Download current micro 40/5 - Bashan Foundation

CURRENT MICROBIOLOGY Vol. 40 (2000), pp. 315–321
DOI: 10.1007/s002849910063
An International Journal
R Springer-Verlag New York Inc. 2000
Transcriptional Analysis of Hydrogenase Genes in the Cyanobacteria
Anacystis nidulans and Anabaena variabilis Monitored by RT-PCR
Gudrun Boison,* Hermann Bothe, Oliver Schmitz
Botanisches Institut, Universität zu Köln, Gyrhofstr. 15, D-50923 Köln, Germany
Received: 22 October 1999 / Accepted: 22 November 1999
Abstract. Diverse cyanobacteria express an uptake hydrogenase, encoded by the genes hupSL, and a
bidirectional, NAD(P) ⫹-reducing hydrogenase with the genes hox(E)FUYH. In the unicellular Anacystis
nidulans, the hox genes are organized on two separate loci, whereas they are contiguous in one cluster,
though interspersed with two unidentified reading frames, ORF 3 and 8, in the heterocystous Anabaena
variabilis. The hox gene clusters of these two cyanobacteria have now been transcriptionally analyzed by
RT-PCR. A polycistronic transcript was identified in both cyanobacteria. In A. nidulans, one message for
each locus has been detected, the dicistronic hoxEF unit, and the polycistronic hoxUYHWhypAB one. In
A. variabilis, the transcript consists of the hox genes hoxFUYH as well as the unidentified ORFs. Previous
enzyme determinations on the occurrence of the uptake hydrogenase in vegetative cells and thus outside of
heterocysts gave ambiguous results. Therefore, transcription of both hup and hox genes has been analyzed
in both heterocysts and vegetative cells of A. variabilis. A hupL transcript is detectable in heterocysts and
also, though less extensive but clearly discernible, in vegetative cells of NH4⫹-grown A. variabilis.
In cyanobacteria, two different NiFe-hydrogenases have
been characterized physiologically, biochemically [19,
29], and recently on the molecular level by identifying
and sequencing the genes [1, 3, 4, 6, 15, 17, 26, 28, 34].
One of these enzymes, the so-called uptake hydrogenase,
catalyzes only H2-oxidation in vitro. It has been described
to be confined mainly [10] or exclusively [30] to heterocysts, where it utilizes the H2 formed in parallel with
N2-reduction catalyzed by nitrogenase. This hydrogenase
transfers the electrons from H2 to either photosystem I or
to the respiratory electron transport chain to O2 [9]. Thus,
the uptake hydrogenase seemingly has a beneficial role
for the cells by providing energy and reductant for
N2-fixation and other metabolic processes. The genes of
this dimeric hydrogenase are hupL and hupS coding for
the large and small subunit, respectively. They have been
described for Anabaena sp. PCC 7120 [6], Nostoc sp.
PCC 73102 [28], and A. variabilis [17]. The hupL gene
undergoes a programmed DNA rearrangement during
heterocyst differentiation in A. PCC 7120 [6, 24], but not
* Present address: Folkehelsa, National Institute of Public Health,
Postboks 4404 Torshov, N-0403 Oslo, Norway.
Correspondence to: G. Boison at Oslo
in N. PCC 73102 [28] and A. variabilis [2; G. Boison,
unpublished].
The bidirectional hydrogenase catalyzes in vitro not
only H2-uptake, but also the Na2S2O4/methylviologendependent evolution of the gas. The enzyme is active in
heterocysts as well as in vegetative cells and in cells of
unicellular cyanobacteria [19, 29]. It occurs in most
species so far examined, but is missing in the filamentous
strain N. PCC 73102 [5, 39]. The bidirectional hydrogenase genes have been characterized for A. variabilis
[34], A. nidulans [3, 4], and Synechocystis sp. PCC 6803
[1, 26]. They are highly homologous to those coding for
the NAD⫹-reducing hydrogenase of Alcaligenes eutrophus [11] and the NADP⫹-dependent hydrogenase of
Desulfovibrio fructosovorans [22]. Sequence comparisons and protein purifications indicated that the cyanobacterial enzyme consists, like the one of A. eutrophus, of
two entities [34, 37]. The hydrogenase dimer HoxYH
catalyzes the H2-oxidation, whereas the diaphorase moiety HoxFU acts in transferring electrons to NAD(P)⫹.
These implications from sequence data have been ascertained by enzyme measurements in crude extracts from
A. nidulans [32]. An additional ORF, termed hoxE [1],
described for unicellular strains, has been suggested to
316
code for a third diaphorase subunit [4]. The diaphorase
subunits Hox(E)FU have been discussed to also serve as
components of the NADH:ubiquinone oxidoreductase of
respiratory complex I [1, 4, 5, 33].
In A. variabilis and S. PCC 6803, different ORFs of
unknown functions are interspersed within the hox cluster
at different positions [4]. In contrast, the hox genes of A.
nidulans are contiguous, but hoxEF and hoxUYH are
located on different loci. A gene set coding for accessory
hydrogenase proteins is located downstream of hoxUYH
in A. nidulans. These genes are spread over the genome in
S. PCC 6803 [26] and have not yet been characterized for
A. variabilis.
Although the hydrogenase genes from several cyanobacteria have been described up to now, transcript
analyses of the hup and hox genes have been performed
solely for Nostoc muscorum CCAP 1453/12 [2]. By
RT-PCR, these authors demonstrated a constitutive transcription for hoxH both under N2- and non-N2-fixing
conditions, whereas a hupL transcript was detected under
N2-fixing conditions only. Currently, the operon structure, location of promoters, and regulation of transcription are still unknown for this and all other cyanobacteria.
In particular, no information is available whether the
unidentified ORFs in the hox clusters are transcribed at
all.
The complete transcriptional analyses of the hoxclusters of A. variabilis and A. nidulans are shown by
RT-PCR in the present communication. Experiments with
isolated heterocysts and vegetative cells of A. variabilis
have also been performed to examine the occurrence of
transcripts of the uptake and the bidirectional hydrogenase in both cell types.
Materials and Methods
Culture and growth of cyanobacteria. A. nidulans (⫽ Synechococcus
leopoliensis sp. PCC 6301), purchased from the Algensammlung des
Pflanzenphysiologischen Instituts der Universität Göttingen, Germany
(SAUG 1402-1) and A. variabilis ATCC 29413 were grown in BG11
medium with or without nitrate as described [34]. To obtain heterocystfree cultures of A. variabilis, cells were grown in nitrate-free BG11
medium with 5 mM NH4Cl. The medium was buffered with 2.1 mM
HEPES and adjusted to pH 8.0 with NaOH prior to autoclaving.
NH4⫹-grown A. variabilis filaments were free of heterocysts as
examined by light microscopy.
Heterocyst preparation. The preparation of heterocysts from N2-fixing
cultures of A. variabilis [13] was slightly modified. An N2-fixing culture
(750 ml) was harvested by centrifugation (10 min, 3000 g, 4°C). The
pellet was resuspended in 5 ml cold (4°C) STET (8% sucrose, 5% Triton
X-100, 50 mM EDTA pH 8.0, 50 mM Tris-Cl pH 8.0) with 1 mg/ml
lysozyme and vortexed (2–3 min, 25°C). Further homogenization was
achieved by sonification (Ultrasonics model W-225R, maximal output,
3 min on ice). Intact heterocysts were separated from broken vegetative
cells by centrifugation (5 min, 3000 g, 4°C). The sedimented heterocysts were washed 4⫻ in SET (as STET, without Triton) followed by
centrifugation (5 min, 4°C) with decreasing g-values (2000 g, 300 g,
CURRENT MICROBIOLOGY Vol. 40 (2000)
2 ⫻ 200 g). The last pellet was frozen in liquid nitrogen for subsequent
RNA preparation. The heterocyst fraction was controlled microscopically and revealed no contaminating vegetative cells.
Isolation of total RNA. Total RNA from both A. variabilis and A.
nidulans was isolated by a combination of different standard techniques
with the RNeasy Kit supplied by Qiagen (D-Hilden). In the case of A.
variabilis, either 50 ml of an N2-fixing or NH4⫹-grown culture or the
heterocyst preparation from 750 ml of an N2-fixing culture were
harvested and frozen in liquid nitrogen. Cells were crushed with a pestle
and mortar in liquid N2 in the presence of 1 ml RLT buffer from the
RNeasy Kit, supplemented with 10 µl ␤-mercaptoethanol, were then
heated (2 min, 50°C), extracted once with acidic phenol/chloroform/
isoamylalcohol (25/24/1, vol/vol/vol) and twice with chloroform/
isoamylalcohol, followed by centrifugation in a microfuge (5 min,
18,000 g, 4°C). The supernatant was purified with the columns of the
RNeasy Kit according to the manufacturer’s protocol. The RNA was
eluted from the column twice with 30 µl H2O, and the two fractions
were combined. To remove contaminating DNA, the eluate was
precipitated with 3 vol of 4 M Na-acetate pH 7.0 (1 h, ⫺20°C). The RNA
sedimented in a microfuge (20 min, 5000 g, 0°C), and the pellet was
resuspended in 50 µl DEPC-H2O. The amount and purity of the RNA
was determined from the optical density at 260 nm and 280 nm. Each
preparation was monitored for contaminating DNA on an agarose gel
and also by PCR.
Total RNA from A. nidulans was prepared in a different way (K.-P.
Michel, D-Bielefeld, personal communication) from 20 ml cells, which
were harvested by centrifugation (10 min, 4000 g, 4°C), washed in 1 ml
Bgl1 medium, centrifuged, and resuspended in 100 µl TE buffer. After
addition of 350 µl RLT buffer from the RNeasy Kit (supplemented with
␤-mercaptoethanol), the cells were vortexed extensively and placed on
ice. Lysis was completed by incubating in 300 µl prewarmed acidic
phenol (10 min, 65°C) and vortexing. After addition of 300 µl
chloroform/isoamylalcohol and vortexing, the preparation was centrifuged (5 min, 18,000 g, 4°C), and extracted 1–2⫻ by chloroform/
isoamylalcohol. The supernatant was then transferred to the RNeasy Kit
column and treated as in the case of A. variabilis RNA.
Reverse transcription (RT) and PCR. Prior to RT, 2 µg RNA was
digested with 2 U DNase (deoxyribonuclease I, amplification grade,
Gibco/BRL) in a volume of 20 µl (15 min, 25°C) with the buffer
supplied by the manufacturer. The digestion was stopped by adding 2 µl
25 mM EDTA and incubating (10 min, 65°C). The sample was split into
two aliquots. One was filled up to 20 µl with DEPC-H2O and used as a
control. The other was used for reverse transcription with Superscript II
(RNase H⫺ reverse transcriptase, Gibco/BRL) according to the manufacturer’s protocol, with the following exceptions: Sequence-specific
primers were used (2 pmol, Table 1), the amount of reaction buffer was
reduced to 2.6 µl, the assay was incubated (2 min, 47°C), 200 U
Superscript II was added, and the incubation was continued (50 min,
47°C). No RNase H digestion was performed. The PCR was performed
either with 2 µl (up to 5 µl) of the cDNA obtained by the transcription
reaction, 2 µl (up to 5 µl) of the control tube, or 2–5 ng genomic DNA in
a 50-µl assay (100 pmol of each primer, 2 mM MgSO4, 2 U Taq
polymerase from Promega) running 35 cycles after 4 min at 95°C
(program: 1 min 92°C, 1 min 50/56°C for A. variabilis/A. nidulans,
respectively, 1.5 min 72°C) and a final elongation step of 7 min at 72°C.
The PCR products obtained were separated on 1–1.5% horizontal
agarose gels with 10 µl of each reaction.
Results
Transcriptional analysis of the hox cluster of A.
nidulans. Total RNA of A. nidulans prepared from exponentially growing cultures was digested by DNase to
317
G. Boison et al.: Hydrogenase Genes in Cyanobacteria
Table 1. Primers used for reverse transcription and subsequent PCR.
The positions of the primers refer to the nucleotide numbers of the
corresponding EMBL entry: AN ⫽ Anacystis nidulans: Y13471
(hoxEF), X97797 (hoxU–hypF); AV ⫽ Anabaena variabilis: X79285,
7120 ⫽ Anabaena PCC 7120: U08013.1. Reverse primers are marked
by an asterisk. IS F/U: intergenic spacer between hoxF and hoxU
Primer
Gene/
specificity
EAn1
EAn2
FAn1
FAnv3
FAn4
FAv1
FAv2
FAv4
Av6
UAn1
UAn2
UAn3
UAv2
UAv3
8Av1
8Av2
YAnv1
YAnv2
YAv3
HAn2
HAnv3
HAv1
W1
W2
A1
A2
B4
B5
hypF1
hypF2
H4A [39]
H6B [39]
hoxE-AN
hoxE-AN
hoxF-AN
hoxF-AN
hoxF-AN
hoxF-AV
hoxF-AV
hoxF-AV
IS F/U-AV
hoxU-AN
hoxU-AN
hoxU-AN
hoxU-AV
hoxU-AV
ORF8-AV
ORF8-AV
hoxY-AN
hoxY-AN
hoxY-AV
hoxH-AN
hoxH-AN
hoxH-AV
hoxW-AN
hoxW-AN
hypA-AN
hypA-AN
hypB-AN
hypB-AN
hypF-AN
hypF-AN
hupL-7120
hupL-7120
Sequence 58 = 38
Position
ctacttctgaaacgacaccc
cttggacttgttgccagacc
atttggggcgtttggctaac
tttcaagccggtgggatagc
tggtagtcatggacgag
gatcgctgcctatgctgtgg
accaagaccacacaagctgg
tcagtctgcacctaatccgg
gcgccagtttccccttcaag
gatgtctgtcgtcaccttac
gtgcttcggccaagaacgc
agacgacagcgtcctac
ggtaaatgcgtcaatgcttg
aacacggatgcagcgagtac
tgtcgatgtgcttatctccg
tgccaatcttgaacaacgcg
gmtgttcgggytgccayatg
armggcggcacaattccggg
aaggacatatgacagccagaac
caggaaaggcagggrtcaaar
gtaagtgaggcacctmgtggk
atactaatcttggcgtgacc
cactccaccatccgtgcaatcg
gtaatcggctatggcaatgc
cgcagcaaatcgtcagtctg
ggaacaggcagctaacagcg
tgccagcgatcgcttcc
atcgtgggtgatctggc
cgctcagattgaagtgg
gtgcgattgcgatcgtaggg
gaagtcggccccctagcccgc
gtggacagtacacaccagacaagagtcaaa
78–97
*529–548
584–603
*1085–1104
1853–1869
831–850
*1661–1680
1680–1699
*2373–2392
0–19
*673–691
*130–146
3298–3317
*3164–3183
3602–3621
*4096–4115
742–761
*1083–1102
*4253–4274
*2588–2608
2385–2405
*5560–5579
*2899–2920
2717–2736
3221–3240
*3401–3420
*3427–3443
3736–3752
4436–4452
*4740–4759
2189–2209
*2642–2671
remove any residual DNA. All preparations were controlled for contaminating DNA by PCR with appropriate
primers (not documented, but see Fig. 3). The DNA-free
RNA aliquots were used for several RT assays with an RT
primer for the 38 end of each gene of the hox cluster (Fig.
1, Table 1). The cDNA fractions obtained were used in
PCR reactions. By applying primer pairs for each gene
lying upstream of the primer that was used for the reverse
transcription, co-transcription of genes could be demonstrated (Fig. 1).
The data obtained indicated that the potential diaphorase gene hoxE [4] is co-transcribed with hoxF. PCR
amplificates have been obtained both for hoxE and hoxF
with the same cDNA generated with primer FAnv3. No
amplificate of either hoxE or hoxF was obtained from
cDNA generated by primer UAn2, thus ascertaining that
hoxEF are transcribed separately from the residual hydrogenase genes. By using either RT primer B4, A2, W1,
HAn2, YAnv2, or UAn2 (Table 1) followed by PCR on
all cDNAs generated, transcription of all genes lying
upstream of the corresponding RT primer was demonstrated (Fig. 1). This implies that the genes hoxUYHWhypAB
are transcribed as a unit. Transcription of hypF has also
been shown. However, no PCR products of the expected
size were obtained with the primer pairs A1/B4 and
B5/hypF2 with cDNA generated with RT primer hypF2.
This might indicate that hypF is transcribed separately
from hoxUYHWhypAB.
Transcriptional characterization of the hox cluster
from A. variabilis. In the same way as for A. nidulans,
DNA-free total RNA of A. variabilis was transcribed with
reverse primers for the genes hoxF, hoxU, ORF8, hoxY,
or hoxH (Fig. 2). Subsequent PCRs with corresponding
primers (Table 1) resulted in amplificates for hoxF with
cDNA derived from RT primer FAv2. Similarly, amplificates consisting of part of hoxF and part of the intergenic
spacer between hoxF and hoxU were obtained with cDNA
derived from both RT primers UAv3 and 8Av2. With the
latter RT primer, transcription of ORF8 was also shown
in a PCR with primers 8Av1 and 8Av2. In addition, a
combined amplificate for hoxU(part)/ORF8/hoxY(part)
with cDNA derived from RT primer YAv3 as well as a
combined amplificate for hoxY(part)/ORF3/hoxH(part)
with cDNA derived from reverse primer HAv1 was demonstrated (Fig. 2). Thus, ORF8 and ORF3 are co-transcribed
with the adjacent hox genes. In view of all these data,
co-transcription of hoxFhoxUORF8hoxYORF3hoxH is
expected.
Transcriptional analysis of hox and hup genes in heterocysts and vegetative cells of A. variabilis. N2-fixing
A. variabilis cultures from the exponential growth
phase were harvested and split into two fractions. One
was used for immediate preparation of total RNA; the
other part was subjected to heterocyst isolation followed
by RNA preparation. Total RNA of vegetative cells
was obtained from NH4⫹-grown cultures, which were
free of heterocysts, as indicated by microscopic examination.
The transcription of hox genes of both the diaphorase
entity (HoxFU) and the hydrogenase dimer (HoxYH)
was detected in all three RNA preparations (N2-grown
filaments, heterocysts, NH4⫹-grown filaments) by the
RT-PCR protocol described above (Fig. 3). With RT
primer H6B for the 38 part of hupL, coding for the
large subunit of the uptake hydrogenase [6], a strong
signal became visible with the primer pair H4A/H6B
for the heterocyst fraction and for RNA isolated from
318
CURRENT MICROBIOLOGY Vol. 40 (2000)
Fig. 1. Transcriptional analysis of the hox loci of Anacystis nidulans by RT-PCR. Primers used in the reverse transcriptions RT1–9 and subsequent
PCRs are given as arrows under the gene clusters (see Table 1). For each RT-reaction, the reverse primer (gray arrow) as well as the PCR-amplificates
obtained with that cDNA are indicated. The maximum lengths of the determined transcripts are given as a curved line.
Fig. 2. Transcriptional analysis of the hox locus of Anabaena variabilis by RT-PCR. Primers used in the reverse transcriptions RT1–5 and subsequent
PCRs are given as arrows under the gene cluster (see Table 1). For each RT-reaction, the reverse primer, as well as the PCR-amplificates obtained with
that cDNA is indicated. The maximum length of the determined transcript is given as a curved line.
N2-grown cells (Fig. 3). Such findings agree well with
physiological data, which indicated the occurrence
of the uptake hydrogenase in heterocysts [10, 19, 30].
Remarkably, there was a distinct, though weaker, signal
also for the RNA isolated from NH4⫹-grown cultures
(Fig. 3). Thus, at least a low basic level of transcription of hupL is detectable in NH4⫹-grown filaments of
A. variabilis.
G. Boison et al.: Hydrogenase Genes in Cyanobacteria
Fig. 3. Demonstration of transcription of hoxYH, hoxF, and hupL in
N2-grown filaments (lanes 2 and 3), heterocysts (lanes 4 and 5), and
vegetative cells (lane 6 and 7) of Anabaena variabilis. RNA isolated
from N2-grown filaments (lane 3), heterocysts (lane 5), and ammoniagrown filaments (lane 7) was used in RT-reactions with the reverse
primers HAv1 (hoxH), FAv2 (hoxF) and H6B (hupL) (see Table 1).
Subsequent PCRs were performed with the primer pairs YAv2/HAv1
(hoxY-ORF3-hoxH), FAv1/FAv2 (hoxF) and H4A/H6B (hupL) with
genomic DNA of N2-grown cultures (lane 1), DNase-treated RNA, not
transcribed into cDNA, as control (lanes 2, 4, and 6), and reversetranscribed RNA (lanes 3, 5, and 7). The amplificates obtained from the
cDNA have the same sizes as those obtained from the genomic DNA,
which have the expected sizes calculated from the sequences. The
control lanes show no amplificates. The 100-bp ladder from GIBCO/
BRL was used as size marker.
Discussion
Up to now, two reports only about transcription of
hydrogenase genes in cyanobacteria have been published.
Axelsson et al. [2] investigated the transcription of hoxH
and hupL in Nostoc sp. PCC 73102. Gubili and Borthakur
[16] compared the differential expression of the accessory gene hupB of the uptake hydrogenase of A. PCC
7120, under N2- and non-N2-fixing culture conditions. In
the present investigation, the complete transcriptional
analysis of the hox genes in A. nidulans and A. variabilis
has been performed, and the presence of hox and hup
transcripts in N2-fixing and NH4⫹-grown A. variabilis has
been demonstrated. Thus, this is the first comprehensive
transcript analysis of hydrogenase genes in cyanobacte-
319
ria. All investigations thus far mentioned have been
performed by RT-PCR. This fairly new technique has
been introduced as a method for transcription analysis in
cyanobacteria only recently [see e.g. 12]. Transcript
analyses by conventional Northern blot analysis, where
transcript levels can more easily be quantified, have never
been published for cyanobacterial hydrogenases. Northern blot experiments with the hox cluster of A. nidulans
gave no clear-cut results (G. Boison, unpublished), probably
owing to a very low abundance of these transcripts. This
assumption is based on the low enzyme activity (⬍10 nmol
min⫺1 mg protein⫺1 [29]), which is at least two orders of
magnitude lower than that of the NAD⫹-reducing hydrogenase of Alcaligenes eutrophus [35]. Promoter activities
measured by the ␤-galactosidase assay of hox::lacZ
fusions of A. nidulans (G. Boison, unpublished) and A.
eutrophus [36] also reveal a much lower transcriptional
activity of the cyanobacterial hox genes. Additionally,
short half-lives of prokaryotic mRNA [31] render transcriptional analysis difficult, especially for large operons.
Therefore, the more sensitive RT-PCR offers better
perspectives in analyzing genes, which are transcribed at
low levels only, as in the case of hydrogenase genes.
The gene cluster arrangement of the bidirectional
hydrogenase has been described to be quite dissimilar in
three cyanobacterial species [4]. The differences refer
mainly to the existence of different unidentified ORFs,
which are interspersed in the cluster of A. variabilis and
S. sp. PCC 6803, but are missing in A. nidulans. The
present communication shows that the unidentified ORFs 3
and 8 of A. variabilis are co-transcribed with the hydrogenase genes hoxF, hoxU, hoxY, and hoxH. Thus, these
ORFs might not be silent genes or even non-coding DNA
regions, but encode proteins of unknown functions.
Sequence alignments of ORF3 to the database showed us
homology to an unknown ORF of Prochlorothrix hollandica being located in the same position, between hoxY
and hoxH, in the hox cluster of this isolate. Outside of
hydrogenases, ORF3 has been reported to show homologies to CP12 of higher plant chloroplasts [41], a protein
that is involved in oligomerization of glyceraldehyde-3phosphate dehydrogenase and phosphoribulokinase. Further homologies of ORF3 exist to the unidentified ORF4
of A. PCC 7120, located downstream of the fdxH gene
[23]. The real functions of the putative proteins encoded
by ORF3 as well as by ORF8 remain to be elucidated.
Interestingly, the present RT-PCR analysis of the A.
variabilis hox cluster gave also clear evidence for transcription of the rather long intergenic stretch between
hoxF and hoxU [34].
The analysis of the A. variabilis hox gene cluster by
RT-PCR demonstrated one polycistronic transcript for all
bidirectional hydrogenase genes. The same is true for the
diaphorase gene hoxU, the hydrogenase genes hoxYH,
320
and the accessory genes hoxWhypAB of A. nidulans.
However, the existence of further smaller transcripts,
either generated by different termination of transcription
or via further promoters in the cluster, cannot be ruled out
by the method chosen. The genes of the hox clusters of R.
opacus [14], A. eutrophus [27], and of the hnd cluster of
the NADP⫹-reducing hydrogenase of D. fructosovorans
[22] are also transcribed as polycistronic mRNA. Additional smaller transcripts, which have been interpreted as
degraded or processed mRNA, have been observed in
these three investigations. Apart from the polycistronic
message hoxUYHWhypAB, the gene hypF encoding an
accessory protein involved in Ni incorporation and
maturation of the large subunit of NiFe hydrogenases [8,
21], is probably transcribed separately in A. nidulans. The
same has been shown for Rhodobacter capsulatus [7] and
Escherichia coli [21]. In A. nidulans, the diaphorase gene
hoxF is separated from the other hydrogenase genes by at
least 16 kb [4]. Upstream of hoxF, the gene hoxE has
been found in S. PCC 6803 [1] and A. nidulans [4]. Up to
now, participation and function of HoxE in the bidirectional hydrogenase has not been demonstrated. HoxE has
been suggested to function as a further subunit of the
diaphorase moiety [1, 4] because of clear sequence
identities of HoxF, HoxU, and HoxE to the NADH
oxidizing homologous subunits of respiratory complex I
of E. coli. However, a function of HoxE in the bidirectional hydrogenase has to be demonstrated by either
protein purification or measuring the NAD(P) ⫹-dependent H2-uptake activity of hoxE-mutants. The present
communication describes transcription of hoxE in a
dicistronic mRNA together with hoxF, strengthening a
function of HoxE in the hydrogenase complex. The
question remains to be solved how the transcription of
hoxEF and hoxUYHWhypAB is coordinated in A. nidulans.
In the present communication, the transcription of
the bidirectional hydrogenase genes hoxF and hoxYH has
been demonstrated for both heterocysts and vegetative
cells of A. variabilis. The uptake hydrogenase gene hupL
is strongly expressed in heterocysts, as expected from the
enzyme measurements [10, 30]. Unexpectedly, a weaker
transcription of hupL was also observed in vegetative
cells of A. variabilis. H2-uptake in heterocyst-free cultures has been detected in A. variabilis [40]. Additionally,
immunological localizations indicated the presence of the
uptake hydrogenase in N. sp. PCC 73102, a strain lacking
the bidirectional enzyme [5, 39], both in heterocysts and
vegetative cells [20, 38]. The RT-PCR signal of hupL
could reflect a basic activity of the hupSL promoter, not
necessarily leading to translation and expression of HupL
in vegetative cells. Such translational control in cyanobacteria has been reported for S. PCC 6803 [18, 25].
CURRENT MICROBIOLOGY Vol. 40 (2000)
ACKNOWLEDGMENT
This work was kindly supported by a grant from the Deutsche Forschungsgemeinschaft.
Literature Cited
1. Appel J, Schulz R (1996) Sequence analysis of an operon of a
NAD(P)-reducing nickel hydrogenase from the cyanobacterium
Synechocystis sp. PCC 6803 gives additional evidence for direct
coupling of the enzyme to NAD(P)H-dehydrogenase (complexI).
Biochim Biophys Acta 1298:142–147
2. Axelsson R, Oxelfelt F, Lindblad P (1999) Transcriptional regulation of Nostoc uptake hydrogenase. FEMS Microbiol Lett 170:
77–81
3. Boison G, Schmitz O, Mikheeva L, Shestakov S, Bothe H (1996)
Cloning, molecular analysis and insertional mutagenesis of the
bidirectional hydrogenase genes from the cyanobacterium Anacystis nidulans. FEBS Lett 394:153–158
4. Boison G, Schmitz O, Schmitz B, Bothe H (1998) Unusual gene
arrangement of the bidirectional hydrogenase and functional analysis of its diaphorase subunit HoxU in respiration of the unicellular
cyanobacterium Anacystis nidulans. Curr Microbiol 36:253–258
5. Boison G, Bothe H, Hansel A, Lindblad P (1999) Evidence against
a common use of the diaphorase subunits by the bidirectional
hydrogenase and by the respiratory complex I in cyanobacteria.
FEMS Microbiol Lett 174:159–165
6. Carrasco CD, Buettner JA, Golden JW (1995) Programmed DNA
rearrangement of a cyanobacterial hupL gene in heterocysts. Proc
Natl Acad Sci USA 2:791–795
7. Colbeau A, Richaud P, Toussaint B, Caballero FJ, Elster C, Delphin
C, Smith RL, Chabert J, Vignais PM (1993) Organization of the
genes necessary for hydrogenase expression in Rhodobacter capsulatus. Sequence analysis and identification of two hyp regulatory
mutants. Mol Microbiol 8:15–29
8. Colbeau A, Elsen S, Tomiyama M, Zorin NA, Dimon B, Vignais
PM (1998) Rhodobacter capsulatus HypF is involved in regulation
of hydrogenase synthesis through the HupUV proteins. Eur J
Biochem 251:65–71
9. Eisbrenner G, Bothe H (1979) Modes of electron transfer from
molecular hydrogen in Anabaena cylindrica. Arch Microbiol
123:37–45
10. Eisbrenner G, Roos P, Bothe H (1981) The number of hydrogenases
in cyanobacteria. J Gen Microbiol 125:383–390
11. Friedrich B, Schwartz E (1993) Molecular biology of hydrogen
utilization in aerobic chemolithotrophs. Annu Rev Microbiol
47:351–383
12. Geisler M, Jakobs B, Richter J, Schumann J (1996) Cotranscription
of a GTPase gene from the cyanobacterium Synechocystis PCC
6803 and a P-type Ca(2⫹)-ATPase gene. Biochim Biophys Acta
1309:189–193
13. Golden JW, Whorff LL, Wiest DR (1991) Independent regulation of
nifHDK operon transcription and DNA rearrangement during
heterocyst differentiation in the cyanobacterium Anabaena sp.
strain PCC 7120. J Bacteriol 173:7098–7105
14. Grzeszik C, Lübbers M, Reh M, Schlegel HG (1997) Genes
encoding the NAD-reducing hydrogenase of Rhodococcus opacus
MR11. Microbiology 143:1271–1286
15. Gubili J, Borthakur D (1996) The use of a PCR cloning and
screening strategy to identify lambda clones containing the hupB
gene of Anabaena sp. strain PCC7120. J Microbiol Methods
27:175–182
16. Gubili J, Borthakur D (1998) Organization of the hupDEAB genes
within the hydrogenase gene cluster of Anabaena sp. strain
PCC7120. J Appl Phycol 10:163–167
G. Boison et al.: Hydrogenase Genes in Cyanobacteria
17. Happe T, Schütz K, Böhme H (1997) unpublished, EMBL accession number Y13216
18. He QF, Vermaas W (1998) Chlorophyll a availability affects psbA
translation and D1 precursor processing in vivo in Synechocystsis
sp. PCC 6803. Proc Natl Acad Sci USA 95:5830–5835
19. Houchins JP (1984) The physiology and biochemistry of hydrogen
metabolism in cyanobacteria. Biochim Biophys Acta 768:227–255
20. Lindblad P, Sellstedt A (1990) Occurrence and localization of an
uptake hydrogenase in the filamentous heterocystous cyanobacterium Nostoc PCC 73102. Protoplasma 159:9–15
21. Maier T, Binder U, Böck A (1996) Analysis of the hydA locus of
Escherichia coli: two genes (hydN and hypF) involved in formate
and hydrogen metabolism. Arch Microbiol 165:333–341
22. Malki S, Saimmaime I, de Luca G, Rousset M, Dermoun Z, Belaich
J-P (1995) Characterization of an operon encoding an NADP⫹reducing hydrogenase in Dusulfovibrio fructosovorans. J Bacteriol
117:2628–2636
23. Masepohl B, Scholisch K, Gorlitz K, Kutzki C, Bohme H (1997)
The heterocyst-specific fdxH gene product of the cyanobacterium
Anabaena sp. PCC 7120 is important but not essential for nitrogen
fixation. Mol Gen Genet 253:770–776
24. Matveyev AV, Rutgers E, Söderbäck E, Bergman B (1994) A novel
rearrangement involved in heterocyst differentiation of the cyanobacterium Anabaena sp. PCC 7120. FEMS Microbiol Lett 116:201–
208
25. Milkowski C, Quinones A, Hagemann M (1998) A DNA fragment
from the cyanobacterium Synechocystis sp. PCC 6803 mediates
gene expression inducible by osmotic stress in E. coli. Curr
Microbiol 37:108–116
26. Nakamura Y, Kaneko T, Hirosawa M, Myajima N, Tabata S (1998)
Cyanobase, a www database containing the complete nucleotide
sequence of Synechocystis sp. strain PCC 6803. Nucleic Acids Res
26:63–67
27. Oelmüller U, Schlegel HG, Friedrich CG (1990) Differential
stability of mRNA species of Alcaligenes eutrophus soluble and
particulate hydrogenases. J Bacteriol 172:7057–7060
28. Oxelfelt F, Tamagnini P, Lindblad P (1998) Hydrogen uptake in
Nostoc sp. strain PCC 73102. Cloning and characterization of a
hupSL homologue. Arch Microbiol 169:267–274
29. Papen H, Kentemich T, Schmülling T, Bothe H (1986) Hydrogenase activities in cyanobacteria. Biochimie 68:121–132
321
30. Peterson RB, Wolk CP (1978) Localization of an uptake hydrogenase in Anabaena. Plant Physiol 61:688–691
31. Rauhut R, Klug G (1999) mRNA degradation in bacteria. FEMS
Microbiol Rev 23:353–370
32. Schmitz O, Bothe H (1996a) NAD(P) ⫹-dependent hydrogenase
activity in extracts from the cyanobacterium Anacystis nidulans.
FEMS Microbiol Lett 135:97–101
33. Schmitz O, Bothe H (1996b) The diaphorase subunit HoxU of the
bidirectional hydrogenase as electron transferring protein in cyanobacterial respiration? Naturwissenschaft 83:525–527
34. Schmitz O, Boison G, Hilscher R, Hundeshagen B, Zimmer W,
Lottspeich F, Bothe H (1995) Molecular biological analysis of a
bidirectional hydrogenase from cyanobacteria. Eur J Biochem
233:266–276
35. Schneider K, Schlegel HG (1976) Purification and properties of
soluble hydrogenase from Alcaligenes eutrophus H 16. Biochim
Biophys Acta 452:66–80
36. Schwartz E, Gerischer U, Friedrich B (1998) Transcriptional
regulation of Alcaligenes eutrophus hydrogenase genes. J Bacteriol
180:3197–3204
37. Serebryakova LT, Medina M, Zorin NA, Gogotov IN, Cammack R
(1996) Reversible hydrogenase of Anabaena variabilis ATCC
29413: catalytic properties and characterization of redox centres.
FEBS Lett 383:79–82
38. Tamagnini P, Oxelfelt F, Salema R, Lindblad P (1995) Immunological characterization of hydrogenases in the nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 73102. Curr Microbiol 31:102–
107
39. Tamagnini P, Troshina O, Oxelfelt F, Salema R, Lindblad P (1997)
Hydrogenases in Nostoc sp. strain PCC 73102, a strain lacking a
bidirectional enzyme. Appl Environ Microbiol 63:1801–1807
40. Troshina OY, Serebryakowa LT, Lindblad P (1996) Induction of
H2-uptake and nitrogenase activities in the cyanobacterium Anabaena variabilis ATCC 29413: effects of hydrogenase and organic
substrate. Curr Microbiol 33:11–15
41. Wedel N, Soll J (1998) Evolutionary conserved light regulation of
Calvin cycle activity by NADPH-mediated reversible phosphoribulokinase/CP12/glyceraldehyde-3-phosphate dehydrogenase complex dissociation. Proc Natl Acad Sci USA 95:9699–9704