Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download No Slide Title
Document related concepts
Protein adsorption wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Holliday junction wikipedia , lookup
Molecular cloning wikipedia , lookup
List of types of proteins wikipedia , lookup
Community fingerprinting wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Bottromycin wikipedia , lookup
Molecular evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA interference wikipedia , lookup
Non-coding DNA wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
RNA silencing wikipedia , lookup
Silencer (genetics) wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Polyadenylation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Transfer RNA wikipedia , lookup
Transcript
Transcription & Translation It’s all about making... Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription. Helicase & RNA polymerase DNA unwinds and unzips (Helicase). Coding Strand RNA Polymerase binds to and moves along a DNA strand. RNA nucleotides are joined in order complimentary to the DNA nucleotide sequence. mRNA Nucleotides mRNA Nucleotides Helicase & A nice image of the same thing! There are three kinds of ... 1) mRNA (Messenger) 2) rRNA (Ribosomal) 3) tRNA (Transfer) Single strand complementary to the template strand. Messenger RNA (mRNA) carries the DNA message out of the nucleus and into the cytoplasm to ribosomes, the site of protein synthesis. tRNA tRNA UACGGCAAUCUGGCAAUCGCCUGGACUG Single strand complementary to the coding strand. Transfer RNA (tRNA) leaves the nucleus, binds to the amino acid specified by it’s anticodon and transfers it to the ribisome where it meets up with mRNA to assemble a protein. Processing results in a “T” shape, with an amino acid binding site at one end and an anticodon at the other. Ribosomal RNA (rRNA) is RNA in globular form. It joins with 83 proteins to form a ribosome. The sites labeled “P” and “A” bind tRNA. The “groove” formed between the two subunits is the site of mRNA binding. AKA Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription. Here’s where it all comes together!!! mRNA, carrying the codon and tRNA, carrying the anticodon, meet at the ribosome (rRNA) to piece together amino acids. Here’s how it works... Ribosome rRNA + Protiens Here it is all together! Anticodon Codon A nice image of the same thing! This is a representation of one molecule of hemoglobin. It is the result of amino acids strung together into peptides, joined to form polypeptides which combine to make up the final protein. The result... Anticodon Codon A nice image of a protein being made! How about a review?
