Download MI Practice EOC/Final Exam - Kenwood Academy High School

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Mutagen wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Genomic library wikipedia , lookup

DNA supercoil wikipedia , lookup

RNA-Seq wikipedia , lookup

Genomics wikipedia , lookup

Public health genomics wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Non-coding DNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Gene wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

Primary transcript wikipedia , lookup

Gene therapy wikipedia , lookup

Epigenomics wikipedia , lookup

Genome (book) wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Molecular cloning wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Oncogenomics wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

DNA vaccination wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Point mutation wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Genome editing wikipedia , lookup

Genetic engineering wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Helitron (biology) wikipedia , lookup

Designer baby wikipedia , lookup

Microevolution wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

NEDD9 wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

History of genetic engineering wikipedia , lookup

Transcript
Name: ________________________
*Do NOT Write on Me*
*Write your answers on looseleaf paper
Date: ____________ Period:______
MI Practice EOC/Final Exam
1.1.1
1.
2.
1.1.2
3.
1.1.3
4.
5.
1.1.4
6.
7.
Nick has a big soccer tournament coming up in three weeks. Which of the following is the best way he can avoid
an injury that would keep him from playing in the tournament in terms of medical interventions?
A. Avoid any type of physical activity, including practices aside from the one the day before the game.
B. Go to all practices, games, and conditioning training, as well as doing extra workouts with his brother every
day until the day of the tournament.
C. Attend conditioning training and practices, stretch before any physical activity, eat a healthy and balanced
diet and wear his orthopedic cleats while on the field for games and practices.
D. Take vitamins, drink lots of milk and eat plenty of saturated fats to store up energy.
Select the best description of a medical intervention.
A. Any measure whose purpose is to improve health or to alter the course of a disease.
B. Any measure used to diagnose and treat or cure a disease.
C. Any measure to keep one healthy and prevent disease.
D. Any series of advanced technologies used to identify and treat illness.
Which of the antibiotic discs pictured below is the bacteria culture most sensitive
to? Circle the letter next to the diagram and explain below.
A. A
B. B
C. C
D. D
Polymerase chain reaction consists of cycles. Each cycle has how many steps?
What is the name of each step?
A. Two steps – anneal, extend
B. Three steps – denature, anneal, extend
C. Three steps – anneal, extend, denature
D. Two steps – extend, anneal
A
A
B
C
D
Disease detection using bioinformatics depends upon properly sequencing the DNA of the pathogen, but
sometimes things go wrong in the lab. If the necessary fluorescent markers were not added properly (or not
functioning properly), that would lead to which of the following results?
A. The PCR sample would be too small to be properly analyzed on a gel
B. The DNA stretches produced after primer attachment would differ by more than one nucleotide
C. The restriction enzymes would fail to cut the DNA strand at the proper restriction sites
D. The sequence of nucleotides could not be determined as the genetic material passed through the laser
Use the pictures and control concentration info (1st tube is 400 ng/ml with a serial ¼ dilution) to determine the
concentration of the meningitis antibody in persons A and B respectively.
A. 100ng/ml; 6 x 10-2 ng/ml
Control
B. 100ng/ml; 6.25 ng/ml
C. 25 ng/ml; 1 x 10-3 ng/ml
Person B
Person A
D. 25ng/ml; 6.25 ng/ml
In order to obtain quantitative results from an ELISA test, what tool can be created for comparative analysis and
what factor is being analyzed?
A. Pregnancy test, protein analysis
C. PCR, band width
B. Genotype, allele frequency
D. Serial dilution, color intensity
8.
1.1.5
9.
You are an immunologist who has 3 different patients suspected of
having systemic lupus erythematosus disease. Below are the results of an
ELISA test done on the patients’ blood. Which patient has the highest
concentration of antibodies in his or her sample?
A. Patient A has the highest concentration of antibodies
B. Patient B has the highest concentration of antibodies
C. Patient C has the highest concentration of antibodies
D. It is impossible to tell; the yellow wells are all equally intense in color
Why may it be better for doctors to test for disease antigens rather than antibodies during sudden outbreaks?
A. Both antibodies and antigens show up at the same time, but the antigens are stronger and therefore will
show up more readily during testing.
B. Both antibodies and antigens will show up at the same time, but antigens release chemical hormones that
block the antibodies from producing positive results when testing for a particular disease.
C. The antigens are going to show up first since the body has to produce the antibodies to fight the antigens
of the disease.
D. Antibodies are going to show up first since the body has to produce the antigens to fight the antibodies of
the disease, but antigens are the one of the two that will produce results.
1.1.6
During an outbreak of disease at Kenwood Academy High School, epidemiologists have found the following results:
 Marcus has a dry cough, aching muscles and has a temperature of 100 °F. Marcus is a reporter for the school
yearbook. Bioinformatics and lab testing reveal that Marcus has influenza.
 Jennifer has a fever with swollen glands on her neck. Jennifer is a cheerleader and has been interviewed by
Marcus. Bioinformatics and lab testing reveal that Jennifer has infectious mononucleosis.
 Darien has been coughing so much he has had to leave school early and has a temperature of 100.5°F. Darien is
friends with Marcus. Bioinformatics and lab testing reveal that Darien has strep throat.
 Maria has been feeling exhausted for a few days and woke up at one point with a temperature of 103°F. Maria is
in the same class as Darien. Bioinformatics and lab testing reveal that Maria has bacterial meningitis.
10.
1.2.1
11.
1.2.2
12.
Carlos has come in feeling tired and sore, but refuses to submit to molecular testing. He has a class with Maria
and Darien and is dating Jennifer. Just a few days ago, Carlos and Jennifer were caught making out in the
hallway. Which of the four diseases does Carlos most likely have?
A. Influenza.
C. Infectious mononucleosis.
B. Strep throat.
D. Bacterial meningitis.
Penicillin is an antibiotic that inhibits enzymes from catalyzing the synthesis of peptidoglycan, so which
prokaryotes should be most vulnerable to inhibition by penicillin?
A. Mycoplasmas
C. Gram-positive bacteria
B. Archaea
D. Gram-negative bacteria
The LB agar plate shows E.coli bacteria growth. If you placed a sample of the bacteria
from this dish onto an LB + Antibiotic A agar plate, what would you expect to see in the
petri dish after a 24 hour period of incubation?
A. Growth of the bacteria in 4mm rings.
B. Complete coverage of the petri dish in E.coli colonies.
C. No bacterial growth.
D. Growth of growth bacteria is small colonies scattered across the
petri dish.
1.2.3
13.
14.
1.2.4
15.
16.
1.3.2
17.
In attack of the super bugs E. coli I with chromosomal DNA coding resistance to streptomycin was cultured with
E. coli II that contains ampicillin resistance located on the plasmid DNA. As the cultures grew which of the
following occurred?
A. DNA from E. coli I was passed to E. coli II causing streptomycin resistance in E. coli II.
B. DNA from E. coli II was passed to E. coli I causing ampicillin resistance in E. coli I.
C. DNA was passed between both strains of bacteria causing antibiotic resistance in each bacterium.
D. DNA cannot be transferred from one bacteria to another so resistance cannot occur.
E. coli I has chromosomal DNA coding resistance to streptomycin.
E. coli II has ampicillin resistance located on the plasmid DNA. In attack of
the super bugs both of these strains of bacteria were cultured together on
a LB agar plate so DNA transfer could occur and produce a new strain of E.
coli, E.coli III. Samples of E. coli III are inoculated on the four plates shown
(A,B,C,D). Which of the following diagrams shows the growth that can
occur with the new E.coli III stain?
A. Only the growth shown in Diagram A can occur.
B. Growth can occur as shown in Diagram A and B.
C. Growth can occur as shown in Diagram A, B and C.
D. Growth can occur as shown in Diagram A, B, C, and D.
Imagine that you are sick with bacterial pneumonia. Your doctor prescribes
an antibiotic to be taken every day for eight days. What do you expect to
happen if two doses are skipped?
A. Weakly resistant bacteria will die off, some moderately and extremely resistant bacteria will be killed off,
but the infection will remain and you will remain sick or may even get worse.
B. Extremely resistant bacteria will die off, then moderately resistant bacteria will die off, leaving only weakly
resistant bacteria.
C. Nothing will happen to any of the bacteria since all the antibiotics were not taken.
D. Bacteria will not die, but will instead multiply, causing you to become even sicker.
The data shows the bacteria present over an eight
day course of antibiotics. When were the antibiotic
doses mostly likely missed?
A. Day 2
B. Day 4-5
C. Day 6
D. No doses missed
Which of the following could be an audiogram taken of an adult who during his teenage years drove around in
his car with music with a high pitch and the bass turned up so high that the car shakes?
A. A
B. B
C. C
D. D
18.
1.3.3
19.
1.4.1
20.
1.4.2
21.
Which type of hearing loss is a hearing aid that amplifies sound best suited for treating?
A. Severe Conductive hearing loss
C. Mild Sensorineural hearing loss
B. Moderate Tinnitis
D. Chronic ear infections
Which of the following is the best candidate for a cochlear implant?
A. A person who has worked without hearing protection in a factory where sounds constantly reach 100
decibels.
B. A person who has experienced multiple middle ear infections every year for the first 6 years of their life.
C. A person who has experienced destruction of their hair cells of the inner ear that transmit sound signals
to the auditory nerve.
D. A person who suffers from Meniere’s disease and is plagued by constant tinnitus.
There has been some speculation as to whether or not parents should have the right to choose to vaccinate
their child. All of the following statements accurately describe vaccination EXCEPT:
A. Some diseases that once injured or killed thousands of children, have been eliminated completely and
others are close to extinction.
B. Vaccines are only given to children after a long and careful review by scientists, doctors, and healthcare
professionals.
C. A child’s immune system can be “overloaded” if the child receives multiple vaccines at once.
D. All of these statements accurately describe vaccination.
A eukaryotic gene has "sticky ends" produced by the restriction endonuclease EcoRI. The gene is added to a
mixture containing EcoRI and a bacterial plasmid that carries two genes conferring resistance to ampicillin and
tetracycline. The plasmid has one recognition site for EcoRI located in the tetracycline resistance gene. This
mixture is incubated for several hours, exposed to DNA ligase, and then added to bacteria growing in nutrient
broth. The bacteria are allowed to grow overnight and are streaked on a plate. Samples of this growth are then
grown in four different media: nutrient broth plus ampicillin, nutrient broth plus tetracycline, nutrient broth plus
ampicillin and tetracycline, and nutrient broth without antibiotics.
Bacteria that contain the plasmid, but not the eukaryotic gene, would grow
A.
B.
C.
D.
Only in the broth containing both antibiotics.
In the broth containing tetracycline, but not in the broth containing ampicillin.
In the nutrient broth plus ampicillin, but not in the broth containing tetracycline.
In all four types of broth.
22.
Restriction enzymes are found in almost all bacterial species, and their sequence specificities cover almost all
possible short sequences (4-6 base pairs). Why do you think this is the case?
A. Restriction enzymes provide the means by which bacteria carry out gene cloning.
B. Restriction enzymes provide a means to ensure the cell’s DNA is properly copied.
C. Restriction enzymes provide the means to protect the cell by
recognizing foreign DNA and destroying it.
D. Restriction enzymes provide the means by which bacteria exchange
antibiotic resistance.
23.
A restriction enzyme identifies CCGG and cuts the strand between CC / GG.
Which lane shows the DNA profile for the DNA sequence after digestion?
GTCGAATTCACCGGAAGTGTGCCGGAATATAGTCCCGGATTAGATCCGGAG
CAGCTTAAGTGGCCTT CACACGGCCTTATAT CAGGGCCTAATCTAGGCCTC
A. Lane 1
C. Lane 2
B. Lane 3
D. Lane 4
1.4.3
24.
25.
2.1.1
26.
Food
Epidemiologists often use attack rates (the number of people who
Milk
develop a certain illness divided by the total number of people at
Banana
risk) to determine contamination origin. Which food most likely
Turkey
caused the illness?
A. Milk
C. Banana
B. Turkey
D. It most likely was not a food related illness
A round of severe gastrointestinal symptoms has swept through a
group of second grade students of Ray Elementary. An epidemiologist
interviewed the students who are showing symptoms about the food
that they consumed in the school cafeteria. Which food can be linked
to the outbreak of food poisoning?
A. Milk
C. Banana
B. Chocolate
D. Potato Salad
When would pre-implantation genetic diagnosis occur?
A. The egg cell
B. The zygote
C. The blastocyst
D. The sperm cell
Food Survey Results
Sick Well Total Attack Rate
42
24
66
42/66=64%
35
24
59
35/59=59%
45
15
60
45/60=75%
Food Survey Results
Food
Sick
Well
Milk
45
24
Banana
20
11
Cheese Pizza
10
48
Chicken
40
24
Potato Salad
43
10
Chocolate
18
10
Ice Cream
36
23
Total
69
31
58
64
53
28
59
27.
There are over 100 alleles known for the gene associated with cystic fibrosis. It is possible to determine exactly
which allele or alleles a person carries. What is the maximum number of alleles a person can have for this gene?
A. 1
C. 2
B. 16
D. As many as there are alleles of the gene (~100 in this case)
28.
Imagine you're counseling a couple that has undergone carrier screening for Tay-Sachs disease. The man is a
carrier, and the woman does not carry the Tay-Sachs allele. How should you advise them?
A. They should be informed that if they conceive a child, the child will have Tay-Sachs disease.
B. They should be informed that if they have a child, there is a 25% chance that the child will have Tay-Sachs.
C. They should be informed that if they have a child, there is a 50% chance that the child will have Tay-Sachs.
D. They should be informed that if they have a child, the child will not have Tay-Sachs disease but will have a
50% chance of being a carrier of the Tay-Sachs allele.
2.1.2
29.
30.
To complete a polymerase chain reaction, geneticists must add free-floating nucleotides to the segments of DNA
they plan to copy. Imagine that of the nucleotides added, 12% of those that attach to the DNA segments are
thymine bases. If that is true, what percentage of bases that attached are guanine bases?
A. 12%
C. 24%
B. 76%
D. 38%
A thermal cycler is programmed with the following for each cycle:
94°C for 45 seconds - Denature
45°C for 45 seconds - Anneal
72°C for 45 seconds - Extend
You conduct a PCR. How many copies of your target gene will there be after 15 cycles? How long will this take?
A.
B.
C.
D.
215 = 32,768 copies of target gene; 29 minutes and 15 seconds
213 = 8,192 copies of target gene; 29 minutes and 15 seconds
215 = 32,768 copies of target gene; 33 minutes and 45 seconds
213 = 8,192 copies of target gene; 33 minutes and 45 seconds
31.
During PCR, if the geneticist selected the wrong primers to use, which of the following would result?
A. The DNA would not denature during the “melt” step
B. Gene synthesis would occur, but the wrong gene would be copied
C. The nucleotides could not attach to the DNA strands, so no new strands would be synthesized
D. The correct portion of DNA would be synthesized, but would not glow properly when exposed to laser light
2.1.3/2.1.4
Observe the SNP of a nontaster, a person who cannot taste PTC, and a taster, a person who can taste PTC, shown below.
The restriction enzyme, HindIII cuts at GGCC. Use that information to answer the next 3 questions.
NONTASTER (tt)
GGCGGGCACT
CCGCCCGTGA
TASTER (TT)
GGCGGCCACT
CCGCCGGTGA
32.
Explain how a weak taster is possible after the above SNPs are digested with HaeIII.
A. The weak taster receives a non-taster gene from each parent. Both strand are cut by the restriction enzyme.
B. The weak taster receives a non-taster gene from one parent and a taster gene from the second parent. Both
strands are cut by the restriction enzyme.
C. The weak taster receives a non-taster gene from one parent and a taster gene from the second parent.
One strand is cut by the restriction enzyme while the other remains intact.
D. The weak taster receives a taster gene from each parent. One of the strands is cut by the restriction enzyme
while the other remains intact.
33.
In 2.1.3 Test Your Own Genes, you extracted your DNA to
identify non-tasters, tasters, and supertasters. Given the
results shown, which wells show the super-tasters?
A. 1, 6, 8
B. 2, 5, 10
C. 3, 4, 7, 9
D. 2, 7 & 10
34.
The U lane indicates the sample has not been digested.
The D lane indicates the sample has been digested
with HindIII. Which lane shows a person with the
genes for the non PTC-taster?
A. Lane 1
B. Lane 2
C. Lane 4
D. Lane 6
35.
2.1.5
36.
The plasmid shown can be digested using
either BamHI, EcoRI, or both. Which lane
shows the DNA that was digested using only
BamHI?
A. I
B. II
C. III
D. IV
A woman in her early forties is pregnant and is 10 weeks past her menstrual cycle. The doctor is concerned
about genetic disorders and wants to do a karyotype of the baby. To make the karyotype the doctor should
perform which of the following.
A. Amniocentesis
C. Chorionic villus sampling
B. Either technique should work
D. Neither technique will work for this situation.
37.
2.2.1
38.
2.2.2
39.
3.1.1
40.
3.1.2
41.
3.1.3
42.
43.
3.1.4
44.
The karyotype to the right is of a developing child from a 42-yearold woman. Which of the following descriptions best matches the
karyotype?
A. Female with trisomy 21.
B. Male with trisomy 13.
C. Female with trisomy 13.
D. Female with monosomy 20.
In genetic engineering, what is the term vector used to describe?
A. the DNA probe used to locate specific genes
B. the restriction fragment taken from the subject organism
C. the enzyme that cuts DNA into restriction fragments
D. the plasmid or other agent used to transfer DNA into cells
Maya and Armond Harris have been trying for years to get pregnant. Their last two attempts at in vitro
fertilization (IVF) have been unsuccessful. The doctor suggests using preimplantation genetic diagnosis (PGD).
What would PGD allow that would help the couple?
A. A way to make and exact genetic replica of a part with a donor egg.
B. A way to analyze chromosomes and pinpoint the strongest embryos
C. A way to sample the placental tissue for chromosomal abnormalities at 10-12 weeks gestation.
D. A way to select the sex of the baby.
In addition to the sun, what is considered a risk factor for skin cancer?
A. Family history
C. Multiple moles or atypical moles
B. Scars from disease or burns
D. All of the above
Which of the following is NOT true of x-ray and computerized tomographic testing?
A. Non-invasive
C. It is widely available
B. Completely harmless
D. Quick and painless
The cell cycle consists of S phase, G2 phase, Mitosis, and the G1 phase. Human papillomavirus (HPV) is thought
to inhibit the action of the Rb protein in cervical epithelial cells. The Rb protein inhibs cells from entering S
phase. What would be the effect of cervical cells being infected with HPV?
A. The number of cells in the G1 phase of the cell cycle would increase.
B. The mitotic rate would increase.
C. The mutation rate would decrease.
D. The growth of cervical cells would decrease.
While looking at a biopsy what would you notice about the cell if the cell were cancerous?
A. Low cytoplasmic ratios
B. Abnormal cell shape
C. Large number of dividing cells – does not show contact inhibition
D. All of the above
A researcher performs a DNA microarray but forgets to add the enzyme reverse transcriptase. This is important
because the enzyme makes _____ from a(n) _____ template.
A. cDNA … DNA
B. mRNA … DNA
C. cDNA … mRNA
D. mRNA … RNA
45.
3.1.5
46.
3.2.1
47.
3.2.2
48.
3.2.3
49.
DNA microarrays have made a huge impact on genomic studies because they
A. can be used to eliminate the function of any gene in the genome.
B. can be used to introduce entire genomes into bacterial cells.
C. allow expression of many or even all of the genes in the genome to be compared
D. allow physical maps of the genome to be assembled in a very short time.
The Pearson Correlation Coefficient is a tool used in understanding the behavior of gene expression. A positive
ratio means a gene is induced in cancer cells and is transcribed at a higher rate. A negative ratio means a gene is
suppressed in cancer cells or is transcribed less frequently than in normal cells. What form of gene expression do
you think would lead to a correlation coefficient of one?
A. the gene is not expressed in cancer cells nor normal cells
B. the gene is being expressed at an equal rate in both cell types
C. the gene is no longer existent in cancer cells
D. the gene is more active in cancer cells than in normal cells
Prostate cancer is the most common form of cancer specific to men. The Cancer Society estimates that 1 in
every 6 men will be diagnosed with prostate cancer. Which risk factor category best applies to prostate cancer?
A. Behavioral
B. Biological
C. Environmental
D. Genetic
Yeast is a eukaryote thus it can be used as a comparison of our own mammalian cells. In the Skin Cancer lab,
you and your partner devised a way to test the effectiveness of a UV protectant (sunscreen, sunglasses, etc.) .
How was the mutant strain of yeast used to demonstrate this effectiveness?
A. The mutant yeast cells use a similar enzyme as humans to repair their DNA.
B. The mutant yeast cells couldn’t repair its own DNA when exposed to the sun
C. The mutant yeast cells repaired its DNA when exposed to the sun
D. The mutant yeast cells DNA was fried when it was exposed to the sun.
Approximate the size (in base pairs) of the unknown band in the figure to the right.
A. 100 bp
B. 350 bp
C. 550 bp
D. 900 bp
50.
Gel electrophoresis separates DNA molecules on the basis of size. Which of the
following would move the slowest?
A. pBr322 (4.39 kb)
C. F plasmid (100 kb)
B. Lambda phage (49 kb)
D. pUC18 (2.69 kb)
51.
A single nucleotide polymorphism (SNP) is detected in an inheritable disorder that deletes the restriction site for
HindIII. When the DNA from two individuals is cut with this enzyme (one with and one without this disorder) and
then analyzed by gel electrophoresis, the resulting samples will be _____.
A. All of the same size, whether or not they have this particular disorder
B. Ccompletely different sizes, independent of whether they have this disorder
C. Different; The person with the disease will have more fragments than an individual without the disorder
D. Different; The person with the disease will have fewer fragments than an individual without the disorder
3.2.4
52.
Which of the following statements regarding viral diseases is false?
A. RNA viruses tend to have high rates of mutation - their RNA genomes cannot be corrected by proofreading.
B. New viral diseases often emerge when a virus infects a new host species.
C. Very few new human diseases have originated in other animals - the genetic differences are too great.
D. Some new viral diseases arise as a result of a mutation of existing viruses.
53.
3.2.5
54.
3.3.1
55.
56.
3.3.3
57.
3.3.4
58.
3.4.1
59.
60.
Viruses are non-living particles that contain DNA or RNA surrounded by a protein capsid. They attach themselves
to a host cell, insert their genetic material into the cell, and then completely take over all of the cell processes.
When viruses insert their DNA or RNA into the host cell, the host cell’s genes are mutated. These mutations can
sometimes cause the cell to become cancerous. Which of the following viruses does not have known
associations with particular cancers?
A. Hepatitis B
B. HPV
C. Epstein Barr Virus I
D. Influenza
Some women should be screened for breast cancer with an MRI in addition to a mammogram. Women will be
placed into this high risk category due to:
A. Lumpy breast, they nursed their children, and they have a family history.
B. Exposure to DES (synthetic estrogen carcinogen), a diet high in fiber, hormone replacement therapy afte.
C. Menstruation before the age of 12, diet high in fats, family history
D. They nursed their children, had babies before the age of 30, menstruation before the age of 12.
Radiation therapy kills cancer cells. In addition it can cause changes such as:
A. Skin damage
B. Fatigue
C. Hair loss
D. All of the above
Chemotherapy is used for all of the following purposes except
A. To cure cancer
C. To control cancer
B. To ease the symptoms of cancer
D. To stop cancer growth at just a specific site
A myoelectric prosthesis works under what power?
A. Voice commands
B. Contraction of your own muscles
C. Preprogrammed computerized movement
D. Mechanical controls
What is a major difference between an occupational therapist and a physical therapist?
A. Physical therapy tends to be more focused on evaluating and diagnosing movement dysfunctions as well as
treating a person’s injury itself.
B. Occupational therapy tends to focus more on evaluating and improving a person’s functional abilities.
C. Both A and B are correct.
D. The inverse of both A and B is correct.
In activity 3.4.1, you met four 8-year-old girls who have ALL (acute lymphoblastic leukemia). Each was being
given the same dosage of a chemotherapy drug azathioprine. Renee was responding well to treatment with no
side effects, Su and Jada have shown some improvement but will require additional treatments, and Maggie is
not responding to treatment at all and is in experiencing severe side effects. How is it that four girls with the
same disease, the same dosage, and given the same environment experience such different results?
A. Maggie’s cancer has built up an immunity to the chemotherapy- similar to bacteria resistance.
B. Renee must have a weakened form of cancer.
C. Given time, they will all develop side effects, and eventually the chemotherapy will be effective.
D. People with different haplotypes will respond differently to treatment.
TPMT enzyme degrades thiopurine over time. Why does the patient with the lowest levels of the TPMT enzyme
have the greatest number of side effects when exposed to a drug containing a thiopurine?
A. Thiopurine levels are too high in in the patient.
C. The body needs TPMT enzyme to kill cancer cells
B. Thiopurine will kill normal cells, not cancer cells
D. All of the above
61.
Three individuals are each taking a cancer drug. Patient 1 with gene sequence CCAATG is responding to the drug
and has no side effects. Patient 2 with gene sequence CCTATG responds to the drug but has some side effects.
Patient 3 with gene sequence CCAATA is responding poorly and has many side effects. If a new patient with
gene sequence CCAATG is diagnosed with the same type of cancer how would he respond to this cancer drug?
A. Good response and no side effects
B. Good response with some side effects
C. Poor response with many side effects
3.4.3
62.
3.4.4
63.
An orphan drug trial would be most appropriate for a drug used to treat which of the following:
A. Osteosarcoma, the most common form of cancer in ages 10-19
B. Diabetes Mellitus, also called type 1 diabetes
C. Huntington’s, a rare genetic disorder caused by a single gene polymorphism
D. Congenital heart failure, in which the heart cannot pump enough blood to the organs
Which of the following is not an example of a nanotechnology targeted treatment?
A. Liposomes are being used as drug delivery vehicles in several products.
B. Particulate iron oxide particles can be used with magnetic resonance imaging (MRI) to accurately detect
metastatic lesions in lymph nodes without surgery.
C. Chemotherapeutic and radioactive agents are being targeted directly to cancerous cells by attaching
antibodies that seek out molecules on their cell surface.
D. All of the above are examples.
4.1.2
64.
LB
-pGLO
LB amp
-pGLO
A.
B.
LB amp
+pGLO
4.1.3
65.
66.
LB amp/ara
+pGLO
C.
D.
Shown to the left are the results of the transformation portion of
the pGLO lab. Which of the following is a true statement?
If bacteria from the top left plate were transferred onto the top
right plate, there would be a bacterial lawn within a couple of days
If colonies on the bottom left plate were placed in a broth with
arabinose sugar and then incubated, they would glow green
Colonies on both bottom plates would glow if exposed to UV light
If the ampicillin had not been present on the bottom 2 plates, no
bacteria would have grown on the plates
Which of the following properties was used during chromatography to isolate green fluorescent protein
molecules from other bacterial cell proteins?
A. Length of polypeptide chain
C. Molecular weights
B. pH
D. Hydrophobicity
The final step of producing and isolating the GFP protein was protein electrophoresis using SDS-PAGE. Which of
the following statements accurately describes how SDS-PAGE separates proteins?
A. The SDS cuts the proteins into segments using restriction enzymes, and the segments are compared to
standards.
B. The SDS changes the environment around the proteins so that the hydrophobic areas of the protein
bend outward to attach to the hydrophobic regions of the PAGE.
C. The SDS denatures the proteins by unfolding it and neutralizing any charged areas of the proteins,
allowing the proteins to be separated based only on size.
D. None of the above.
67.
4.1.4
68.
4.1.5
69.
4.2.1
70.
71.
4.3.2
72.
Proteins have a unique structure based on the sequence of their amino acids. GFP is a highly hydrophobic
molecule because of its many water-fearing amino acids. Using a column filled with porous beads and a series
of buffer solutions, the GFP proteins can be trapped in the beads of the column and then washed out and
collected. What property must the beads possess in order to trap GFP?
A. Hydrophilic
B. Basic
C. Acidic
D. Hydrophobic
Proteins are separated in a SDS-PAGE protein gel electrophoresis experiment based on their
A. Positively charged side chains
C. Molecular weight
B. Negatively charged side chains
D. Differences in charges
Which statement properly sequences the steps involved in protein manufacturing?
A. Recombinant DNA Plasmid Creation, Transformation, Protein Purification, Protein Electrophoresis, and Sales
and Marketing
B. Recombinant DNA Plasmid Creation, DNA Isolation, Transformation, Protein Purification, Protein
Electrophoresis, and Sales and Marketing
C. DNA Isolation, Recombinant DNA Plasmid Creation, Transformation, Protein Electrophoresis, Protein
Purification, and Sales and Marketing
D. DNA Isolation, Recombinant DNA Plasmid Creation, Transformation, Protein Purification, Protein
Electrophoresis, and Sales and Marketing
What would be the best diagnosis for a
patient that has the following symptoms:
muscle cramps, muscle tone loss, recurrent
urinary tract infection, bad breath and fluid
retention? Lab results show the following:
A. Diabetes
B. Renal failure
C. Heart disease
D. Hypothyroid disease
Result(s):
60 mg/dL
2.8 mg/dL
7.1 mEq/L
3.6 million cells/mcL
13 mL/min
Presence of red blood cells
Presence of white blood cells
High levels of albumin (300 mg/dL)
140/90 mmHg
Normal
Test:
Blood Urea Nitrogen Levels
Blood Creatine Levels
Blood Potassium Levels
Red Blood Cell Count
Glomerular Filtration Rate (GFR)
Urinalysis
Blood Pressure
EKG
Which of the following lab results is out of normal range and best confirms your diagnosis?
A. Blood Pressure: 120/75 mmHg
C. EKG: normal
B. RBC: 4.0 million/μL
D. Urine: RBC’s present, high levels of albumin, low levels of urea
Use the chart below to
determine blood types and
answer the following
question.
Based on blood typing alone,
who can donate a kidney to
Adele?
A.
B.
C.
D.
Eminem & Mariah Carey
Ed Sheeran & Ice Cube
Spice Girls and Cam
Hozier, Spice Girls, &
Cam
Blood Sample
Adele
Eminem
Ice Cube
Spice Girls
Ed Sheeran
Mariah Carey
Hozier
Kayne West
Cam
Agglutination with
Anti-A Serum (+/-)
Agglutination with
Anti-B Serum (+/-)
Agglutination with
Anti-Rh Serum (+/-)
+
+
+
+
+
-
+
+
+
+
+
-
+
+
+
+
-
73.
74.
4.3.3
75.
4.3.5
76.
77.
4.3.6
78.
4.4.1
79.
4.4.3
80.
Based on the
data table, how
many people
have only ONE
possible
genotype?
A. 1
B.
Blood
Sample
Jennifer
Judy Smith
Sue Smith
Emily Jones
2
Agglutination with
Anti-A Serum (+/-)
+
+
C. 3
Agglutination with
Anti-B Serum (+/-)
+
+
Agglutination with
Anti-Rh Serum (+/-)
+
+
+
Blood
Type
Possible
Genotype(s)
D. 4
Based on the data table above, which of these people would be a good donor for a person with Type A- blood?
A. Judy
B. Jennifer
C. Sue
D. Emily
E. Jennifer and Judy
All of the following are examples of limits or diseases that rule out organ donation EXCEPT
A. HIV-positive status
C. if candidate is over 70
B. actively spreading cancer
D. severe infection
List the following as a patient may see them in the course of an organ transplant:
A. Perioperative Nurse, Surgeon, Pharmacist, Nurse, Anesthesiologist
B. Nurse, Perioperative Nurse, Anesthesiologist, Surgeon, Pharmacist
C. Anesthesiologist, Nurse, Surgeon, Perioperative Nurse, Pharmacist
D. Pharmacist, Perioperative Nurse, Anesthesiologist, Nurse, Surgeon
Which of the following is necessary for post-transplant patients?
A. Tissue typing checkups once every 5 years to make sure that the organ is not being rejected.
B. Additional surgeries to repair damage due to the previously damaged organ.
C. MRI scans once every 3 years to check on proper blood flow and function of the new organ.
D. A lifelong requirement to take immunosuppressive drugs.
Despite a waiting list of 80,000 individuals, kidney transplantation is more common than heart transplantation.
Which of the following is a reason for this?
A. Kidney transplantation does not require HLA compatibility
B. Heart transplantation requires lower HLA compatibility
C. Kidney transplantation may involve a living donor
D. Heart transplantation must be performed laproscopically
Which of these would be considered an example of xenotransplantation?
A. Transplanting a new human heart into a patient that had already received and rejected one donor heart
B. Transplanting synthetic materials into an organic organ, as in the case of a cochlear ear implant
C. Taking a skin graft from one part of the body and transplanting it to another area of the body
D. Transplanting pancreatic beta cells (islets of Langerhans) from a pig into a patient with diabetes
A blind man walks into a supermarket store with a guide dog in a harness. With the help of his guide dog, this
man has crossed a quarter of a mile from his apartment to the supermarket, crossing several major intersections
in the process. Based on your understanding of what a medical intervention is, is a guide dog a type of medical
intervention? Why or why not?
A. Yes, because it is legal to use guide dogs and other service animals.
B. Yes, because it is intended to improve the quality of life of an individual with a medical issue.
C. No, because it is not a form of medicine or medical testing.
D. No, because medical interventions can only be a form of drug or technology, not living things.