light O O P O O H O CH2 O– H H N O O O H H N H CH3 H H CH3 O O P O CH2 O– Figure 16.17 N O H H H O O H H Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display N H N H O Thymine dimer 45 BIO 184, Exam 2, Spring 2012 35 30 25 20 15 10 5 0 A B C D F 46 Animations 47 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer. 48