* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Comparative Genomics of Microbes
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Gene expression programming wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gene desert wikipedia , lookup
Copy-number variation wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Oncogenomics wikipedia , lookup
Ridge (biology) wikipedia , lookup
Gene expression profiling wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genomic imprinting wikipedia , lookup
History of genetic engineering wikipedia , lookup
Transposable element wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Genome (book) wikipedia , lookup
Public health genomics wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Metagenomics wikipedia , lookup
Human genome wikipedia , lookup
Genomic library wikipedia , lookup
Genome editing wikipedia , lookup
Human Genome Project wikipedia , lookup
Helitron (biology) wikipedia , lookup
Pathogenomics wikipedia , lookup
Comparative genomics: Overview & Tools Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. [email protected] Genome sequence: Fact file • 1995: The first complete genome sequence of Haemophilus infuenzae Rd-was published • • • • Biological systems are dynamic and evolving The forth dimension: Time Genome sequence is a snapshot of evolution Correlation between Phenotypic properties and Genomic region is not straightforward as phenotypic properties are result of many to many interactions October 2K5 © UKK, Bioinformatics Centre, University of Pune. 2 Genomes: the current status • Published complete genomes: 303 – Archaeal: 24 – Bacterial: 240 – Eukaryal: 39 • Completed Viral genomes: >5000 • Prokaryotic ongoing genomes: 755 • Eukaryotic ongoing genomes: 531 As of October 11, 2005 October 2K5 © UKK, Bioinformatics Centre, University of Pune. 3 Genome databases • Genomes at NCBI, EBI, TIGR October 2K5 © UKK, Bioinformatics Centre, University of Pune. 4 H. influenzae Complete Genome October 2K5 © UKK, Bioinformatics Centre, University of Pune. 5 Function information clock of E. coli Generated on March 2K4 October 2K5 © UKK, Bioinformatics Centre, University of Pune. 6 Genome analyses • Variation in – – – – – E. coli: 4.6Mbp M. pneumoniae: 0.81Mbp B. subtilis: 4.20Mbp Genome size GC content B. burgdorferi: 29% M. tuberculosis: 68% Codon usage Amino acid composition G, A, P, R: GC rich Genome organisation I, F, Y, M, D: AT rich • Single circular chromosomes • Linear chromosome + extra chromosomal elements October 2K5 © UKK, Bioinformatics Centre, University of Pune. 7 CG: Comparisons between genomes • The stains of the same species • The closely related species • The distantly related species – List of Orthologs – Evolution of individual genes – Evolution of organisms October 2K5 © UKK, Bioinformatics Centre, University of Pune. 8 CG helps to ask some interesting questions • Identification similarities/differences between genomes may allow us to understand : – How 2 organisms evolved? – Why certain bacteria cause diseases while others do not? – Identification and prioritization of drug targets October 2K5 © UKK, Bioinformatics Centre, University of Pune. 9 CG: Unit of comparison • Unit of comparison: Gene/Genome – – – – – Number Content (sequence) Location (map position) Gene Order Gene Cluster (Genes that are part of a known metabolic pathway, are found to exist as a group) – Colinearity of gene order is referred as synteny – A conserved group of genes in the same order in two genomes as a syntenic groups or syntenic clusters – Translocation: movement of genomic part from one position to another October 2K5 © UKK, Bioinformatics Centre, University of Pune. 10 Comparison of the coding regions • Begins with the gene identification algorithm: infer what portions of the genomic sequence actively code for genes. • There are four basic approaches. October 2K5 © UKK, Bioinformatics Centre, University of Pune. 11 Knowledge of Full Genome sequence: Solutions or new questions…? Correct # of genes…? October 2K5 • Still struggling with the gene counters… © UKK, Bioinformatics Centre, University of Pune. 12 Numbers: Geneoperon number Structure of•tryptophan • Arrows: Direction of transcription • //: Dispersion of operon by 50 genes trpB and trpA genetically linked separate genes October 2K5 © UKK, Bioinformatics Centre, University of Pune. 13 Dandekar et al., 1998 Domain fusion trpD and trpG trpF and trpC Important observations with regard to Gene Order • Order is highly conserved in closely related species but gets changed by rearrangements • With more evolutionary distance, no correspondence between the gene order of orthologous genes • Group of genes having similar biochemical function tend to remain localized – Genes required for synthesis of tryptophan (trp genes) in E. coli and other prokaryotes October 2K5 © UKK, Bioinformatics Centre, University of Pune. 14 Synteny • Refers to regions of two genomes that show considerable similarity in terms of – sequence and – conservation of the order of genes • likely to be related by common descent. October 2K5 © UKK, Bioinformatics Centre, University of Pune. 15 COGs: Phylogenetic classification of proteins encoded in complete genomes October 2K5 © UKK, Bioinformatics Centre, University of Pune. 16 Genome analyses@NCBI Pairwise genome comparison of protein homologs (symmetrical best hits) October 2K5 © UKK, Bioinformatics Centre, http://www.ncbi.nlm.nih.gov/sutils/geneplot.cgi University of Pune. 17 Integr8: CG site at EBI http://www.ebi.ac.uk/integr8 October 2K5 © UKK, Bioinformatics Centre, University of Pune. 18 Comparative Genomics Tools • BLAST2 • MUMmer • Comparisons and analyses at both – Nucleic acid and protein level • Comparative genomics of Parasites @ TIGR • Microbial Genome Database (MDG) in Japan • Comparative Genome analysis in P. Borks lab @embl-heidelberg • Comprehensive Microbial Resource page@TIGR October 2K5 © UKK, Bioinformatics Centre, University of Pune. 19 Genome Alignment Algorithm: MUMmer • Developed by – Dr. Steven Salzberg’s group at TIGR – NAR (1999) 27:2369-2376 – NAR (2002) 30:2478-2483 • Availability – Free – TIGR site October 2K5 © UKK, Bioinformatics Centre, University of Pune. 20 Features of MUMmer • The algorithm assumes that sequences are closely related • Can quickly compare millions of bases • Outputs: – Base to base alignment – Highlights the exact matches and differences in the genomes – Locates • • • • October 2K5 SNPs Large inserts Significant repeats Tandem repeats and reversals © UKK, Bioinformatics Centre, University of Pune. 21 Definitions are drawn from biology • SNP: Single mutation surrounded by two matching regions – Regions of DNA where 2 sequences have diverged by more than one SNP • Large inserts: regions inserted into one of the genomes – Sequence reversals, lateral gene transfer • Repeats: the form of duplication that has occurred in either genome. • Tandem repeats: regions of repeated DNA in immediate succession but with different copy number in different genomes. – A repeat can occur 2.5 times October 2K5 © UKK, Bioinformatics Centre, University of Pune. 22 Techniques used in the MUMmer Algorithm Compute Suffix trees for every genome Longest Increasing Subsequence (LIS) Alignment using Smith & Waterman algorithm Integration of these techniques for genome alignment October 2K5 © UKK, Bioinformatics Centre, University of Pune. 23 MUMmer: Steps in the alignment process Read two genomes Using SNPs, mutation regions, repeats, tandem repeats Perform Maximum Unique Match (MUM) of genomes Close the gaps in the Alignment Output alignment October 2K5 © UKK, Bioinformatics Centre, University of Pune. Sort and order the MUMs using LIS • MUMs • regions that do not match exactly 24 MUMmer steps • Locating MUMs • Sorting MUMs • Closure with gaps G1: ACTGATTACGTGAACTGGATCCA G2: ACTCTAGGTGAAGTGATCCA October 2K5 © UKK, Bioinformatics Centre, University of Pune. 25 Genome1: ACTGATTACGTGAACTGGATCCA Genome2: ACTCTAGGTGAAGTGATCCA Genome1: ACTGATTACGTGAACTGGATCCA Genome2: ACTCTAGGTGAAGTGATCCA ACTGATTACGTGAACTGGATCCA ACTC--TAGGTGAAGT-GATCCA October 2K5 © UKK, Bioinformatics Centre, University of Pune. 26 What is a MUM? • MUM is a subsequence that occurs exactly once in both genomes and is NOT part of any longer sequence • Two characters that bound a MUM are always mismatches GenA: tcgatcGACGATCGCCGCCGTAGATCGAATAACGAGAGAGCATAAcgactta GenB: gcattaGACGATCGCCGCCGTAGATCGAATAACGAGAGAGCATAAtccagag • Principle: if a long matching sequence occurs exactly once in each genome, it is certainly to be part of global alignment Similar to BLAST & FASTA!! October 2K5 © UKK, Bioinformatics Centre, University of Pune. 27 Sorting & ordering MUMs • MUMs are sorted according to their position in Genome A • The order of matching MUMs in Genome B is considered 2 4 MUM3: Random match Inexact repeat MUM5: transposition • LIS algorithm to locate longest set of MUMs which occur in ascending order in both genomes October 2K5 UKK, Bioinformatics Centre, Leads©to Global MUM-alignment University of Pune. 28 MUMmer Results • 2 strains of M. tuberculosis – H37Rv & CDC1551 – Genome size: 4Mb – Time: 55 s • Generating suffix tree: 5 s • Sorting MUMs: 45s • S&W alignment: 5 s October 2K5 © UKK, Bioinformatics Centre, University of Pune. 29 Alignment of M. tuberculosis strains CDC1551 (Top) & H37Rv (bottom) Single green lines indicate SNPs Blue lines indicate insertions October 2K5 © UKK, Bioinformatics Centre, University of Pune. 30 Comparison of 2 Mycoplasma genomes cousins that are distantly related • M. genitalium: 580 074 nt • M. pneumoniae: 816 394 (+226 000) • Analysis of proteins tell us that all M.g. proteins are present in P.m. • Alignment was carried using – – – – FASTA (dividing each genome into 1000 bp) All-against-all searches Fixed length of pattern (25) Using MUMmer (length = 25) October 2K5 © UKK, Bioinformatics Centre, University of Pune. 31 Comparison of 2 Mycoplasma genomes Using FASTA Fixed length patterns: 25mers MUMmer October 2K5 © UKK, Bioinformatics Centre, University of Pune. 32 Post-sequencing challenges • Genome sequencing is just the beginning to appreciate biocomplexity • Sequence-based function assignment approaches fail as the sequence similarity drops … • Structure-based function prediction approaches are limited by the availability of structures, association of structural motifs & associated functional descriptor • As a result, in any genome, Genes with known function: ~ 40% October 2K5 Genes with unknown function: ~60% © UKK, Bioinformatics Centre, University of Pune. 33