* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DUAL TRAFFICKING PATHWAYS OF CONNEXINS TO GAP …
Copy-number variation wikipedia , lookup
Genomic imprinting wikipedia , lookup
Gene therapy wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene nomenclature wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene desert wikipedia , lookup
Non-coding DNA wikipedia , lookup
Public health genomics wikipedia , lookup
Oncogenomics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Human genome wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Point mutation wikipedia , lookup
Microsatellite wikipedia , lookup
Gene expression programming wikipedia , lookup
Human Genome Project wikipedia , lookup
Genome (book) wikipedia , lookup
Metagenomics wikipedia , lookup
Gene expression profiling wikipedia , lookup
History of genetic engineering wikipedia , lookup
Pathogenomics wikipedia , lookup
Microevolution wikipedia , lookup
Designer baby wikipedia , lookup
Minimal genome wikipedia , lookup
Genome evolution wikipedia , lookup
Genomic library wikipedia , lookup
Transposable element wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS AND BIOTECHNOLOGY FOR HEALTH Actinomycetes are an important resource for new antibiotics • techniques to manipulate actinomycete genes are vital to exploiting this resource • precursor biosynthesis • regulatory networks • antibiotic biosynthetic genes • exemplified in S. coelicolor Why Streptomyces coelicolor ? • Streptomycetes makes two-thirds of all natural antibiotics • Genome sequenced • 8,667,507bp Chromosome • G+C content of 72.1% Actinorhodin “act” Undecylprodigiosin “red” • contains 7825 orfs Genome sequencing was based on a detailed genetic and physical map Functional genomics of Streptomyces coelicolor UMIST: Bioinformatics & metabolomics University of Warwick: 20 metabolite analysis University of Wales Swansea: Systematic mutagenesis John Innes Centre: Proteomics & Redirect mutagenesis University of Surrey: microarrays Mutagenesis Three techniques that exploit the genome sequence: (1) In vitro transposon mutagenesis – systematic (2) In vivo transposon mutagenesis – identify genes of related function (3) PCR targetting (Redirect) – functional analysis of a set of genes (1) In vitro ‘shuttle’ transposition • Transposition is (fairly) random • Target site is duplicated and Insertion Sequence integrated Tn5062 [AprR oriT] + Cosmid Target Site Ref: Bishop et al 2004 Genome Research 14: 893-900 In vitro transposon mutagenesis (1) Mutant cosmid isolation cosmid Tn5062 + transposase + In vitro transposition Transform E.coli [AprRKanRAmpR ] Isolate cosmid DNA Sequence Organisation of Tn5062 EZR1 sequencing primer MEstop RBS gfp T4 apramycinR T4 oriT ME Analysis of Tn5062 insertions • sequence files are directly processed using Transposon Express software • finds boundary of Tn5062 sequence • compares succeeding sequence with cosmid or genome sequence • reports coordinates of insertion and identity of disrupted gene Ref: Herron et al 2004 Nucleic Acids Res 32: e113 Transposon Express • location and description of each insertion provided at: http://streptomyces.org.uk/S.coelicolor/index.html Systematic mutagenesis of Streptomyces coelicolor A3(2) Progress to date: • 105 of 319 cosmids fully processed • 11493 independent insertions • 10459 insertions in 2520 orfs (of 7825 in total) • 4.2 insertions per orf Advantages of systematic in vitro transposon mutagenesis • High throughput • Conjugation and the recovery of gene replacement clones are efficient, so that many replicate clones are obtained for phenotypic testing • With one insertion per 280 bp, phenotypic analysis of several independent insertions in a given gene obviates the need for linkage analysis • Mutations can be moved into different genetic backgrounds, facilitating analysis of gene interactions Advantages of systematic in vitro transposon mutagenesis • Mutations can be stored and shipped as: cosmid DNA E coli containing cosmids Streptomyces mutants • A Tn5062 insertion can be manipulated to: change resistance marker (eg switch AprR to HygR ) leave an in-frame deletion induce transcription of downstream genes Tn5062 Tn5066 Tn5069 Tn5070 MEstop RBS gfp MEstop RBS gfp T4 apramycinR T4 oriT T4 Thyg hygromycinRT4 oriT ME ME MEstop RBS luxAB Thyg hygromycinRT4 oriT ME ME tcp Tmmr ME tetR Thyg hygromycinRT4 oriT exchange cassettes can be excised as PvuII fragments and used to: (1) replace an existing Tn5062 insertion by Red recombination in E.coli (2) for de novo in vitro transposon mutagenesis Transfer of mutated cosmid to Streptomyces Transfer by conjugation from E.coli ET12567(pUZ8002) into S. coelicolor X X Select for marker replacement [AprRKanS] Apr usually 1-10% of exconjugants if gene/operon is non-essential Km Apr Insertional mutagenesis of cosmid SC7C7 6279200 bp 6290053 bp 3 hybrid histidine kinase 1 kb x 5 osaB 6 Sph I osaA 4 Bam HI 1 2 7 SCO5750 SCO5751 response regulator osaB complementing DNA Mutant phenotypes 1) S. lividans A B R2YE (containing 10.3% sucrose) A: wild type B: osaB mutant [insertion x, Tn5493] 2) S. coelicolor R2YE MS + 250mM KCl MS A:wild type B:osaA (HK) mutant [insertion #1]; C:osaB (RR) mutant+vector; D:osaB (RR) mutant (complemented); E:osaB (RR) mutant [insertion #5] osaAB, genes involved in osmoadapation 1 2 3 4 x 5 6 osaA osaB hybrid histidine kinase response regulator 7 • osaB encodes a response regulator (insertion 5) that is essential for osmoadaptation during the transition between vegetative and reproductive growth • osaA mutants (1-4) all exhibit delayed aerial hyphal formation in the presence of osmolyte; a second orphan HHK (SCO7327) may also be involved in osmoadaptation • SCO5750 mutants (6) are unaffected by osmolyte; insertions 1-5 are non-polar with respect to SCO5750 • osaB complementation, with a fragment initially cloned linked to AprR of insertion 7, indicates osaA and osaB are independently transcribed • insertions 1 and 5 have been successfully introduced into S. lividans: similar phenotypes as for the S. coelicolor osaAB mutants were obtained Expression analysis of mutated gene Truncated protein eGFP promoter Translation Chromo- Translation Monitoring of gene expression Transcription ME stop RBS gfp T4 some apramycin resistance gene Tn5062 T4 oriT ME osaB is induced by hyperosmolarity + sucrose - sucrose osaB has its own promoter t g c a 12 – 72h Timecourse of osaB expression: mRNA isolated from R2YE-grown cultures 6285056 chromosome position…… cttctggtctcccgccgcgcttccgctacgagcacagtgacatcacggtgacagggtgtg Transcription start -35 -10 gcgacaggcggggtgcggctacgatgaccggcacaaggacgggcggcgcaagggagtcgt cccccggggcggcacccgccggtgccgtgccaagtcctgtggacaggggaggccccacgc Translation start cggggcgaggagggcgggccatggtgcagaaggccaagatcctcctggtcgatgaccggc cggagaatctgcttgcgctggaggcgatcctctcggcgctcgatcagacgctggtgcggg Overproduction of ACT and RED in an osaB mutant 0.08 -1 0.06 A640 ml A450 0.05 -1 0.04 0.03 0.02 osaB mutant (+S) 0.01 0 20h 36h 46h 71h 84h wild-type Time (h) 2 -1 wild-type 1.5 -1 A530 ml A450 (+S) osaB mutant (-S) 2.5 Undecylprodigiosin... Total blue pigments... 0.07 1 0.5 0 20h 36h 46h Time (h) 71h 84h (-S) Overproduction of ACT and RED in an osaB mutant wild-type osaB mutant Complemented strain Osmoadaptation – conclusions • the response regulator encoded by osaB is essential for developmental osmoadaptation • osaB impacts on antibiotic production in conditions of hyperosmolarity • unlike most sensory kinase-response regulator gene pairs, osaB is independently transcribed • the sensory kinase encoded by osaA is required for osmoadaptation, but not essential – another kinase may also interact with OsaB (2) In vivo transposon mutagenesis Aim Generate a library of transposon induced, tagged mutants for gene function studies Kay Fowler Tn4560 (8 kb) Derived from Tn 4556 of Streptomyces fradiae (Chung 1987) Viomycin phosphotransferase gene for selection in Streptomyces vph Recombinase ? 38 bp IRs ~Tn3 38 bp IRs Tn4560 delivery plasmid pKAY1 • based on temperature-sensitive plasmid pUC1169 (derivative of pIJ101 containing Tn4560) • pOJ260 (contains E. coli ori and oriT) was cloned at the unique BamHI site • encodes a truncated Rep protein due to mutation at the unique BstBI site: -GCCCCGTTCGCGAACTCCTCGGACGGATCGGGGACCTGA -AlaProPheAlaAsnSerSerAspGlySerGlyThr*** Transposon delivery on pKAY1 introduced into Streptomyces by conjugation from E. coli 1. Mix Streptomyces and E. coli on agar plate 2. Overlay with antibiotics: Nalidixic acid or carbenicillin to kill E. coli Viomycin to select Streptomyces::Tn Conjugation plate 2d after overlay >1000 colonies contain independent Tn insertions In vivo transposon mutagenesis • wash off microcolonies • plate on SFM viomycin • harvest spores = Tn library • plate library using conditions to detect a specific phentype • isolate DNA from mutant • Ligation-mediated PCR Ligation-mediated PCR for target sequence amplification 1. Digest DNA using EagI (C’GGCCG) 2. Ligate non-phosphorylated End primer/Adaptor 3. PCR Ligation End primer Genome Adaptor No ligation End primer PCR Product Transposon Tn primer Tn primer 3’ nested Target sequence identification • Use TA cloning to clone PCR products • Sequence inserts • Blast sequence against genome to identify target gene (3) PCR targetting (Redirect) Bertolt Gust Tübingen Acknowledgements Swansea: Amy Bishop osaAB Sue Fielding sequencing Paul Herron in vitro transposition Gareth Hughes Transposon Express Ricardo del Sol exchange cassettes Norwich: Govind Chandra ScoDB Tobias Kieser in vivo transposon mutagenesis Kay Fowler in vivo transposon mutagenesis