* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 11 Molecular Diagnostics
Genomic imprinting wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Designer baby wikipedia , lookup
Genetic drift wikipedia , lookup
X-inactivation wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Population genetics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Point mutation wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Molecular cloning wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
SNP genotyping wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microsatellite wikipedia , lookup
Molecular Diagnostics DNA Polymorphisms and Human Identification 1 Molecular Diagnostics 2 Polymorphism A DNA polymorphism is a sequence difference compared to a reference standard that is present in at least 1–2% of a population. Polymorphisms can be single bases or thousands of bases. Polymorphisms may or may not have phenotypic effects. 3 Molecular Diagnostics Polymorphic DNA Sequences Polymorphisms are found throughout the genome. If the location of a polymorphic sequence is known, it can serve as a landmark or marker for locating other genes or genetics regions. Each polymorphic marker has different versions or alleles. 4 Molecular Diagnostics Types of Useful Polymorphisms and Laboratory Methods 5 Molecular Diagnostics RFLP Typing Restriction fragment sizes are altered by changes in or between enzyme recognition sites. 6 Molecular Diagnostics RFLP Typing The presence of RFLP is inferred from changes in fragment sizes. 7 Molecular Diagnostics RFLP Typing 8 Molecular Diagnostics RFLP and Parentage Testing RFLP genotypes are inherited. For each locus, one allele is inherited from each parent. Southern blot band patterns 9 Molecular Diagnostics RFLP and Parentage Testing Who is the alleged father? Of the two alleged fathers shown, only one could supply the fragments not supplied by the mother. 10 Molecular Diagnostics Evidence Testing by RFLP Which suspect—S1 or S2—was at the crime scene? (V = victim, E = crime scene evidence, M = molecular weight standard) M S1 S2 V E M M S1 S2 V E M M S1 S2 V E M Locus 1 Locus 2 Locus 3 11 Molecular Diagnostics Short Tandem Repeat Polymorphisms (STR) STR are repeats of nucleotide sequences. AAAAAA… - mononucleotide ATATAT… - dinucleotide TAGTAGTAG… - trinucleotide TAGTTAGTTAGT… - tetranucleotide TAGGCTAGGCTAGGC… - pentanucleotide Different alleles contain different numbers of repeats. TTCTTCTTCTTC - four repeat allele TTCTTCTTCTTCTTC - five repeat allele 12 Molecular Diagnostics Short Tandem Repeat Polymorphisms STR alleles can be analyzed by fragment size (Southern blot). One repeat unit Restriction site Allele 1 GTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCT GCTGGGCCGTGG CAAGATCG CCGGCACCG TCGATCGATCGATCGA CGACCCGGCACC tandem repeat Allele 2 GTTCTAGCGGCCGTGGCAGCTAGCTAGCT GCTGGGCCGTGG CAAGATCG CCGGCACCG TCGATCGATCGA CGACCCGGCACC Allele M 1 2 M 13 Molecular Diagnostics Short Tandem Repeat Polymorphisms STR alleles can also be analyzed by amplicon size (PCR). 14 Molecular Diagnostics Short Tandem Repeat Polymorphisms Allelic ladders are standards representing all alleles observed in a population. 11 repeats (Allelic ladder) 5 repeats Genotype: 7,9 Genotype: 6,8 15 Molecular Diagnostics Short Tandem Repeat Polymorphisms Multiple loci are genotyped in the same reaction using multiplex PCR. Allelic ladders must not overlap in the same reaction. 16 Molecular Diagnostics Short Tandem Repeat Polymorphisms by Multiplex PCR FGA PentaE TPOX D18S51 D2S11 D8S1179 THO1 vWA D3S1358 STR Nomenclature The International Society for Forensic Genetics recommended nomenclature for STR loci in 1997: STRs within genes are designated according to the gene name (no phenotypic effect with respect to these genes): TH01 is in intron 1 of the human tyrosine hydroxylase gene on chromosome 11 Non–gene associated STRs are designated by the D#S# system: D stands for DNA The following number designates the chromosome where the STR is located (1-22, X or Y). S refers to a unique segment, followed by a number registered in the International Genome Database (GDB). 18 Molecular Diagnostics Gender Identification: Amelogenin Locus, HUMAMEL The amelogenin locus is not an STR (but along with STR). The HUMAMEL gene codes for amelogenin-like protein. located on the X (Xp22.1–22.3) and Y chromosomes required for embryonic development and tooth maturation Polymorphism is located in the second intron of the amelogenin gene: X allele = 212 bp Y allele = 218 bp (longer) Males (X, Y) Heterozygous (2 bands) Females (X, X) Homozygous (1 band) 19 Molecular Diagnostics Analysis of STR PCR Test Results: STR genotypes are analyzed using gel or capillary gel electrophoresis. 11 repeats 11 repeats 5 repeats 5 repeats (Allelic ladder) Genotype: 7,9 Identity testing by STR-PCR A matching genotype is not necessarily an absolute determination of identity of an individual. Genetic concordance: is a term used where all locus genotypes (alleles) from two sources are the same. Concordance is interpreted as inclusion of a single individual as the donor of both genotypes. Two samples are considered different if at least one locus A microvariant allele (15.2) migrates genotype differs (exclusion). between the full-length alleles 21 Molecular Diagnostics Parentage Testing by STR-PCR Which alleged father’s Child and parent are not necessarily in complete Genetic genotype has the paternal alleles? concordance Mutational events may generate a new allele in the offspring, and this difference may not rule out paternity. Child Mother Father Locus D3S1358 vWA FGA TH01 TPOX CSF1PO D5S818 D13S317 Child 16/17 14/18 21/24 6 10/11 11/12 11/13 9/12 Mother 16 16/18 20/21 6/9.3 10/11 12 10/11 9 1 17 14/15 24 6/9 8/11 11 13 12/13 2 17 16/17 24 6/7 8/9 11/13 9/13 11/12 22 Molecular Diagnostics Short Tandem Repeat Polymorphisms: Y-STR The Y chromosome is inherited in a block without recombination (Y chromosome cannot exchange information) STR on the Y chromosome are inherited paternally as a haplotype. Series of linked alleles always inherited together Thus, marker alleles on the Y chromosome are inherited from generation to generation in a single block. Y haplotypes are used for exclusion and paternal lineage analysis. Except for rare mutation events, every male member of a family (brothers, uncles, cousins, and grandparents) will have the same Y-chromosome haplotype. Engraftment Testing Using DNA Polymorphisms Recipient receives Allogeneic donor and recipient immune compatibility is tested prior to the transplant by HLA typing. Sequence polymorphisms (alleles) in the HLA locus are compared with those of the recipient to determine which donor would be most tolerated by the recipient immune system. Donors may be known or related to the patient or anonymous unrelated contributors (matched unrelated donor). his or her own purged cells Recipient receives donor cells A recipient with donor marrow is a chimera. 24 Molecular Diagnostics Chimerism Testing Using STR There are two parts to chimerism testing: pretransplant informative analysis and posttransplant engraftment analysis donor cells can be monitored by following donor polymorphisms in the recipient blood and bone marrow Before transplant Donor Recipient After transplant Complete (Full) Mixed Graft failure 25 Molecular Diagnostics Chimerism Testing Using STR: Informative Analysis STR are scanned to find informative loci (donor alleles differ from recipient alleles). Noninformative loci: the donor and the recipient have the same alleles. Donor-informative loci: donor and recipient share one allele, and the donor has a unique allele. Recipient informative loci: the unique allele is in the recipient Full chimerism: only the donor alleles are detected in the recipient Mixed chimerism: a mixture of donor and recipient alleles are present Graft failure: only recipient alleles are detectable 26 Molecular Diagnostics Which loci are informative? GF: graft failure MC: mixed chimerism FC: full chimerism vWA TH01 Amel TPOX CSF1PO 27 Molecular Diagnostics Chimerism Testing Using STR: Engraftment Analysis Using informative loci, peak areas are determined in fluorescence units or from densitometry scans of gel bands. A(R) = area under recipient-specific peaks A(D) = area under donor-specific peaks A(R) + A(D) A(D) A(R) % Recipient DNA = A(R) A(R) + A(D) × 100 % Recipient DNA = A(R) A(R) + A(D) × 100 28 Molecular Diagnostics Chimerism Analysis of Cellular Subsets Cell subsets (T cells, granulocytes, NK cells, etc.) engraft with different kinetics. Analysis of cellular subsets provides a more detailed description of the engrafting cell population. Analysis of cellular subsets also increases the sensitivity of the engraftment assay. 29 Molecular Diagnostics Chimerism Analysis of Cellular Subsets T cells (CD3), NK cells (CD56), granulocytes, myeloid cells (CD13, CD33), myelomonocytic cells (CD14), B cells (CD19), stem cells (CD34) Methods Flow cytometric sorting Immunomagnetic cell sorting Immunohistochemistry + XY FISH 30 Molecular Diagnostics Chimerism Analysis of Cellular Subsets Detection of different levels of engraftment in cellular subsets is split chimerism. R D T R = Recipient alleles D = Donor alleles T = T-cell subset (mostly recipient) G = Granulocyte subset (mostly donor) G 31 Molecular Diagnostics Single Nucleotide Polymorphisms (SNP) Single-nucleotide differences between DNA sequences. One SNP occurs approximately every 1,250 base pairs in human DNA. SNPs are detected by sequencing, melt curve analysis, or other methods. 99% have no biological effect; 60,000 are within genes. 32 Molecular Diagnostics SNP Detection by Sequencing T/T 5′ AGTCTG T/A 5′ AG(T/A)CTG A/A 5′ AGACTG 33 Molecular Diagnostics SNP Haplotypes SNPs are inherited in blocks or haplotypes. Sections of DNA along chromosomes can be inherited as a unit or block of sequence No recombination occurs within the block. All the SNPs on that block comprise a haplotype. SNPs can be used for mapping genes, human identification, chimerism analysis, and many other applications.