* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Lect2 Genetics
Eukaryotic transcription wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA barcoding wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genome evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Silencer (genetics) wikipedia , lookup
DNA sequencing wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Gene expression wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Community fingerprinting wikipedia , lookup
Holliday junction wikipedia , lookup
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular evolution wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Biosynthesis wikipedia , lookup
DNA supercoil wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genetics Nicky Mulder Life as we know it is specified by genomes They hold all the necessary info to grow and function Copyright-Anna Kramvis 2 Genomes Prokaryotes Eukaryotes History of genetics 1953 Watson and Crick discover structure of the DNA double helix Mendel’s genetics Studied inheritance of seed change –characterized dominant and recessive phenotypes Some genetics concepts Diploid –two copies of each chromosome Two copies of each gene (allelles), if the same then homozygous, if different – heterozygous Alleles can be wild type or mutant Interactions between alleles can be dominant or recessive Central Dogma DNA Genomes RNA Protein RNA genomes Some viral genomes are RNA Retrotranscribed into DNA DNA genomes Prokaryotes Composed of nucleic acids Eukaryotes Nucleic Acids -DNA Deoxyribonucleic acid Nuclear material, found in nucleus Double stranded Sugar: 2’-deoxyribose Nucleotides Adenine (A) Cytosine (C) Guanine (G) Thymine (T) Copyright-Anna Kramvis 11 Nucleic Acids -RNA Ribonucleic acid Genome of some viruses Found in cytoplasm Single stranded Sugar: ribose Nucleotides Adenine (A) Cytosine (C) Guanine (G) Uracil (U) Nucleotides purine phosphate OOO5’ γ β α O- P O- P O- P O CH2 O O O 4’C H H 3’ C pyrimidine base O H C1’ X H C 2’OH OH H deoxyribonucleotides Ribonucleotides –extra OH sugar Bases Copyright-Anna Kramvis 14 From nucleotide to ssDNA Sense strand = mRNA http://haplogroup-i.com/img/DNA2.gif Copyright-Anna Kramvis 15 Base pairing Hydrogen bonds AT –weaker bond (2 versus 3 for GC) www.mun.ca Copyright-Anna Kramvis 16 Representation of sequences String of letters (ACGT) usually written 5’3’ 5’-ATGCGTGGCCTAAACGTTCAGGTCGA-3’ 3’-TACGCACCGGATTTGCAAGTCCAGCT-5’ Reverse complement = reverse strand written 5’ to 3’ Sequence formats: Fasta > [title] [sequence] >example sequence GGAAAATTAGATGCATGGGAAAAAATTA GGATTAGACAAGATGGGAAACCGCATTA Sequence formats: GenBank LOCUS 525-42 1588 bp DEFINITION 525-42 1588 bp TITLE 525-42 FEATURES Location/Qualifiers exon 39..70 /note="exon1 is believed to have an alternative splice donor site" ORIGIN 1 51 101 151 ATGTT AGGGG AGCTG TGTAA AAGAG GAAAG GAAAG ACAAA GGGGA AAATG ATTTG TAATG AAATT CTATA CACTT NAACA AGATG NGATA AACCC GATAC CATGG AAACA TGGCC AACCA GAAAA CCTAG TTTTA GCTCT AATTA TATGG GAGAC TCAGA GGTTA GCAAG ATCAG CAGGA AGGCC CAGGG ANGGC ACAGA DNA structure continued Base pairs stack into a helix Alternating sugars and phosphates form backbone www.dkimages.com Double helix DNA supercoiling DNA denaturation Unwinding of the strands and breaking of base pairs Achieved by heat Denaturation temperature depends on AT/GC content Required for replication, transcription, etc. DNA can also be degraded by exonucleases Central dogma of molecular biology http://www.cem.msu.edu/~reusch/VirtualText/nucacids.htm Copyright-Anna Kramvis 24 DNA replication DNA polymerase can only extend 5’ to 3’. Leading strand is generated normally, lagging strand goes opposite way so is done in ‘Okazaki’ fragments cellbiology.med.unsw.edu.au Copyright-Anna Kramvis 25 DNA repair and recombination DNA polymerases can make mistakes -> mutations DNA repair mechanisms Recombination can occur –cutting out and insertion of pieces of DNA These can all leads to changes in genetic material and thus changes in phenotype! Base pairing exercise 1.Determine the complementary strand for the following sequences: •5’ATGCCATTAGCTTAGCATTGGAAAGTCATGCCATG3’ •5’CATCGGTAACTAGCTAATGGCCTACTGCCATGCCT3’ 2. Determine the reverse complement of the strands above. 3. Transcribe the above sequences into RNA. 4. Work out the percent GC content. Which strand will have stronger bonding between the two strands? Copyright-Anna Kramvis 27 Additional questions Which of these sequences will have the higher denaturation temperature? 1) ATATCATATGATATGTA 2) CGGTACTCGCTCAGGT The base composition of a sequence was determined, there are 20% adenines, what is the % cytosine?