* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Test Results - Oregon State University
G protein–coupled receptor wikipedia , lookup
RNA interference wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Magnesium transporter wikipedia , lookup
Metalloprotein wikipedia , lookup
Genetic code wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Peptide synthesis wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Expression vector wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Oligonucleotide synthesis wikipedia , lookup
Interactome wikipedia , lookup
Protein structure prediction wikipedia , lookup
Western blot wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Protein purification wikipedia , lookup
Biosynthesis wikipedia , lookup
Alternative splicing wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Polyadenylation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Gene expression wikipedia , lookup
De novo protein synthesis theory of memory formation wikipedia , lookup
Test Results • • • • Overall Average : 48 ±14 (6-81) Multiple Choice Average: 25±6 (6-38) Fill in Average:10±4 (0-20) Short Answer/Diagram Average:13±7 (0-35) • Question 2 is misgraded, I will adjust for it later. Approximate Pace • • • • • 48 is middle C 48+14 (1StD) = 62 is middle B 48+28 (2StD) = 76 is middle A 48-14 (1StD) = 34 is middle D 48-28 (2StD) = 20 is middle F Numerical Breakdown • • • • • 11 in A range 25 in B range 56 in C range 26 in D range 9 in F range Study Tactics • • • • • • • • • Read Chapter and Study Figures Study Summary, Key Terms; Questions Flashcards Reread chapter carefully in quiet place while taking notes Create your own outline of chapter Practice diagrams on paper; the text discusses each step Quiz study partner Discuss subjects with friends Grill your T.A. at recitation about the subject matter Test Tactics • Assess your strengths/weaknesses • Survey test and determine pace • Fill in high points questions if you know the answers • Rapidly go through MC and fill ins and answer the ones you know • Use remaining time to use the process of elimination to better statistical chances on the remaining multiple choice • Revisit high point questions and try to garner some partial credit • Do not dilute correct pieces with too much random guessing Syllabus Change • We will only go to Chapter 8 by the end of next week. • Read Chapter 8 by Wednesday RNA Processing • Prokaryotes – rRNAs – tRNAs • Eukaryotes – rRNAs – tRNAs – mRNAs Specialized Processing Systems rRNA Methylation Glycosylation 5S Specialized Processing Systems pre-tRNAs to tRNA Eukaryotic mRNA Processing Overview Eukaryotic mRNA Processing Polyadenylation Eukaryotic mRNA Processing Splicing: Methods Eukaryotic mRNA Processing Splicing: Two Step Reaction YYYYYYYYYN(C/U)AG|G(G/U) (A/C)AG|GU(A/G)AGU Eukaryotic mRNA Processing Splicing: Spliceosome • snRNAs – 50-200 nt – U1,U2,U5,U6, • snRNPs – snRNA +6-10 proteins Eukaryotic mRNA Processing Splicing: Alternative Splicing RNA Degradation • Half life of mRNAs – rRNAs and tRNAs: very long – mRNAs • Bacteria : approx. 2-3 minutes • Mammals: < 30 min to >20 hours Transferrin (Fig.6.48) Proteins • • • • Synthesis: Translation of mRNA Folding and Processing Regulation of Function Degradation Protein Synthesis Translation of mRNA Protein Synthesis Polycistronic vs. Monocistronic Protein Synthesis The Genetic Code Protein Synthesis Decoding Example AUGUUCGACUGCAACCCCCCGUAA AUGUUCGACUGCAACCCCCCGUAA Met Phe Asp Cys Asn Pro Pro Stop Protein Synthesis Transfer RNAs • tRNAs – – – – 70-80 nt Cloverleaf Anticodon loop amino acid attachment site Protein Synthesis Aminoacyl tRNA Synthetases • • • • • Approx. 40 Why not 64? Why not 61? Wobble I can pair with C, U, orA Protein Synthesis Ribosomes Protein Synthesis Signals for Initiation