Download Test Results - Oregon State University

Test Results
•
•
•
•
Overall Average : 48 ±14
(6-81)
Multiple Choice Average: 25±6 (6-38)
Fill in Average:10±4 (0-20)
Short Answer/Diagram Average:13±7 (0-35)
• Question 2 is misgraded, I will adjust for it later.
Approximate Pace
•
•
•
•
•
48 is middle C
48+14 (1StD) = 62 is middle B
48+28 (2StD) = 76 is middle A
48-14 (1StD) = 34 is middle D
48-28 (2StD) = 20 is middle F
Numerical Breakdown
•
•
•
•
•
11 in A range
25 in B range
56 in C range
26 in D range
9 in F range
Study Tactics
•
•
•
•
•
•
•
•
•
Read Chapter and Study Figures
Study Summary, Key Terms; Questions
Flashcards
Reread chapter carefully in quiet place while taking
notes
Create your own outline of chapter
Practice diagrams on paper; the text discusses each step
Quiz study partner
Discuss subjects with friends
Grill your T.A. at recitation about the subject matter
Test Tactics
• Assess your strengths/weaknesses
• Survey test and determine pace
• Fill in high points questions if you know the
answers
• Rapidly go through MC and fill ins and answer the
ones you know
• Use remaining time to use the process of
elimination to better statistical chances on the
remaining multiple choice
• Revisit high point questions and try to garner
some partial credit
• Do not dilute correct pieces with too much random
guessing
Syllabus Change
• We will only go to Chapter 8 by the end of
next week.
• Read Chapter 8 by Wednesday
RNA Processing
• Prokaryotes
– rRNAs
– tRNAs
• Eukaryotes
– rRNAs
– tRNAs
– mRNAs
Specialized Processing Systems
rRNA
Methylation
Glycosylation
5S
Specialized Processing Systems
pre-tRNAs to tRNA
Eukaryotic mRNA Processing
Overview
Eukaryotic mRNA Processing
Polyadenylation
Eukaryotic mRNA Processing
Splicing: Methods
Eukaryotic mRNA Processing
Splicing: Two Step Reaction
YYYYYYYYYN(C/U)AG|G(G/U)
(A/C)AG|GU(A/G)AGU
Eukaryotic mRNA Processing
Splicing: Spliceosome
• snRNAs
– 50-200 nt
– U1,U2,U5,U6,
• snRNPs
– snRNA +6-10 proteins
Eukaryotic mRNA Processing
Splicing: Alternative Splicing
RNA Degradation
• Half life of mRNAs
– rRNAs and tRNAs: very long
– mRNAs
• Bacteria : approx. 2-3 minutes
• Mammals: < 30 min to >20 hours
Transferrin
(Fig.6.48)
Proteins
•
•
•
•
Synthesis: Translation of mRNA
Folding and Processing
Regulation of Function
Degradation
Protein Synthesis
Translation of mRNA
Protein Synthesis
Polycistronic vs. Monocistronic
Protein Synthesis
The Genetic Code
Protein Synthesis
Decoding Example
AUGUUCGACUGCAACCCCCCGUAA
AUGUUCGACUGCAACCCCCCGUAA
Met Phe Asp Cys Asn Pro Pro Stop
Protein Synthesis
Transfer RNAs
• tRNAs
–
–
–
–
70-80 nt
Cloverleaf
Anticodon loop
amino acid attachment site
Protein Synthesis
Aminoacyl tRNA Synthetases
•
•
•
•
•
Approx. 40
Why not 64?
Why not 61?
Wobble
I can pair with
C, U, orA
Protein Synthesis
Ribosomes
Protein Synthesis
Signals for Initiation