* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Bitter-Tasting Ability
Comparative genomic hybridization wikipedia , lookup
Genetic engineering wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Primary transcript wikipedia , lookup
Metagenomics wikipedia , lookup
DNA profiling wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA vaccination wikipedia , lookup
Point mutation wikipedia , lookup
Genomic library wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Microevolution wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Genome editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Helitron (biology) wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
SNP genotyping wikipedia , lookup
21-1376 21-1379 21-1377 21-1380 21-1378 21-1381 Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 1. The TAS2R38 protein has not been crystallized and there is no associated PDB number. (TAS2R38=PTC gene) 2. The nucleotide and putative amino acid sequence of the TAS2R38 gene is known. The GenBank Accession # is NM_176817. 3. However the structure of the receptor and its ligand-binding has been predicted by computer modeling. The reference is Modeling the human PTC bitter-taste receptor interactions with bitter tastants. Floriano WB, Hall S, Vaidehi N, Kim U, Drayna D, Goddard WA 3rd. J Mol Model. 2006 Sep;12(6):931-41. ! Using restriction enzymes to cut DNA Restriction Enzymes: cut covalent phosphodiester bonds at restriction / recognition sites (4 - 8 nucleotide sequence, often a palindrome); often in staggered fashion ---> restriction fragments w/ “sticky ends”. ! Restriction site DNA 5! 3! 3! 5! G AAT T C C T TAA G Restriction enzyme cuts the sugar-phosphate backbones at each arrow G Naming: genus, species, strain, # discovered ! C T TAA AAT T C G Sticky end ex. ECoRI, HindIII! AAT T C DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. G AAT T C C T TAA G G C T TAA G Fragment from different DNA molecule cut by the same restriction enzyme G AAT T C C T TAA G One possible combination DNA ligase seals the strands. Recombinant DNA molecule 2! http://www.dnai.org/b/index.html - Manipulation / Techniques/ Cutting & Pasting ! Gel Electrophoresis! www.dnai.org/index.htm Manipulation / Sorting & sequencing! Digest with restriction enzymes! Concentration of agarose gel can be increased for finer separation! DNA = negatively charged smaller fragments travel faster & therefore farther correlate distance to size http://www.phschool.com/science/biology_place/labbench/lab6/concepts2.html! SNP’S & RFLP’S! SNP’s (single nucleotide polymorphisms) occur at a frequency ! 43! of about 1 in every 1,000 nucleotides. Although some have a ! biological effect on the individual, most have no effect. However, ! they may be used as genetic markers in order to locate genes that ! cause or predispose to disease or influence other traits.! 34! If you pick a restriction enzyme that recognizes the sequence TTAAA and ! cuts it between the T and A, then person 1’s DNA will be cut ! differently than person 2’s DNA.! PERSON 1! TTAAATCGTGCTGATATTGGCGATGATCGGGGGTTTAAACCGCTA! PERSON 2! TTAAATCGTGCTGATATTGGCGATGATCGGGGGTTTGAACCGCTA ! ! ! ! ! ! ! ! RFLP’s - restriction fragment length polymorphisms ---> ! 9! 2! ! ! ! ! ! ! ! ! ! person 1 !! !! !2! genetic markers (certain pattern of RFLP’s always associated ! with a particular disorder/trait)! ! ! ! !! Person 1 will have different length fragments cut by the restriction enzyme than person 2. If you analyze their DNA by gel electrophoresis, you will get different patterns due to the different length fragments of DNA ((RFLP’s).! Person 1 - fragment lengths of 2, 9 , 34 Person 2 - fragment lengths of 2, 43! ! We will assume that each person has 2 of the same alleles for this trait. Two pieces of DNA of the same length stop on the gel at the same place and still appear as a single band. What would the banding pattern look like for someone that was heterozygous? Hint: fragment lengths = 2,9,34,43! RFLP’s - restriction fragment length polymorphisms ---> genetic markers :certain pattern of RFLP’s always associated with a particular disorder/trait. !! SNP’s - single nucleotide polymorphisms; occur at a frequency of about 1 in every 1,000 nucleotides. Although some have a biological effect on the individual, most have no effect. However, they may be used as genetic markers in order to locate genes that cause or predispose to disease or influence other traits.! Haplotype - a set of single nucleotide polymorphisms (SNPs) on a single chromatid that are statistically associated. This information is very valuable for studying similarities and differences in humans and investigating the genetics behind common diseases - see International HapMap Project. http:// www.hapmap.org/thehapmap.html.en (http://en.wikipedia.org/wiki/Haplotype) DNA in the Cell! chromosome! cell nucleus! Double stranded DNA molecule! Target Region for PCR! Individual nucleotides! PCR - Polymerase Chain Reaction! **use! .2 ml tubes! http://www.dnai.org/b/index.html - Manipulation/Amplifying! http://learn.genetics.utah.edu/content/labs/pcr/ ! *Amplifies DNA segments to make unlimited quantities of sections of DNA / genes of interest! • DNA is heated, denatured to break hydrogen bonds! • Cool and add primers, DNA polymerase is added and DNA is synthesized! • Repeat; Amount of DNA doubles with each cycle! = forward primer! = intentionally introduced mismatch in primer! The forward primer binds within the TAS2R38gene, from nucleotides 101–144. There is a single mismatch at position 143, where the primer has a G and the gene has an A. This mismatch is crucial to the PCR experiment, because the A in the PTC sequence is replaced by a G in each of the amplified products. This creates the first G of the HaeIII recognition sequence GGCC (this is not naturally present in the TAS2R38gene), allowing the amplified taster allele to be cut. The amplified nontaster allele reads GGGC and is not cut. ! 221 bp 177 & 41 bp 9! http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=607751! 12! Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 5 STUDENT LAB INSTRUCTIONS INTRODUCTION Mammals are believed to distinguish only five basic tastes: sweet, sour, bitter, salty, and umami (the taste of monosodium glutamate). Taste recognition is mediated by specialized taste cells that communicate with several brain regions through direct connections to sensory neurons. Taste perception is a two-step process. First, a taste molecule binds to a specific receptor on the surface of a taste cell. Then, the taste cell generates a nervous impulse, which is interpreted by the brain. For example, stimulation of “sweet cells” generates a perception of sweetness in the brain. Recent research has shown that taste sensation ultimately is determined by the wiring of a taste cell to the cortex, rather than the type of molecule bound by a receptor. So, for example, if a bitter taste receptor is expressed on the surface of a “sweet cell,” a bitter molecule is perceived as tasting sweet. A serendipitous observation at DuPont, in the early 1930s, first showed a genetic basis to taste. Arthur Fox had synthesized some phenylthiocarbamide (PTC), and some of the PTC dust escaped into the air as he was transferring it into a bottle. Lab-mate C.R. Noller complained that the dust had a bitter taste, but Fox tasted nothing—even when he directly sampled the crystals. Subsequent studies by Albert Blakeslee, at the Carnegie Department of Genetics (the forerunner of Cold Spring Harbor Laboratory), showed that the inability to taste PTC is a recessive trait that varies in the human population. Albert Blakeslee using a voting machine to tabulate results of taste tests at the AAAS Convention, 1938. (Courtesy Cold Spring Harbor Laboratory Research Archives) Bitter-tasting compounds are recognized by receptor proteins on the surface of taste cells. There are approximately 30 genes for different bitter taste receptors in mammals. The gene for the PTC taste receptor, TAS2R38, was identified in 2003. Sequencing identified three nucleotide Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 6 positions that vary within the human population—each variable position is termed a single nucleotide polymorphism (SNP). One specific combination of the three SNPs, termed a haplotype, correlates most strongly with tasting ability. pharmacogenomics !! Analogous changes in other cell-surface molecules influence the activity of many drugs. For example, SNPs in serotonin transporter and receptor genes predict adverse responses to anti-depression drugs, including PROZAC® and Paxil®. In this experiment, a sample of human cells is obtained by saline mouthwash. DNA is extracted by boiling with Chelex resin, which binds contaminating metal ions. Polymerase chain reaction (PCR) is then used to amplify a short region of the TAS2R38 gene. The amplified PCR product is digested with the restriction enzyme HaeIII, whose recognition sequence includes one of the SNPs. One allele is cut by the enzyme, and one is not—producing a restriction fragment length polymorphism (RFLP) that can be separated on a 2% agarose gel. Each student scores his or her genotype, predicts their tasting ability, and then tastes PTC paper. Class results show how well PTC tasting actually conforms to classical Mendelian inheritance, and illustrates the modern concept of pharmacogenetics—where a SNP genotype is used to predict drug response. Blakeslee, A.F. (1932). Genetics of Sensory Thresholds: Taste for Phenyl Thio Carbamide. Proc. Natl. Acad. Sci. U.S.A. 18:120-130. Fox, A.L. (1932). The Relationship Between Chemical Constitution and Taste. Proc. Natl. Acad. Sci. U.S.A. 18:115-120. Kim, U., Jorgenson, E., Coon, H., Leppert, M., Risch, N., and Drayna, D. (2003). Positional Cloning of the Human Quantitative Trait Locus Underlying Taste Sensitivity to Phenylthiocarbamide. Science 299:1221-1225. Mueller, K.L., Hoon, M.A., Erlenbach, I., Chandrashekar, J., Zuker, C.S., and Ryba, N.J.P. (2005). The Receptors and Coding Logic for Bitter Taste. Nature 434:225-229. Scott, K. (2004). The Sweet and the Bitter of Mammalian Taste. Current Opin. Neurobiol. 14:423-427. DEFINITION Homo sapiens taste receptor, type 2, member 38 (TAS2R38), RefSeqGene on chromosome 7. ACCESSION NG_016141 SOURCE Homo sapiens (human) Summary: This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, V262A, and I296V) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. ! ! !"#!$%% ! ! ! "#"$%&#!'()*!+)%&,!-.! ! !/01!/234!055/! ! 673588!9:564928!;53;5;! 953<50! ! ! ! ! ! !"#$!%&'(%)%*+!*,!*'-*$!*#$!(%**$.&$--!,/!0"1!23-*!($!'!-4$5%/%5!6$/%5%*!.'*#$.!*#'&!'!7$&$.')!,&$8!-%&5$!,&$!2%7#*!&,*!*'-*$! 0"1!(3*!5'&!-*%))!*'-*$!,*#$.!(%**$.!5,24,3&6-9!!"#%-!,(-$.:'*%,&!)$6!%&:$-*%7'*,.-!-*36+%&7!*'-*$!*,!-4$53)'*$!*#'*!*#$.$! 2%7#*!($!6%//$.$&*!.$5$4*,.-!/,.!6%//$.$&*!(%**$.-!,&!*#$!#32'&!*,&73$;!!%/!,&$!.$5$4*,.!6%6!&,*!/3&5*%,&8!-4$5%/%5! 5,24,3&6-!5,3)6!&,*!($!*'-*$6!(3*!*#$!(%**$.!*'-*$!-$&-$!'-!'!<#,)$!<'-!4.$-$.:$69!!"#%-!4.$6%5*%,&!<'-!/,3&6!*,!($! *.3$!=!<#$&!*#$!#32'&!7$&,2$!<'-!/3))+!-$>3$&5$6!%&!?@@@8!'(,3*!?A!6%//$.$&*!7$&$-!<$.$!/,3&6!<%*#!5#'.'5*$.%-*%5-! *#'*!)%B$)+!2'6$!*#$2!(%**$.!*'-*$!.$5$4*,.-9! "#$-$!7$&$-!#':$!'!4'.*%53)'.!&'2$;!!*#$!!"#$%&'()*+,9!!"#$!C"DEF!2$'&-!*#$+!'.$!*'-*$!7$&$-8!*#$!C?F!2$'&-!*#$+!'.$! *#$!-$5,&6!/'2%)+!,/!*'-*$!7$&$-!6%-5,:$.$6!G*#$!/%.-*!($%&7!*#$!-<$$*!.$5$4*,.!7$&$-H8!'&6!*#$!CIF!2$'&-!*#$!7$&$!%-!'! .$5$4*,.!G-$$!J%73.$!AH9!!"#$!*$.2!C.$5$4*,.F!#'-!*#$!-'2$!2$'&%&7!%&!2,)$53)'.!(%,),7+!'-!%*!2%7#*!#':$!%&!7$&$.')!3-$! =!'!.$5$4*,.!%-!*#$!/%.-*!4,%&*!,/!5,&*'5*!<%*#!*#$!-%7&')!'&6!.$)'+-!%&/,.2'*%,&!6,<&-*.$'28!%&!*#%-!5'-$!*,!*#$!%&-%6$!,/! *#$!5$))8!*,!*#$!&$.:$-8!'&6!3)*%2'*$)+!*,!*#$!(.'%&8!<#$.$!<$!'-5.%($!>3')%*+!'&6!%&*$&-%*+!*,!*#$!-*%23)%9!!! !"#$%&'(!K+4,*#$-%-!('-$6!,&!,(-$.:'*%,&-! '(,3*!*'-*$!'(%)%*%$-!,/!/'2%)%$-;!7$&,*+4$!,/! 4'.$&*8!7$&,*+4$!,/!5#%)6!!! ! )%*+,-.%&+/&& 0&."1%*,&2& !& &,& !& ""! "*! ,& "*! **! ! "!L!*'-*$.!'))$)$M!*!L!&,&*'-*$.!'))$)$9! 0$,4)$!<#,!'.$!C""F!,.!C"*F!5'&!*'-*$!0"18!! <#$.$'-!*#,-$!<#,!'.$!C**F!5'&&,*9! ! ! ! !"#$%&'%(%)$*'#&+,&$-%&!./01&2"3+45&"'%&)'*$%+,#&$-"$&"'%&"6*7$&89:&"3+,*&"(+;#&4*,<=&$-%5&-">%&"&#)%(+2+(&#$'7($7'%&",;& "'%&("44%;&?@)'*$%+,@(*7)4%;&'%(%)$*'#A&&!-%&$%'3&B?@)'*$%+,@(*7)4%;C&'%2%'#&$*&D-"$&-"))%,#&+,#+;%&$-%&(%44&D-%,&$-%& '%(%)$*'&+#&#$+374"$%;&65&$-%&$"#$%&3*4%(74%A&&?@)'*$%+,#&"'%&#+<,"4+,<&3*4%(74%#&$-"$&#%$&*22&"&)"'$+(74"'&#%'+%#&*2& (-%3+("4&'%"($+*,#&+,#+;%&$-%&(%44A&&E,&3*4%(74"'&6+*4*<5&$%'3+,*4*<5F&"&$"#$%&3*4%(74%&+#&("44%;&"&!"#$%&&",;&2+$#&+,$*&"& )*(G%$&('%"$%;&*,&$-%'2"(%&*2&$-%&'%(%)$*'A&&.4$-*7<-&$-%&B4*(G@",;@G%5C&3%$")-*'&+#&*2$%,&7#%;&$*&;%#('+6%&-*D& 4+<",;#&+,$%'"($&D+$-&'%(%)$*'#F&+$&+#&*,45&)"'$+"445&7#%274&$*&7,;%'#$",;&$-%&(*,(%)$A&&H-%,&4+<",;#&+,$%'"($&D+$-& '%(%)$*'#F&$-%&'%(%)$*'&(-",<%#&#-")%A&&E$&+#&$-+#&(-",<%&*2&#-")%&$-"$&#%$#&*22&'%"($+*,#&+,#+;%&$-%&(%44F&",;&+$&(",&"4#*& (-",<%&$-%&%I$%',"4&#-")%&*2&$-%&'%(%)$*'F&#*3%$+3%#&('%"$+,<&,%D&,**G#&",;&('",,+%#&2*'&*$-%'&4+<",;#&$*&6+,;A&&J+<7'%& K&#-*D#&"&#+3)4+2+%;F&$D*@;+3%,#+*,"4&;'"D+,<&*2&!./018LF&$-%&'%(%)$*'&$-"$&+#&#$+374"$%;&65&$-%&4+<",;&M!NA&&& & & & & !"#$%&'()&&/,"G%&;+"<'"3&*2&6+$$%'&'%(%)$*'&!./018LA&& 1%<+*,#&*2&$-%&'%(%)$*'&D-%'%&)%*)4%&<%,%$+("445&;+22%'&& "'%&+,;+("$%;&D+$-&"''*D#A ! "#$%$!&%$!'()*!+,!-.//$%!%$0$1/'%23!&(4!*$/!/#.2!%$0$1/'%!.2!(&5$4!6789:!!"#.2!.2!-$0&;2$!<#$(!/#$!#;5&(!=$('5$!>?@! 2$A;$(0$!<&2!-$.(=!4.20'B$%$43!/#$%$!<&2!1&(4$5'(.;5!&2!1$'1)$!%&0$4!/'!.4$(/.C*!($<!1%'/$.(!C&5.).$23!&(4!2$B$%&)! .(B$2/.=&/'%2!<$%$!<'%D.(=!&/!/#$!2&5$!/.5$!/'!0#&%&0/$%.E$!/#$2$!%$0$1/'%29!!F($!0'(2$A;$(0$!<&2!/#&/!/#$!(;5-$%.(=! 2*2/$5!-$0&5$!4.2'%=&(.E$4!-$0&;2$!2'!5&(*!1$'1)$!<$%$!C.(4.(=!/#$!2&5$!%$0$1/'%2!&/!/#$!2&5$!/.5$!-;/!(&5.(=! /#$5!.(4$1$(4$(/)*9!!G(!$&%).$%!/.5$2!.(!20.$(0$3!.C!*';!4.20'B$%$4!2'5$/#.(=!C.%2/3!*';!='/!/'!(&5$!./9!!H;/!/#.2!0&;2$2! /%';-)$!-$0&;2$!.C!/<'!'%!5'%$!.(B$2/.=&/'%2!4.20'B$%!/#$!2&5$!/#.(=!!&/!/#$!2&5$!/.5$3!/#$!4.20'B$%*!#&2!/<'!(&5$29!! ?'<!/#$%$!&%$!0'55.//$$2!/#&/!4$0.4$!20.$(/.C.0!(&5$23!&(4!/#$!-.//$%!%$0$1/'%!(&5.(=!.2!;(4$%='.(=!%$B.2.'(!/'! 2/%&.=#/$(!/#$!2*2/$5!';/9!!H;/!C'%!/#$!5'5$(/3!/#$!=$($!'C!.(/$%$2/!.2!!"#$%&'9!!I?'/$!/#&/!=$($!(&5$2!&%$!.(!./&).0! /*1$3!$9=93!!"#$%&'3!&(4!/#$!%$0$1/'%!1%'/$.(!/#&/!/#$*!0'4$!C'%!&%$!.(!%$=;)&%!IJ'5&(K!/*1$3!$9=93!"@L+J789K ?'/$!/#&/!/#%$$!'C!/#$!&5.('!&0.42!.(!M.=;%$!N!&%$!.(4.0/$4!<./#!&%%'<29!!"#$!&%%'<2!.(4.0&/$!)'0&/.'(2!.(!/#$!%$0$1/'%! <#$%$!1$'1)$!4.CC$%9!!"#$!=$($/.0!-&2.2!'C!.(4.B.4;&)!4.CC$%$(0$2!).$2!.(!/#$!C&0/!/#&/!/#$!=$($!2$A;$(0$!'C!'($!1$%2'(! 4.CC$%2!.(!2'5$!)'0&/.'(2!C%'5!/#&/!'C!'/#$%!1$'1)$3!&(4!=$($/.0.2/2!;2$!5&(*!<'%42!/'!4$20%.-$!/#.2!1#$('5$('(9!!O';! 5&*!-$!C&5.).&%!<./#!/#$!/$%5!6&))$)$3:!<#.0#!.2!&(!&)/$%(&/.B$!C'%53!'%!B&%.&(/3!'C!&!=$($9!!"#.2!0'(0$1/!.2!&)2'!D('<(!-*! 5&(*!'/#$%!(&5$23!C'%!$P&51)$3!1')*5'%1#.25!I65&(*Q-'4.$4:K!&(4!5&%D$%!I-$0&;2$!&5.4!&!;(.C'%5!2/%.(=!'C! (;0)$'/.4$23!&!4.CC$%$(0$!-$/<$$(!1$'1)$!5&%D2!/#$!)'0&/.'(K9!!"#$!1&%/.0;)&%!/*1$!'C!B&%.&/.'(!2#'<(!.(!M.=;%$!N!.2!'C/$(! 0&))$4!&!()*+,-.*/0,-12)3-451,671859)(79!!@!#&1)'/*1$!.2!/#$!'%4$%$4!0'(C.=;%&/.'(!'C!&))$)$29!! ! !"#$%&'(' ! !"#$%& '()*+&#,-#$%&#.(+/$#/(")0&1"*20&3$(4򁣱+5%(/7#(/#8#3+#9#:;0;"("+#5+30("&<#;$#53/($(3"#=>?@##A*$#$%&#B;+(;$(3"# $%;$#)(B&/#+(/&#$3#$%(/#2%;")&#("#5+3$&("#(/#;$#$%&#CD8#0&B&0@### E&2;00#$%;$#;00#63*+#2%+373/37&/#237&#("#5;(+/@##F%(/#)&"&#(/#3"#2%+373/37&#,-#;"#!"#$%$&'(:(@&@-#&;2%#7&7G&+#3.#$%&# 5;(+#%;/#;#2356#3.#&;2%#;00&0&#H#;00#63*+#2%+373/37&/#&I2&5$#63*+#/&I#2%+373/37&/#;+&#;*$3/37&/<-#/3#63*#%;B&#$J3# 235(&/#3.#$%(/#;00&0&@##K&#+&.&+#$3#$%".()*+;$(3"#3.#;00&0&/#3"#3"%+373/37&#;/#;#)!*+$#,*'#:8#3+#9<-#;"4#$%&# 237G(";$(3"#.+37#G3$%#2%+373/37&/#("#$%(+#;/#;#-.*+$#,*'@##!.#J&#J&+&#$3#&I;7("?*+#CD8#;$#53/($(3"#=>?-#J&# J3*04#0&;+"#63*+#)&"3$65&L# 88-#89-#3+#99# D3$(2&#;0/3#$%;$#$%&+&#;+&#;#$3$;0#3.#$%+&22&/#("#$%(/#5+3$&("#J%&+&350峝"06#4(..&+-#"3$#3"06#$%#3+#9#;$# 53/($(3"#=>?-#G*$#;0/3#M#:B;0("&<#3+#8#;$#53/($(3"#=NON-#;"4#!#:(/30&*2("&<#3+#M#;$#53/($(3"#N?O@##8"3$%&+#J;6#$3#&I5+&//# $%(/#(/#8>?9-#MNON8-#;"4#!N?OM@##K($%#$%(/#"37&"20;$*+&-#$%I/$#23773"#;7("3#;2(4#237&/#.(+/$-#.3003J&4#G6#$%&# 53/($(3"#J%&+&#$%(..&+&"2ł*+/-#;"4#$%&"#$%�&;/$#23773"#;7("3#;2(4#;$#$%&#&"4@### A&2;*/&#$%&+&#;+&#$%+&22&/#$%;$#4(..&+-#63*+#4(503$65()%$#G&#$%&#.3003J(")L# 8M!P8M!# F%(/#7&;"/#63*#;+&#)$&$/,0$"%#:%;B&#$%&#/;7&#;00&0&<#.3+#$%X#;$#53/($(3"#=>?-#MM#;$#53/($(3"#=NON-#;"4#!!#;$#53/($(B&# =N?O@##!.#63*#J&+&#*";G0&#$3#$;/$&#$%	FQ-#$%&"#63*+#4(503$65&#(/#0(R&06#8M!P8M!@### D3$&#;00#$%(..&+&"$#53//(G0íG(";$(3"/#3.#%;503$65&/L# 8M!#:23773"-#"3"$;/$&+<# 8MM# 88!#:+;+&-#73/$06#.3*"4#("#8.+(2;"#535*0;$(3"/<# 88M#:+;+&-#73/$06#.3*"4#("#S*+35&;"#535*0;$(3"/<# 9M!# 9MM# 98M#:23773"-#$;/$&+< 98!# D3$#;00#3.#$%&/íG(";$(3"/#;+&#.3*"4#("#%*7;"#CD8@### !"#3*+#%653$%&$(2;0#&I;750&-#J($%#FF#;/#$;/$&+/#;"4#$$#;/#"3"$;/$&+/-#J&#"3J#R"3J#$%&$;(0/L##FF#$;/$&+/#%;B&#$%&# 4(503$65bMP98M-#J%&+&;/#$$#"3"$;/$&+/#%;B&#$%(503$65M!P8M!@##T37&#%;503$65&/#;"4#4(503$65&/#%;B&# ("$&+7&4(;$%&"3$65&/-#J%(2%#7&;"/#$%;$#5&350"#$;/$&#$%&#G($$&+"&//#G*$#"3$#B&+6#J&00@##T3#;0$%3*)%#9FQ#(/# ("$&+&/$(")#G&2;*/&#($#/&&7/#("($(;006#$3#G&#;#G0;2R1;"41J%($&#$+;($#H#5&350"#$;/$&#($#3+#$%&6#2;"U$#H#$%&+&#;+&#/%;4&/# 3.#)+;6-#J%(2%#;+&#"3J#*"4&+/$334#;$#$%˚&2*0;+#0&B&0@# 80/3#"3$&#$%;$#G&2;*/&#$%&#.(+/$#;7("3#;2(4#;$#=>?#5+&4(2$/#$%&#%;503$65&-#$%&"#.3+#23"B&"(&"2&-#(.#$%&#.(+/$#)&"3$65&#(/# 7&;/*+&4-#$%&#+&7;("(")#)&"3$65&/#;"4#$%&#%;503$65"#G&#)*&//&4@##F%(/#)*&//(")#(/#2;00&4#.&*"#!#.$1#("#)&"&$(2/# :&@)@-#;"#8#;$#=>?#(75*$&/#$3#8M!#%;503$65&<@##80/3-#"3$&#$%&#("$+34*2$(3"#3.#$%&#$&+7#0'1$#,*'-#J%(2%#7&;"/#$%&# 237G(";$(3"#3.#;00&0&/#;$#;#+$2"%-#3+#032;$(3"#("#;#2%+373/37&@# D3J#$%;$#J&#%;B&#$;/$&4#9FQ#;"4#0&;+"&4#;G3*$#$%˚&2*0;+#G;/(/#3.#$%(/#$+;($#("#%*7;"/-#J"#;0/3#)*&//#;$#3*+# 3J"#)&"3$65&-#%;503$65&-#;"4#4(503$65&@##K*04-#(.#J&#J&+&#/3#("20("&4-#)&"3$65&350&#;"4#5+&4(2$#J%&$%&+#$%&6# 2;"#$;/$	FQ@##F%(/#4&73"/$+;$(3"#J;/#$%&#G;/(/#3.#;#9AT#3456#5+3)+;7#.(07&4#("#$%(/#/2%330-#J%(2%#(/#;22&//(G0&#.+37# $%&#!"$&+"&$L## %$$5LPPJJJ@5G/@3+)PJ)G%P"3B;P/2(&"2&"3JPV>V>PVW@%$70# K&#%;B�&;+"&4#$%;$#$%&+&#;+&#NX#G($$&+#+&2&5$3+/-#/3#J()%$#03)(2;006#J3"4&+#J%&$%&+#9FQ#(/#$%"06#&I;750.# G($$&+#G0("4"&//#;"4#7689:;<#$%"06#G+3R&"#+&2&5$3+-#3+#J%&$%&+#3$%&+#&I;750&/#7;6#&I(/$@##K&#$%("R#J6#%;B&# !"#$%&'$"()*+&*,'-./*&"!&()01&10(#'(0"$&!"+&()*&20((*+&%+#3&4#0$0$*&'$%&'//*/*1&"!&!"#$%&'5&&6)*&%0!!*+*$7*1&'-"$3& .*"./*&0$&4#0$0$*&.*+7*.(0"$&'+*&$"(&'1&%+'-'(07&'1&()'(&!"+&869:&2#(&()*;&'+*&1(0//&*<0%*$(5& 6)*&"()*+&4#*1(0"$&;"#&-03)(&/"307'//;&'1=&01&>)*()*+&2/0$%$*11&("&869&-03)(&)'<*&0-./07'(0"$1&!"+&('1(*:&)*'/():&'$%& $#(+0(0"$5&&869&01&.+"2'2/;&$"(&!"#$%&$'(#+'//;&0$&!""%1:&2#(&10-0/'+&7"-."#$%1&'+*5&&?"0(+0$&01&!"#$%&0$&-'$;&<*3*('2/*1:& 1#7)&'1&7'22'3*&'$%&@+#11*/1&1.+"#(1:&'$%&0(&)'1&'&10-0/'+&7)*-07'/&-"(0!:&AB9BC&D$0(+"3*$:&7'+2"$:&'$%&1#/!#+&7"$$*7(*%& >0()&%"#2/*&2"$%1E:&'$%&'/1"&1(0-#/'(*1&()*&869&+*7*.("+&DF""%0$3()*(+,-&&GHIHE5&&6)*+*!"+*:&1"-*&.*"./*&-03)(& *,.*+0*$7*&<*3*('2/*1&7"$('0$0$3&3"0(+0$&'1&-"+*&20((*+&()'$&%"&"()*+&.*"./*:&%*.*$%0$3&"$&()*0+&!"#$%./&3*$"(;.*& DC'$%*//&'$%&@+*1/0$&GHHJE5&&K**.&0$&-0$%&()'(&()*&7"$7*$(+'(0"$1&"!&3"0(+0$1:&/0=*&"()*+&$#(+0*$(1&'$%&1*7"$%'+;&./'$(& 7)*-07'/1:&'+*&$"(&#$0!"+-&0$&<*3*('2/*1&L&%0!!*+*$(&7#/(0<'+1&3+">$&0$&%0!!*+*$(&+*30"$1&-';&)'<*&-"+*&"+&/*11&3"0(+0$5& M0$'//;:&>);&-03)(&()*1*&'-0$"&'70%&1#21(0(#(0"$1&7)'$3*&()*&.+"(*0$&1#7)&()'(&.*"./*&7'$$"(&('1(*&869&'$%&1(+#7(#+'//;& +*/'(*%&1(0-#/0N&&6)*&'$1>*+&/0*1&0$&()*&7)'$3*1&0$&7)*-07'/&2"$%1&()'(&"77#+&>)*$&()*&'-0$"&'70%1&0$&()*&+*7*.("+& 7)'$3*5&&M"+&0$1('$7*:&'(&."10(0"$&OPQ:&0(&7)'$3*1&!+"-&'/'$0$*&DRS&$"$('1(*+E&("&.+"/0$*&D8S&('1(*+E5&&& & & & Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 7 LAB FLOW I. ISOLATE DNA BY SALINE MOUTHWASH II. AMPLIFY DNA BY PCR III. DIGEST PCR PRODUCTS WITH HaeIII IV. ANALYZE PCR PRODUCTS BY GEL ELECTROPHORESIS – + Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 8 METHODS I. ISOLATE DNA BY SALINE MOUTHWASH Reagents (at each student station) Supplies and Equipment 0.9% saline solution, 10 mL 10% Chelex®, 100 µL (in 0.2- or 0.5-mL PCR tube) Permanent marker Paper cup Micropipets and tips (10–1000 µL) 1.5-mL microcentrifuge tubes Microcentrifuge tube rack Microcentrifuge adapters Microcentrifuge Thermal cycler (or water bath or heat block) Container with cracked or crushed ice Vortexer (optional) 1. Use a permanent marker to label a 1.5-mL tube and paper cup with your assigned number. 2. Pour saline solution into your mouth, and vigorously rinse your cheek pockets for 30 seconds. 3. Expel saline solution into the paper cup. Your teacher may instruct you to collect a small sample of cells to observe under a microscope. 4. Swirl the cup gently to mix cells that may have settled to the bottom. Use a micropipet with a fresh tip to transfer 1000 µL of the solution into your labeled 1.5-mL microcentrifuge tube. 5. Place your sample tube, along with other student samples, in a balanced configuration in a microcentrifuge, and spin for 90 seconds at full speed. Before pouring off supernatant, check to see that pellet is firmly attached to tube. If pellet is loose or unconsolidated, carefully use micropipet to remove as much saline solution as possible. 6. Carefully pour off supernatant into the paper cup. Try to remove most of the supernatant, but be careful not to disturb the cell pellet at the bottom of the tube. (The remaining volume will reach approximately the 0.1 mark of a graduated tube.) Food particles will not resuspend. 8. Withdraw 30 µL of cell suspension, and add it to a PCR tube containing 100 µL of Chelex®. Label the cap and side of the tube with your assigned number. The near-boiling temperature lyses the cell membrane, releasing DNA and other cell contents. Alternatively, you may add the cell suspension to Chelex in a 1.5-mL tube and incubate in a boiling water bath or heat block. 7. Set a micropipet to 30 µL. Resuspend cells in the remaining saline by pipetting in and out. Work carefully to minimize bubbles. 9. Place your PCR tube, along with other student samples, in a thermal cycler that has been programmed for one cycle of the following profile. The profile may be linked to a 4°C hold program. If you are using a 1.5-mL tube, use a heat block or boiling water bath. Boiling step: 99°C 10 minutes 10. After boiling, vigorously shake the PCR tube for 5 seconds. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability To use adapters, “nest” the sample tube within sequentially larger tubes: 0.2 mL within 0.5 mL within 1.5 mL. Remove caps from tubes used as adapters. 9 11. Place your tube, along with other student samples, in a balanced configuration in a microcentrifuge, and spin for 90 seconds at full speed. If your sample is in a PCR tube, one or two adapters will be needed to spin the tube in a microcentrifuge designed for 1.5-mL tubes. 12. Use a micropipet with a fresh tip to transfer 30 µL of the clear supernatant into a clean 1.5-mL tube. Be careful to avoid pipetting any cell debris and Chelex® beads. 13. Label the cap and side of the tube with your assigned number. This sample will be used for setting up one or more PCR reactions. 14. Store your sample on ice or at –20°C until you are ready to continue with Part II. II. AMPLIFY DNA BY PCR Reagents (at each student station) Supplies and Equipment *Cheek cell DNA, 2.5 µL (from Part I) *PTC primer/loading dye mix, 22.5 µL Ready-To-GoTM PCR beads (in 0.2-mL or 0.5-mL PCR tube) Permanent marker Micropipet and tips (1–100 µL) Microcentrifuge tube rack Thermal cycler Container with cracked or crushed ice Shared Reagent Mineral oil, 5 mL (depending on thermal cycler) *Store on ice The primer/loading dye mix will turn purple as the PCR bead dissolves. If the reagents become splattered on the wall of the tube, pool them by pulsing in a microcentrifuge or by sharply tapping the tube bottom on the lab bench. If your thermal cycler does not have a heated lid: Prior to thermal cycling, you must add a drop of mineral oil on top of your PCR reaction. Be careful not to touch the dropper tip to the tube or reaction, or the oil will be contaminated with your sample. 1. Obtain a PCR tube containing a Ready-To-Go™ PCR Bead. Label with your assigned number. 2. Use a micropipet with a fresh tip to add 22.5 µL of PTC primer/loading dye mix to the tube. Allow the bead to dissolve for a minute or so. 3. Use a micropipet with a fresh tip to add 2.5 µL of your cheek cell DNA (from Part I) directly into the primer/loading dye mix. Insure that no cheek cell DNA remains in the tip after pipeting. 4. Store your sample on ice until your class is ready to begin thermal cycling. 5. Place your PCR tube, along with other student samples, in a thermal cycler that has been programmed for 30 cycles of the following profile. The profile may be linked to a 4°C hold program after the 30 cycles are completed. Complete 35 cycles if you are staining with CarolinaBLU™. Denaturing step: Annealing step: Extending step: 94°C 64°C 72°C 30 seconds 45 seconds 45 seconds 6. After cycling, store the amplified DNA on ice or at –20°C until you are ready to continue with Part III. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 10 III. DIGEST PCR PRODUCTS WITH HaeIII Reagents (at each student station) Supplies and Equipment *PCR product (from Part II), 25 µL Permanent marker 1.5-mL microcentrifuge tubes Microcentrifuge tube rack Micropipet and tips (1–20 µL) Thermal cycler (or water bath or heat block) Container with cracked or crushed ice Shared Reagent *Restriction enzyme HaeIII, 10 µL *Store on ice The DNA in this tube will not be digested with the restriction enzyme HaeIII. If you used mineral oil during PCR, pierce your pipet tip through the mineral oil layer to withdraw the PCR product in Step 2 and to add the HaeIII enzyme in Step 3. 1. Label a 1.5-mL tube with your assigned number and with a “U” (undigested). 2. Use a micropipet with a fresh tip to transfer 10 µL of your PCR product to the “U” tube. Store this sample on ice until you are ready to begin Part IV. 3. Use a micropipet with a fresh tip to add 1 µL of restriction enzyme HaeIII directly into the PCR product remaining in the PCR tube. Label this tube with a “D” (digested). 4. Mix and pool reagents by pulsing in a microcentrifuge or by sharply tapping the tube bottom on the lab bench. Alternatively, you may incubate the reaction in a 37°C water bath or heat block. Thirty minutes is the minimum time needed for complete digestion. If time permits, incubate reactions for 1 or more hours. 5. Place your PCR tube, along with other student samples, in a thermal cycler that has been programmed for one cycle of the following profile. The profile may be linked to a 4°C hold program. Digesting step: 37°C 30 minutes 6. Store your sample on ice or in the freezer until you are ready to begin Part IV. IV. ANALYZE PCR PRODUCTS BY GEL ELECTROPHORESIS Reagents (at each student station) Supplies and Equipment *Undigested PCR product (from Part III), 10 µL *HaeIII-digested PCR product (from Part III), 16 µL Micropipet and tips (1–20 µL) Microcentrifuge tube rack Gel electrophoresis chamber Power supply Staining trays Latex gloves UV transilluminator (for use with ethidium bromide) White light transilluminator (for use with CarolinaBLU™) Digital or instant camera (optional) Water bath (60°C) Container with cracked or crushed ice Shared Reagents *pBR322/BstNI marker 2% agarose in 1× TBE, 50 mL 1× TBE, 300 mL Ethidium bromide (1 µg/mL), 250 mL or CarolinaBLU™ Gel and Buffer Stain, 7 mL CarolinaBLU™ Final Stain, 375 mL *Store on ice 1. Seal the ends of the gel-casting tray with masking tape, and insert a well-forming comb. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 11 Avoid pouring an overly thick gel, which is more difficult to visualize. The gel will become cloudy as it solidifies. 2. Pour 2% agarose solution to a depth that covers about 1/3 the height of the open teeth of the comb. Do not add more buffer than necessary. Too much buffer above the gel channels electrical current over the gel, increasing running time. 4. Place the gel into the electrophoresis chamber, and add enough 1× TBE buffer to cover the surface of the gel. 100-bp ladder may also be used as a marker. 6. Use a micropipet with a fresh tip to load 20 µL of pBR322/BstNI size markers into the far left lane of the gel. If you used mineral oil during PCR, pierce your pipet tip through the mineral oil layer to withdraw the PCR products. Do not pipet any mineral oil. 7. Use a micropipet with a fresh tip to add 10 µL of the undigested (U) and 16 µL of the digested (D) sample/loading dye mixture into different wells of a 2% agarose gel, according to the diagram below. Expel any air from the tip before loading. Be careful not to push the tip of the pipet through the bottom of the sample well. 3. Allow the gel to solidify completely. This takes approximately 20 minutes. 5. Carefully remove the comb, and add additional 1× TBE buffer to just cover and fill in wells—creating a smooth buffer surface. MARKER pBR322/ BstNI STUDENT 1 U D STUDENT 2 U D STUDENT 3 U D 8. Run the gel at 130 V for approximately 30 minutes. Adequate separation will have occurred when the cresol red dye front has moved at least 50 mm from the wells. Destaining the gel for 5–10 minutes in tap water leeches unbound ethidium bromide from the gel, decreasing background and increasing contrast of the stained DNA. 9. Stain the gel using ethidium bromide or CarolinaBLU™: a. For ethidium bromide, stain 10–15 minutes. Decant stain back into the storage container for reuse, and rinse the gel in tap water. Use gloves when handling ethidium bromide solution and stained gels or anything that has ethidium bromide on it. Ethidium bromide is a known mutagen, and care should be taken when using and disposing of it. b. For CarolinaBLU™, follow directions in the Instructor Planning section. Transillumination, where the light source is below the gel, increases brightness and contrast. 10. View the gel using transillumination, and photograph it using a digital or instant camera. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 12 BIOINFORMATICS For a better understanding of the experiment, do the following bioinformatics exercises before you analyze your results. Biological information is encoded in the nucleotide sequence of DNA. Bioinformatics is the field that identifies biological information in DNA using computer-based tools. Some bioinformatics algorithms aid the identification of genes, promoters, and other functional elements of DNA. Other algorithms help determine the evolutionary relationships between DNA sequences. Because of the large number of tools and DNA sequences available on the Internet, experiments done in silico (in silicon, or on the computer) now complement experiments done in vitro (in glass, or test tube). This movement between biochemistry and computation is a key feature of modern biological research. http://bioinformatics.dnalc.org/ptc/ animation/index.html Point your browser to http://bioinformatics.dnalc.org/ptc/ for an onscreen version of the exercise below guided by David Micklos, founder and Executive Director of the Dolan DNA Learning Center at Cold Spring Harbor Laboratory. In Part I, you will use the Basic Local Alignment Search Tool (BLAST) to identify sequences in biological databases and to make predictions about the outcome of your experiments. In Part II, you will find and copy the human PTC taster and non-taster alleles. In Part III, you will discover the chromosome location of the PTC tasting gene. In Part IV, you will explore the evolutionary history of the gene. I. Use BLAST to Find DNA Sequences in Databases (Electronic PCR) The following primer set was used in the experiment: 5’-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3’ (Forward Primer) 5'-AGGTTGGCTTGGTTTGCAATCATC-3' (Reverse Primer) 1. Initiate a BLAST search. a. Open the Internet site of the National Center for Biotechnology Information (NCBI) www.ncbi.nlm.nih.gov. b. Click on BLAST in the top speed bar. c. Click on Nucleotide-nucleotide BLAST (blastn). d. Enter the sequences of the primers into the Search window. These are the query sequences. e. Omit any non-nucleotide characters from the window, because they will not be recognized by the BLAST algorithm. f. Click on BLAST! and the query sequences are sent to a server at the National Center for Biotechnology Information in Bethesda, Maryland. There, the BLAST algorithm will attempt to match the Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. forward primer = 5'CCTTCGTTTTCTTGGTGAATTTTTGGGATGTA GTGAAGAGGCGG-3ʼ reverse primer = 5'-AGGTTGGCTTGGTTTGCAATCATC-3' 5'-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3ʼ 5'-AGGTTGGCTTGGTTTGCAATCATC-3' skip Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 17 RESULTS AND DISCUSSION The following diagram shows how PCR amplification and restriction digestion identifies the G-C polymorphism in the TAS2R38 gene. The “C” allele, on the right, is digested by HaeIII and correlates with PTC tasting. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 18 MARKER pBR322/ BstNI tt nontaster U D TT taster U D Tt taster U D MARKER 100 bp ladder 1857 bp 1058 bp 929 bp 383 bp 221 bp 177 bp 121 bp 44 bp primer dimer (if present) 1. Determine your PTC genotype. Observe the photograph of the stained gel containing your PCR digest and those from other students. Orient the photograph with the sample wells at the top. Use the sample gel shown above to help interpret the band(s) in each lane of the gel. a. Scan across the photograph to get an impression of what you see in each lane. You should notice that virtually all student lanes contain one to three prominent bands. b. Locate the lane containing the pBR322/BstNI markers on the left side of the sample gel. Working from the well, locate the bands corresponding to each restriction fragment: 1857 bp, 1058 bp, 929 bp, 383 bp, and 121 bp. The 1058-bp and 929-bp fragments will be very close together or may appear as a single large band. The 121bp band may be very faint or not visible. (Alternatively, use a 100-bp ladder as shown on the right-hand side of the sample gel. These DNA markers increase in size in 100-bp increments starting with the fastest migrating band of 100 bp.) c. Locate the lane containing the undigested PCR product (U). There should be one prominent band in this lane. Compare the migration of the undigested PCR product in this lane with that of the 383-bp and 121-bp bands in the pBR322/BstNI lane. Confirm that the undigested PCR product corresponds with a size of about 221 bp. d. To “score” your alleles, compare your digested PCR product (D) with the uncut control. You will be one of three genotypes: tt nontaster (homozygous recessive) shows a single band in the same position as the uncut control. TT taster (homozygous dominant) shows two bands of 177 bp and 44 bp. The 177-bp band migrates just ahead of the uncut control; the 44-bp band may be faint. (Incomplete digestion may leave a small amount of uncut product at the 221-bp position, but this band should be clearly fainter than the 177-bp band.) Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 19 Tt taster (heterozygous) shows three bands that represent both alleles—221 bp, 177 bp, and 44 bp. The 221-bp band must be stronger than the 177-bp band. (If the 221-bp band is fainter, it is an incomplete digest of TT.) e. It is common to see a diffuse (fuzzy) band that runs just ahead of the 44-bp fragment. This is “primer dimer,” an artifact of the PCR reaction that results from the primers overlapping one another and amplifying themselves. The presence of primer dimer, in the absence of other bands, confirms that the reaction contained all components necessary for amplification. f. Additional faint bands at other positions occur when the primers bind to chromosomal loci other than the PTC gene and give rise to “nonspecific” amplification products. 2. Determine your PTC phenotype. First, place one strip of control taste paper in the center of your tongue for several seconds. Note the taste. Then, remove the control paper, and place one strip of PTC taste paper in the center of your tongue for several seconds. How would you describe the taste of the PTC paper, as compared to the control: strongly bitter, weakly bitter, or no taste other than paper? 3. Correlate PTC genotype with phenotype. Record class results in the table below. Phenotype Genotype Strong taster Weak taster Nontaster TT (homozygous) Tt (heterozygous) tt (homozygous) According to your class results, how well does TAS2R38 genotype predict PTC-tasting phenotype? What does this tell you about classical dominant/recessive inheritance? 4. How does the HaeIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene? 5. The forward primer used in this experiment incorporates part of the HaeIII recognition site, GGCC. How is this different from the sequence of the human TAS2R38 gene? What characteristic of the PCR reaction allows the primer sequence to “override” the natural gene sequence? Draw a diagram to support your contention. 6. Research the terms synonymous and nonsynonymous mutation. Which sort of mutation is the G-C polymorphism in theTAS2R38 gene? By what mechanism does this influence bitter taste perception? 7. Research other mutations in the TAS2R38 gene and how they may influence bitter taste perception. Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. 20 Using a Single-Nucleotide Polymorphism to Predict Bitter-Tasting Ability 8. The frequency of PTC nontasting is higher than would be expected if bitter-tasting ability were the only trait upon which natural selection had acted. In 1939, the geneticist R.A. Fisher suggested that the PTC gene is under “balancing” selection—meaning that a possible negative effect of losing this tasting ability is balanced by some positive effect. Under some circumstances, balancing selection can produce heterozygote advantage, where heterozygotes are fitter than homozygous dominant or recessive individuals. What advantage might this be in the case of PTC? 9. Research how the methods of DNA typing used in this experiment differ from those used in forensic crime labs. Focus on: a) type(s) of polymorphism used, b) method for separating alleles, and c) methods for insuring that samples are not mixed up. 10. What ethical issues are raised by human DNA typing experiments? Conclusion: 1. How were you able to find and visualize (including knowing exact fragment lengths) your TAS2R38 genotype? Be sure to include the following in your explanation: primer, PCR, SNP, RFLP, HaeIII restriction enzyme, gel electrophoresis, DNA ladder/markers 2. What are haplotypes? What haplotypes are associated with TAS2R38 and tasters/non-tasters? (see notes and also website: http://www.ncbi.nlm.nih.gov/ entrez/dispomim.cgi?id=607751 Look under Molecular Genetics 3. Describe the structure and function of the TAS2R38 gene product/protein http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=607751 Look under Cloning 4. Describe the locus, # bp, and # exons of the TAS2R38 gene. http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=607751 Look under Cloning, Gene Function, Gene Structure Copyright © 2006, Dolan DNA Learning Center, Cold Spring Harbor Laboratory. All rights reserved. http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=607751! Gel Analysis Gel Electrophoresis is a method used to separate biological molecules based upon molecular charge (polarity), molecular mass, and molecular shape. This is particularly useful in separating charged biomolecules such as deoxyribonucleic acid, DNA, and ribonucleic acid, RNA. The Logger Pro Gel Analysis feature calculates the number of base pairs of various molecules based on the distance traveled during electrophoresis. Setup for Gel Analysis Select Gel Analysis from the Insert menu of the program, and select either Take Photo or From File. Take Photo is a live method of capturing your gel results using a ProScope, Logitech, or other digital camera. Choose From File to select a gel photograph stored in your computer. Analyzing the Gel Photograph The following sequence of steps will guide you through analysis of your gel photograph: 1 Click on the Set Origin button and position your cursor to the left of the first well and click. A yellow origin will appear where vertical and horizontal lines intersect. Drag the origin up or down to position the horizontal line in the middle of all the wells. Use the dot on the horizontal line to rotate, if needed. 2 If your photo includes a reference to distance such as a ruler, click on the Set Scale button. This step is optional. If it is skipped, distances will be reported in pixels. Use your cursor to draw a line of known distance on the photo. A window will appear allowing you to input the distance of the line you draw. 3 Click on the Set Standard Ladder button. Click on the center of the first band of the Standard Ladder in the photo. Enter the number of base pairs in the window that appears. Click on the next band and repeat for all bands in the standard ladder. 4 Once the Standard Ladder has been set, click on the Add Lane button and on the Add Lane option. Click on the center of the first band of the first experimental lane. The number of base pairs will be calculated and entered in the data table and on the graph. Click on each of the remaining bands in this lane. 5 To register the bands of the next lane, click on the Add Lane button and on the Add Lane option that appears. Repeat procedure employed in step 4. This sequence is repeated for each additional lane being added to your analysis of this gel photograph. Analysis of your gel is complete. Note: Logger Pro will automatically name the first experimental lane "Lane 2." If you wish to change the name, you can do so by double-clicking on the data set name in the data set table and typing in the new name. Completed Gel Analysis of plasmid pBR322 digested with three different restriction enzymes (RE’s). Lanes 6 & 7 exhibit the result of multiple RE’s acting on the plasmid. The central lane with five bands is the Standard Ladder lane. The graph depicts the Standard Curve and the large point circles used to establish the curve. The solid circles represent the standard ladder while the other symbols indicate the different experimental bands. The graph is scaled to show millimeters (mm) migrated on the horizontal axis and number of base pairs along the vertical logarithmic axis.