* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Todd Eckdahl - Davidson College
Gene therapy of the human retina wikipedia , lookup
Genomic library wikipedia , lookup
Clinical neurochemistry wikipedia , lookup
Gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Gene nomenclature wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Non-coding DNA wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Community fingerprinting wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gene expression profiling wikipedia , lookup
Polyadenylation wikipedia , lookup
Expression vector wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Gene regulatory network wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
RNA interference wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Epitranscriptome wikipedia , lookup
RNA silencing wikipedia , lookup
Using DNA Microarrays from Multiple Species: Comparisons for Teaching Effectiveness Todd T. Eckdahl Biology Department Missouri Western State College Overview Background Courses using microarray technology Species studied Implementation Results Planned research projects Missouri Western State College Saint Joseph, Missouri State-supported PUI ~5200 students 200 faculty Biology Department ~340 majors 10 faculty No graduate degree programs New major in Biochemistry and Molecular Biology Courses Using Microarray Technology BIO 431 Molecular Biology 4 credit course 3 hours lecture, 3 hours lab Student majors BMB, Biology with Health Sciences emphasis BIO 313 Topics in Molecular Genetics 1 credit course 3 hours lab Student majors BMB, Biology-Health Sciences, Teaching Functional Genomics Technology Microarrays cDNAs printed eg. Stanford yeast chips, UW E. coli chips 80-mer oligos printed eg. ISB yeast chips Labeling options Indirect labeling eg. Genisphere dendrimers Direct incorporation eg. Ulysis alexafluore labeling Conducting Microarray Experiments in a Course Emphasize the “Big Picture” Genomics, functional genomics, proteomics Shift to data-rich science Primary Literature Brainstorming for ideas Scheduling Data Analysis Presentations Ideas for Yeast Experiments Glucose vs. Galactose vs. Fructose vs. Maltose Anaerobic vs. aerobic Induction of sporulation Heat Shock v. Cold Shock Drug treatment Minor Groove Binding Drugs Anti-tumor properties Conformational change in the 3D structure of DNA Prior Knowledge of MGBD/DNA interaction As models for minor groove binding proteins DAPI Yeast Culture OD at 660 nm to measure turbidity Grown through log phase 4 hours of exposure to 10 uM DAPI Control culture without DAPI Isolation of RNA Sterile, RNase- free equipment and workspace Harvesting of yeast Production of spheroblasts Isolation of RNA via RNA spin column Elution of RNA Quantify RNA with A260 / A280 Run RNA on denaturing agarose Preparation of labeled cDNA and hybridization Reverse transcription of RNA capture sequence incorporated Label preparation addition of Cy3 and Cy5 dendrimer addition of capturing reagents Add probe to slide, cover and incubate at 55 C for 1-3 days Experimental Summary Yeast in log phase untreated 10 uM DAPI Total RNA Total RNA Reverse Txn cDNA cDNA Red fluorophore Green fluorophore microarray hybridization Data Acquisition Post-hybe wash, dry slide Ship for scanning Receive data Scanalyze Submit to SMD Microarray Controls Empty or 3X SSC Duplicate genes Duplicate experiments Cy3 and Cy5 dyes Poly A Genomic, Intron, tRNA Example of induced gene YBR012W-B, TyB Gag-Pol protein TGAGAAGCTGTCATCGAAGTTAGAGGAAGCTGAAGTGCAAGGATTGATAA TGTAATAGGATAATGAAACATATAAAACGGAATGAGGAATAATCGCAATA TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAG GAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA ATG Example of repressed gene YHR055C, copper-binding metallothionein TTCCGCTGAACCGTTCCAGCAAAAAAGACTACCAACGCAATATGGATTGT CAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGC ATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATA GATATTAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAA ATG Analyses at Stanford Microarray Database Single spot or sequence Data filtering signal strength R/G or G/R ratio Linear regression comparison Prepare data for clustering Databases linked to SMD SGD - Saccharomyces genome database Genbank YPD - yeast protein database Swissprot protein database Ideas for E. coli Experiments Metabolic shift Osmotic stress Growth curve effects Heat Shock v. Cold Shock Drug treatment Effects of gene deletion BIO 313 Experiment E coli chips M1655 sequenced strain cDNA spotted Putative transcriptional regulators nusA deletion strain yhbM deletion strain Two channel hybridizations Compare labeled RNA from wt versus deletion E. coli culture Overnight culture Grown at 37°C to log phase OD at 600 nm to measure turbidity RNA Isolation Sterile, RNase-free equipment and work area Total RNA SafeKit Total RNA Safe protocol used Lysis of E. coli done with mixture of TE and lysozyme RNA Isolates Measure A260 / A280 Check on denaturing agarose gel Labeling Labeling of isolated RNA done by use of ULYSIS Nucleic Acid Direct Labeling Kit ULYSIS protocol followed Fluorescent Dyes: Alexa Fluor 546 (green) and Alexa Fluor 660 (red) Hybridization Microarray prehybridized Labeled RNA mixed together in hybridization buffer and added to slide Hyb at 55 C in dry incubator overnight Post-hyb washes Microarray Controls Empty or 3X SSC Duplicate genes Duplicate experiments Cy3 and Cy5 dyes Genomic Examples of Results asr flhC emrY Examples Induced Asr, G1787881 acid shock protein Repressed flhC, G1788201 regulator of flagellar biosynthesis acting on class 2 operons Non-responsive emrY, G1788710 multidrug resistance protein Y putative transport Example of induced gene Asr, G1787881 gatca agactactattattggtagctaaatttcccttaagtcac aatacgttattatcaacgctgtaatttattcagcgtttg tacatatcgttacacgctgaaaccaaccactcacggaag tctgccattcccagggatatagttatttcaacggccccg cagtggggttaaatgaaaaaacaaattgagggtatgaca 1 - atg aaa aaa gta tta gct ctg gtt gtt gcc 31 - gct gct atg ggt ctg tct tct gcc gcc ttt 61 - gct gca gag act acg acc aca cct gct ccg 91 - act gcg acg acc acc aaa gca gcg ccg gcg Example of repressed gene flhC, G1788201 ccgca aatggttaagctggcagaaaccaatcaactggtttgtca cttccgttttgacagccaccagacgattactcagttgac gcaagattcccgcgttgacgatctccagcaaattcatac cggcatcatgctctcaacacgcttgctgaatgatgttaa tcagcctgaagaagcgctgcgcaagaaaagggcctgatc 1 - atg agt gaa aaa agc att gtt cag gaa gcg 31 - cgg gat att cag ctg gca atg gaa ttg atc 61 - acc ctg ggc gct cgt ttg cag atg ctg gaa 91 - agc gaa aca cag tta agt cgc gga cgc ctg Example of non-responsive gene emrY, G1788710 gaact catggaacaccccttgcgtattggtttatcgatgacagc aactattgatacgaagaacgaagacattgccgagatgcc tgagctggcttcaaccgtgacctccatgccggcttatac cagtaaggctttagttatcgataccagtccgatagaaaa agaaattagcaacattatttcgcataatggacaacttta 1 - atg gca atc act aaa tca act ccg gca cca 31 - tta acc ggt ggg acg tta tgg tgc gtc act 61 - att gca ttg tca tta gcg aca ttt atg caa 91 - atg ttg gat tcc act att tct aac gtc gca Microarrays in Courses: Lessons Learned Advance planning essential Controls for critical steps Reliability and Reproducibility Do Controls Make Sense? Do Results Make Sense? Potential for large amounts of data means extensive analysis time needed Ongoing and Planned Research Projects Measure Effects of Minor Groove Binding Drugs on Gene Expression in Yeast Measure Effects of Minor Groove Binding Drugs on Gene Expression in Human Tumor Cells in Culture Big Ideas Sequence and structural requirements for MGBD binding A+T rich sequences DNA bending Determination of optimal binding sites Effects of MGBDs on gene expression Preliminary data using RT-PCR Global patterns of gene expression Complementary in vitro and in vivo approaches Acknowledgements Genome Consortium for Active Teaching Malcolm Campbell, Davidson College NSF DBI 0099720 MUE grant Dr. Barbara Dunn, Stanford University Dr. Fred Blattner lab, UW-Madison Dr. Bob Getts, Genisphere, Inc. Missouri Western Students