* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Guillain-Barre syndrome (GBS)
Survey
Document related concepts
Phosphorylation wikipedia , lookup
Cell membrane wikipedia , lookup
SNARE (protein) wikipedia , lookup
Protein moonlighting wikipedia , lookup
Protein domain wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Intrinsically disordered proteins wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Magnesium transporter wikipedia , lookup
List of types of proteins wikipedia , lookup
Western blot wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Endomembrane system wikipedia , lookup
Proteolysis wikipedia , lookup
Transcript
GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT GCAAGCCTCAATGGATCCACCACCCTTTTTGG TGCAAGCCTCAATGGATCCACCACCCTTTTTG GTGCAGCCTCAATGGATCCACCACCCTTTTTG GGCAGCCTCAATGGATCCACCACCCTTTTTG GTGCAAGCCTCAATGGATCCACCACCCTTTTT GGTGCAAGCCTCAATGGATCCACCTCCACCA CCCTTTTTGGTGCATGTGCCATGGC 1 2 Gene expression Transcription Translation Functional proteins: post-translational modifications Phosphorylation Glycosylation Sorting: targeting to appropriate organelles Modulation by extracellular signals Covalent modification Association with other molecules Degradation 3 Sorting and Secretory pathways diverged in trans-Golgi Constitutive pathway many soluble proteins Regulated pathway stored in secretory vesicles active transport from cytosol to vesicles complexed with macromolecules (e.g. proteglycans) 4 Regulated secretory pathway In response to extracellular stimuli: hormone, transmitters, digestive enzymes stored in secretory vesicles active transport from cytosol to vesicles complexed with macromolecules (e.g. proteglycans) to reach high concentration 5 6 Three pathways in Golgi to lysosome with mannose-6-phosphate, via late endosome to lysosome to secretory pathways Constitutive: to apical or basolateral domain Regulated 7 8 “Roadmap” for traffic Transport Gated transport: cytosol and nucleus via nuclear pore complexes Membrane transport: via membrane-bound translocators; unfolded Vesicle transport: vesicles Sorting signals 9 Membrane transport Membrane-bound translocators Unfolding of protein to be transported Passing through a topologically distinct space: cytosol to ER; cytosol to mitochondria 10 Equivalent space for transport Cycles of budding and fusion permits transport of molecules 11 Sorting signals Signal sequences 15-60 aa Removed by signal peptidase when reaching the target Signal patch Usually non-continuous stretch of sequences Exposed when appropriately folded 12 Sorting signals 13 Signal sequences Function: specify the direction for destination for initial transfer to the ER: with a signal sequence at N-terminus; consisting of 5-10 hydrophobic aa Go forward Golgi: most proteins Return to ER (ER residents): with a specific sequence of 4 aa at C-terminus Go to mitochondria: positively charged amino acids alternate with hydrophobic ones Go to peroxisome: with a signal peptide of 3 characteristic at C terminus 14 Signal sequences 15 Experiments to demonstrate “zip code” Swap the signal sequence: e.g.: adding the ER signal sequences to a cytosolic protein results in the retention of this protein in ER Hyprophobicilty: maybe a determing factor of signal sequences 16 Günter Blobel 17 Effect of misdirected protein 18 19 Overview of protein sorting 20 Protein sorting ER ER-Golgi intermediate Glogi network 21 Glycosylation in ER 22 Lysosomal protein: phosphorylation of mannose 23 Sorting in Golgi Export Lysosome Secretion Constitute Regulated Retain in Golgi transmembrane 24 Transport to plasma membrane TGN Apical domain Basolateral domain 25 Endocytosis Phagocytosis (cell eating) Ingestion of large particles (e.g. bacteria) In specialized cells Pinocytosis (cell drinking) Up-take of fluids or macromolecules in small vesicles Receptor-mediated endocytosis Common among eukaryotic cells 26 Phagocytosis Pseudopodia Phagosome Phagolysosome 27 Receptor-mediated endocytosis Clathrin-coated pits Clathrin-coated vesicles Example: cholesterol, LDL, LDL receptor 28 LDL: low density lipoprotein Core ~1500 Cholesterol ester Coat ~500 cholesterol ~ 800 phospholipid 1 Apoprotein B100 29 LDL receptor MS Brown, JL Goldstein Familial hypercholesterolemia LDL-binding domain Internalization signal 30 LDL receptor Internalization signal: Tyr 31 Clathrin-coated pits 32 Lysosomal proteins in clathrin-coated pits 33 Sorting in early endosome ph by H+ pump for dissociation of proteins Acidic 34 Recycling of synaptic vesicles 35 Protein sorting by transcytosis Membrane protein in apical domain Secretory proteins from bloodstream 36 Lysosomal system For membrane-bound proteins and proteins taken by endocytosis Multiple acid proteases (cathepsins) and other hydrolases Studied with weak bases to inhibit lysosomal acidification or lysosomal inhibitors (E64) 37