Download Identification of porcine Lhx3 and SF1 as candidate genes for QTL

Identi®cation of porcine Lhx3 and SF1 as candidate genes
for QTL affecting growth and reproduction traits in swine
T. P. L. Smith*, A. D. Showalter², K. W. Sloop², G. A. Rohrer*,
S. C. Fahrenkrug*, B. C. Meier² and S. J. Rhodes²
*USDA, ARS, U.S. Meat Animal Research Center, PO Box 166, Clay Center, NE 68933, USA. ²Department of Biology,
Indiana University-Purdue University, Indianapolis, IN 46202, USA.
Summary
The distal portion of the long arm of porcine chromosome 1 has been shown to harbour
several quantitative trait loci affecting growth and reproductive traits in swine. In order
to identify potential candidate genes that might underlie these effects, a comparative
mapping analysis was undertaken to de®ne the extent of orthologous segments of
human chromosome 9. A microsatellite associated with heat shock protein (HSP) A5
was used to de®ne the proximal boundary of the quantitative trait loci (QTL) region,
which suggests the human orthologue of the gene(s) responsible for the observed effects
lies between HSPA5 and the q arm telomere of human chromosome 9. Examination of
this region revealed two candidate genes with known roles in production of hormones
essential to growth and reproductive function. The steroidogenic factor 1 and Lhx3 LIM
homeodomain transcription factor genes were mapped to 123 and 155 cM, respectively, of the Sus scrofa chromosome 1 (SSC1) linkage group, placing both genes within
the con®dence interval for the observed QTL. To further evaluate Lhx3, we examined
the expression pro®le during porcine embryonic development. Low levels were detected
at early embryonic stages, when development of the nervous system is proceeding.
A transient increase in expression level is observed during the time of pituitary organogenesis and again at the time of differentiation of anterior pituitary cells, with relatively high levels of expression persisting in the adult pituitary gland. This ontology is
consistent with Lhx3 being a candidate gene for the QTL.
Keywords
growth, reproduction, mapping, pituitary, QTL.
Introduction
Development of genetic maps of swine in the past decade
has allowed identi®cation of quantitative trait loci (QTL)
affecting a variety of traits of economic importance. While
these results are promising with respect to potential
improvement of pork production through marker-assisted
selection procedures, it would be of signi®cant interest to
identify the genes and speci®c allelic polymorphisms
Address for correspondence
Timothy P. L. Smith, U.S. Meat Animal Research Center, PO Box 166,
Clay Center, NE 68933±0166, USA.
E-mail: [email protected]
Accepted for publication 3 July 2001
underlying the observed variation. This achievement would
allow development of speci®c DNA-based genetic tests to
evaluate individual animals for merit and genetic potential,
as well as increase understanding of the genetic basis
underlying non-disease producing variability among populations. However, identi®cation of genes and DNA sequence
differences that contribute to relatively minor (but still of
substantial economic importance) variation in phenotype is
a daunting task. The most promising avenue is the application of comparative mapping, making use of the wealth of
knowledge and resources produced from the human
genome project and biomedical research community.
Genomic scans of a Meishan±White Composite reciprocal
backcross resource population have identi®ed a number of
QTL affecting traits of economic importance (Rohrer et al.
Ó 2001 International Society for Animal Genetics Animal Genetics, 32, 344±350
Mapping candidate genes for swine QTL
1999; Rohrer 2000). Several QTL were identi®ed on the
distal portion of the long arm of SSC1, representing correlated traits of early growth rate (from 8 to 18 weeks),
weight at 26 weeks, backfat thickness at 14 and 26 weeks
of age, and age at puberty. The peak of probability for these
traits were observed at 129±138 cM on SSC1. In order to
identify potential candidate genes underlying these QTL
effects, we undertook a comparative study of distal SSC1q.
Previous mapping data have shown that the comparative
map of SSC1q and the human genome appears quite complex, with blocks of conserved synteny to human chromosomes 9, 14, 15, and 18 (Goureau et al. 1996; Fig. 1).
Zoo-¯ourescence in-situ hybridization (FISH) experiments
indicate that the entire complement to Homo sapiens
chromosome 9 (HSA9) in the porcine genome is contained
in the distal half of SSC1q (Goureau et al. 1996). A number
of genes found on HSA9 have been physically assigned to
SSC1q, including CDKN2, IFNA1, RPS6, GGTA1, LCN1,
RLN1, SF1, ORM1, HSPA5 and HXB (for a complete list of
abbreviations and swine map positions, see www.ri.bbsrc.ac.uk/pigmap/pig_genome_ mapping.html). However, all
of these genes are found on HSA9p (CDKN2, IFNA1, RLN1,
RPS6) or in the HSA9q33-q34 region, so there is no gene
assignment evidence for the central third of HSA9 on SSC1.
Furthermore, the physical assignment of RLN1 in swine
overlaps with that of LCN1, although they are on opposite
ends of HSA9, suggesting that substantial gene order rearrangements may have occurred during evolution. Thus, the
telomeric end of the block of conserved synteny appears to
be the most likely to carry the gene(s) that map within the
QTL interval as indicated by the telomeric position of
markers S0056 and SW1301 (Fig. 1; Rohrer et al. 1996;
www.marc.usda.gov). In addition, a genetic marker for
RLN1 has been mapped in swine, approximately 50 cM
proximal to the QTL peaks (Rohrer et al. 1996). We concluded that the distal portion of HSA9q is the most likely
region to contain the orthologue of the gene(s) underlying
the QTL.
The goal of this study was to further narrow the comparative region containing the QTLs, identify the most likely
candidate genes, and begin to characterize these positional
candidates for their suitability as functional candidates. We
successfully narrowed the search to a small region of
HSA9q and identi®ed two candidates for one or more of the
Figure 1 Comparison of the physical and
genetic linkage maps of SSC1 with the map of
HSA9. Genes with porcine physical assignments are indicated with approximate assignments along the ideogram. Those genes that
have also been placed on the genetic linkage
map are joined to the linkage map scale (in
centimorgans) in the centre. Genes mapped in
swine and found on HSA9 are shown to the
right of the linkage map (the size of HSA9 is
approximately to scale). Gene symbols shown
in bold indicate those mapped in swine for the
present study. ESR ˆ estrogen receptor alpha;
CGA ˆ glycoprotein subunit alpha;
MEF2A ˆ MADS box transcription enhancer
factor 2 A; IGF1R ˆ insulin-like growth factor
1 receptor; MC4R ˆ melanocortin receptor 4;
IFNA ˆ interferon a; RLN1 ˆ relaxin;
SF1 ˆ steroidogenic factor 1.
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350
345
346
Smith et al.
QTL. In addition, we provided initial characterization of a
promising candidate, Lhx3, and show that its ontogeny of
expression is consistent with the possibility that variation in
the gene underlies a proportion of observed phenotypic
differences in growth and age at puberty.
Materials and methods
Genetic markers and mapping
A yeast arti®cial chromosome (YAC) clone containing the
heat shock protein (HSP) A5 gene was isolated by polymerase chain reaction (PCR) screening of DNA pools of the
Meat Animal Research Center (MARC) porcine YAC library
as described (Alexander et al. 1996), using primers HSPA5f/
HSPA5r (Table 1) developed from the sequence of the porcine HSPA5 cDNA (Accession X92446). Microsatellite
sequence was obtained by subcloning, hybridization
screening of the subclones with radiolabelled (GT)11
oligonucleotide, and sequencing as described (Sonstegard
et al. 1997). Primers Grp78f±Grp78r were designed to
amplify across the microsatellite and used for genotyping.
Allele sizes, genotypes, and map positions were estimated,
scored and analysed as described (Rohrer et al. 1994).
Primers to detect single nucleotide polymorphism (SNP)
markers (Table 1) were developed from cDNA sequence
present in GenBank, either porcine (SF1; accession
U84399; primers MARC1432/1433) or an alignment of
human, porcine and mouse (Lhx3; accessions AF156888,
AF063245 and L38249, respectively; primers I223±I224).
Primers were used to generate amplicons from the genomic
DNA of the nine parents of the US MARC swine reference
population (Rohrer et al. 1994), and the amplicons were
directly sequenced using a ¯uorescent DNA analyser
(Applied Biosystems, Foster City, CA, USA). Polymorphisms
were detected by visual inspection of the chromatograms
and analysed with PHRAP and CONSED programs (Gordon
et al. 1998). Genomic DNA ampli®cation with primers
I223±I224 was of low reproducibility, so nested ampli®cation primers for genotyping of Lhx3 were developed from the
porcine sequence of intron 2 (MARC6871±6872; Table 1).
The sequences adjacent to identi®ed polymorphisms in both
genes were used to develop primer extension probe oligonucleotides (designated as `probe' in Table 1). Extension
products corresponding to speci®c genotypes were generated from the entire mapping population in the presence of
dNTPs, with appropriate ddNTPs to provide termination for
assay via MALDI-TOF mass spectrometry (Sequenom, San
Diego, CA, USA) as described (Little et al. 1997). The SNP
genotypes were scored in the reference population and
analysed with all markers previously entered into the
genotype database (Rohrer et al. 1994, 1996) using CRIMAP v2.4 (Green et al. 1990) to obtain map position.
Expression analysis of Lhx3
Table 1 Primers used for ampli®cation, genotyping, and RT±PCR as
described in the text.
Primer name
Primer sequence (5¢®3¢)
HSPA5f
HSPA5r
Grp78f
Grp78r
I223
I224
MARC6871
MARC6872
Probe6871
MARC1432
MARC1433
ProbeSF1.1
ProbeSF1.2
Lhx3 RT±PCR.for
Lhx3 RT±PCR.rev
b-actin.for
b-actin.rev
TGAAGCTGTCCCTGGTGG
AGTAGGTGGTGCCCAGGTC
TAGAAGGCATAACTCCCCCT
CTTCCATGTGCCACAGGC
ACAGCAAGTG(T/C)CTCAAGTGCA
AGGTGGTACACGAAGTCCTG
GGGCGGAGGGGTTGCTAC
ATCAGGAAGGGGCATTGGAAG
TAAATGATGGGGATGGGGC
ACCACTACGGGCTGCTCACAT
CCCACCGTCAGGCACTTCT
TGTCTTGCCCACCGCT
GGGAGGGGGTAGGCC
CCACGGGCGACGAGTTCTAC
CGGCGGTTCTGGAACCACAC
CTACAATGAGCTGCGTGTGG
TAGCTCTTCTCCAGGGAGGA
GenBank accession number: The GenBank accession number for intron
2 of porcine Lhx3 is AF345446, for the amplicon from Meishan±White
Composite cross animals is AF356175, and for the SF1 amplicon is
AF356174.
First strand cDNA was generated from embryonic and adult
porcine RNA samples using reverse transcriptase (RT) (Life
Technologies, Rockville, MD, USA) and oligo d(T) as a primer. Hot-start PCR reactions for Lhx3 were performed using
RT±PCR primers with b-actin primers as control (Table 1)
as described (Sloop et al. 2000b). Thermal cycling parameters were one cycle at 94 °C for 2 min, 30 cycles of 94 °C
for 30 s/59 °C for 30 s/72 °C for 30 s, and one cycle at
72 °C for 10 min. The PCR products were separated by
agarose gel electrophoresis and visualized by ethidium
bromide staining. For each developmental stage, the
experiment was performed at least in triplicate to provide
semiquantitative estimation of RNA expression.
Results
The ®rst goal of the study was to reduce the amount of
HSA9 to scan for potential candidate genes. This was
accomplished by developing a microsatellite marker from a
YAC clone containing the HSPA5 gene, which had previously been physically assigned to SSC1q2.12-q2.13 (Yasue
et al. 1994). Primers designated GRP78 (a synonym locus
name for HSPA5) ampli®ed a sequence length polymorph-
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350
Mapping candidate genes for swine QTL
ism in the MARC porcine reference population, which was
used to place the gene on the linkage map. This microsatellite produced 66 informative meioses in the reference herd,
exhibiting highly signi®cant linkage (maximum two-point
LOD of 15.81) with multiple markers in the SSC1 linkage
group. Multipoint analysis positioned this gene at 127 cM
in the linkage group, slightly centromeric from the peak of
probability for the various QTL but within the 95% con®dence interval (Fig. 1). Because HSPA5 maps to HSA9q34,
mapping of this gene in swine reduced the likely region
carrying the orthologue of the QTL gene(s) to the telomeric
region of HSA9q.
Examination of the distal end of HSA9q using the
Mapviewer resources at the National Center for Biological Information (http://www.ncbi.nlm.nih.gov) indicated
numerous conceivable candidate genes, as this region of
HSA9 has a relatively high gene density. Genes encoding a
number of zinc ®nger-containing transcription factors,
homeobox proteins, and oncogenes lie in this area. A group
of ®ve members of the lipocalin family of proteins are found
in this region, and may conceivably play roles in processes
affected by the QTL. In addition, a group of tumour necrosis
factor (TNF) associated protein genes (TRAF1, TRAF2 and
TNFSF8) lie in this region, although the primary roles for
these proteins are related to maturation and activation of
blood cells. Most interesting was the presence of two genes
with known roles in development and hormone expression
in the pituitary gland, an organ with far-reaching effects
that could impact all of the phenotypic characteristics
associated with the QTL. These genes are SF1 (also referred
to as fushi tazaru factor 1 homologue, FTZF1, AD4BP or
nuclear receptor 5A1, NR5A1) and Lhx3.
The SF1 and Lhx3 genes were mapped in order to verify
their position and determine if they represent positional
candidate genes in swine. The swine cDNA sequence of SF1
in GenBank (U84399) was compared with the human
genome draft sequence using BLASTN, which identi®ed the
position of a predicted intron at position 969 of the swine
sequence. Primers MARC1432/1433 (Table 1) corresponding to positions 935±955 and 1079±1097 of the cDNA
sequence produced a 305-bp product (accession number
AF356174) that included a 142-bp intron. This intron
displayed two C/T polymorphisms in the MARC reference
mapping parents at positions 80 and 138 of the amplicon
sequence. Genotyping of the offspring produced 44
informative meioses, and allowed the SF1 locus to be
mapped at 123 cM on SSC1 (maximum LOD of 11á44). This
result suggests that SF1 lies within the 95% con®dence
interval for the QTLs (Rohrer et al. 1999).
A similar approach was used to map Lhx3. Because
porcine sequence of this gene was not available at the start
of this study, an alignment of human and murine sequences
was used to develop primer pair I223/I224. This primer pair
ampli®ed portions of exons 1b and 2, and the entire 817 bp
intron 2 (accession number AF345446). For sequencing of
the MARC reference mapping parents, a pair of nested
primers (MARC6871/6872) were used to obtain higher
quality ampli®cation for direct sequencing of PCR products.
The nucleotide sequence of the amplicon produced, with
polymorphic positions indicated in the submission via
standard nomenclature, has been deposited in GenBank
(accession number AF356175). The observed set of SNPs
formed two haplotypes, one of which was found only in the
six Chinese cross sows of the reference population. A single
SNP suf®cient to distinguish the haplotypes (an A/G polymorphism detected at position 312 of the amplicon) was
used to genotype the offspring, providing 69 informative
meioses. The SNP showed signi®cant linkage with markers
in the SSC1 linkage group (maximum LOD of 8á62 with
SW1301; recombination fraction 0á10) that allowed the
Lhx3 locus to be mapped at 155 cM of the linkage group.
This result placed the gene 8á4 cM in the telomeric direction
from marker SW2512, previously the most telomeric marker of the linkage group. Because this placed the marker
outside the current linkage group, which the CRIMAP
program may do when genotyping errors are present, the
individual genotype spectra were reinspected manually to
ensure integrity. No errors could be detected, so we conclude that the Lhx3 marker extends the SSC1 linkage group
and appears to represent the telomeric end of this group. In
addition, this position placed the locus within the 95%
con®dence interval for the observed QTLs.
To examine the ontogeny of Lhx3 gene expression in
swine, we performed RT±PCR analysis during embryogenesis. Porcine Lhx3 gene transcripts were weakly detected on
embryonic day 13 (e13; Fig. 2). At this time, neurulation
occurs and development of nervous system structures rapidly follows (Fig. 2; Patten 1948). The Lhx3 expression
continues throughout embryogenesis and was readily
detected in the adult pituitary (Fig. 2). Although these
assays are semiquantitative, we observed intriguing pulses of
increased Lhx3 gene transcription in samples from embryonic days e18 and e31 (Fig. 2). These time points mark the
early structural events that consign the cells of Rathke's
pouch, the pituitary primordium, to a pituitary fate and the
onset of differentiation of porcine hormone-secreting anterior pituitary cells, respectively. This observation correlates
with the prediction that Lhx3 is required for both the early
development of the pituitary gland and later for expression of
pituitary trophic hormone-encoding genes, based on gene
ablation experiments in mice (Sheng et al. 1996) and
observation of human patients with Lhx3 gene mutations
(Netchine et al. 2000). By contrast, using a similar
approach, we have reported that expression of the porcine
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350
347
348
Smith et al.
Figure 2 Lhx3 gene expression during development. (a) Timeline of
porcine pituitary ontogeny. The times of relevant stages in development are given in days post coitus (eN). Following neurulation and
opening of the stomodaeum, an invagination of oral ectoderm
(Rathke's pouch) is observed. This structure gives rise to the anterior
and intermediate lobes of the pituitary gland. Later, regulated cellular
proliferation and differentiation events occur that result in the ®rst
release of hormones at the indicated times (Ma et al. 1994, 1996;
Granz et al. 1997). ACTH ˆ adrenocorticotrophic hormone;
GH ˆ growth hormone; TSH ˆ thyroid-stimulating hormone;
FSH ˆ follicle-stimulating hormone; LH ˆ luteinizing hormone;
PRL ˆ prolactin. The expression of the Prop-1 pituitary transcription
factor gene (Sloop et al. 2000b) is also depicted, (b) Analysis of Lhx3
gene expression by RT±PCR. RNA was isolated from pig embryos of the
indicated stages, adult female pituitaries (Pit), or liver (Liv), cDNA was
synthesized, and Lhx3 cDNA was ampli®ed by PCR. b-actin was
ampli®ed in parallel reactions as a positive control. Negative control
reactions (Neg) with no input cDNA also are shown. The assays for
each stage were performed at least three times; a representative gel is
shown.
Prop-1 gene is detected at consistent levels during the time of
pituitary organogenesis and is found at lower levels in
mature pituitary tissue (Sloop et al. 2000b). The Lhx3 RNAs
were not detected in non-pituitary tissues such as liver or in
negative controls (Fig. 2).
Discussion
In vertebrates, hormones secreted from the anterior pituitary gland mediate endocrine regulation of growth, reproduction, the stress response, metabolic homeostasis and
many other physiological functions. These hormones are
adrenocorticotrophic hormone (ACTH), thyroid-stimulating
hormone (TSH), follicle-stimulating hormone (FSH),
luteinizing hormone (LH), growth hormone (GH) and prolactin (PRL). Differentiated cells within the mature pituitary
gland are specialized to release these characteristic hormone
products. The anterior and intermediate lobes of the
pituitary develop from Rathke's pouch, a region of early oral
ectoderm near the anterior neural ridge. As embryogenesis
proceeds, Rathke's pouch associates with neural tissue
destined to form the posterior pituitary. During this time,
cells within the developing anterior lobe are determined to
speci®c fates, and the hormone-secreting cells populate the
gland by the proliferation and differentiation of these precursor cells. This developmental process is regulated by the
coordinated actions of cell-speci®c and tissue-speci®c gene
regulatory proteins (Burrows et al. 1999).
Among the potential candidate genes that lie on
HSA9q34, we ®nd Lhx3 and SF1 to be the most attractive,
based on the known functions of the proteins and their
in¯uence on the growth and reproduction parameters
identi®ed with the QTLs. Lhx3 is a LIM homeodomain
transcription factor that is critical for pituitary development
and function in rodents and humans. The mouse and
human Lhx3 genes have seven protein-coding exons and
produce two distinct protein isoforms with different gene
activation properties (Zhadanov et al. 1995; Sloop et al.
1999, 2000a). Lhx3 is expressed in the developing nervous
system but is later restricted to the developing and mature
pituitary gland (Bach et al. 1995). Mice with null alleles of
Lhx3 lack the anterior pituitary, exhibit improper assignment of speci®c motor neuron subtypes, and die shortly after
birth (Sheng et al. 1996; Sharma et al. 1998). In addition,
these mice lack a number of hormones that play important
roles in numerous processes. Human patients with mutations of the Lhx3 gene have a compound pituitary hormone
de®ciency disease with loss of the same hormones as the
Lhx3 knockout mice (Netchine et al. 2000). The absence of
these hormones results in symptoms including short stature,
failure to enter puberty and hypothyroidism. Because the
hormones lost include GH, PRL, TSH, LH and FSH, all of
which have signi®cant roles in porcine development,
growth, and reproduction, it is possible that allelic variation
at the Lhx3 locus may in¯uence growth and reproduction
traits in swine. We previously demonstrated that the Lhx3
gene is conserved in swine, and that porcine Lhx3 can activate transcription from pituitary hormone genes (Meier
et al. 1999). In this manuscript, we demonstrated that the
ontology of expression of Lhx3 is consistent with the hypothesis that the same in¯uence on growth and reproduction
traits will occur in swine as seen in mice and humans.
The SF-1 gene represents an attractive candidate for
in¯uencing age at puberty, growth rate and nutrient
partitioning, but may act through the adrenal axis rather
than through its activity in the pituitary. Mice lacking the
SF-1 gene die postnatally and exhibit gonadal and adrenal
agenesis, reduced expression of pituitary gonadotropins
and loss of the ventromedial hypothalamus (reviewed in
Hanley et al. 2000). Targeted conditional knockout of the
SF-1 gene in pituitary cells results in mice with hypogo-
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350
Mapping candidate genes for swine QTL
nadotropic hypogonadism (Zhao et al. 2001), con®rming
that SF-1 activity is essential for the development and
function of pituitary gonadotrope cells. In human patients,
heterozygous mutations in SF-1 are associated with a
range of phenotypes ranging from adrenal insuf®ciency
(Biason-Lauber & Schoenle 2000) to sex reversal and
adrenal failure (Achermann et al. 1999). A mild phenotype, marked by poor adrenal development and an
impaired stress response, is observed in heterozygous mice
(Bland et al. 2000).
The mapping and analysis of pituitary regulatory genes
such as SF-1 and Lhx3 provides potential positional candidate genes for genetic analysis of growth, reproductive and
metabolic traits in meat species. Application of genetic
markers developed in this study will help to re®ne the
position of the QTL and assist in evaluating this hypothesis.
Further characterization of the genes, speci®cally to look for
potential functional allelic variants, will also help to test the
idea. Finally, characterization of the biochemical mechanisms of the encoded transcription factors may allow the
development of genetic protocols to improve productivity in
the meat industry.
Acknowledgements
We gratefully acknowledge the technical support of Renee
Godtel, Kevin Tennill, Tracy Happold, Linda Flathman, and
Steve Simcox. We thank Dr Rosamund Smith for generously
sharing reagents, and Drs Tad Sonstegard and Joe Ford for
critical review of the manuscript. Supported by the U.S.
Department of Agriculture/NRICGP/CSREES.
References
Achermann J.C., Ito M., Ito M., Hindmarsh P.C. & Jameson J.L.
(1999) A mutation in the gene encoding steroidogenic factor-1
causes XY sex reversal and adrenal failure in humans. Nature
Genetics 22, 125±6.
Alexander L.J., Smith T.P.L., Beattie C.W. & Broom M.F. (1996)
Construction and characterization of a large insert porcine YAC
library. Mammalian Genome 8, 50±1.
Bach I., Rhodes S.J., Pearse I.I.R.V., Heinzel T., Gloss B., Scully K.M.,
Sawchenko P.E. & Rosenfeld M.G. (1995) P-Lim, a LIM homeodomain factor, is expressed during pituitary organ and cell
commitment and synergizes with Pit-1. Proceedings of the National
Academy of Sciences USA 92, 2720±4.
Biason-Lauber A. & Schoenle E.J. (2000) Apparently normal
ovarian differentiation in a prepubertal girl with transcriptionally inactive steroidogenic factor 1 (NR5A1/SF-1) and adrenocortical insuf®ciency. American Journal of Human Genetics 67,
1563±8.
Bland M.L., Jamieson C.A., Akana S.F., Bornstein S.R., Eisenhofer G.,
Dallman M.F. & Ingraham H.A. (2000) Haploinsuf®ciency of
steroidogenic factor-1 in mice disrupts adrenal development
leading to an impaired stress response. Proceeding of the National
Academy of Science, USA 97, 14488±93.
Burrows H.L., Douglas K.R., Seasholtz A.F. & Camper S.A. (1999)
Genealogy of the anterior pituitary gland: tracing a family tree.
Trends in Endocrinology and Metabolism 10, 343±52.
Gordon D., Abajian C. & Green P. (1998) Consed: a graphical tool
for sequence ®nishing. Genome Research 8, 195±202.
Goureau A., Yerle M., Schmitz A., Riquet J., Milan D., Pinton P.,
Frelat G. & Gellin J. (1996) Human and porcine correspondence
of chromosome segments using bidirectional chromosome
painting. Genomics 36, 252±62.
Granz S., Ellendorff F., Grossmann R., Kato Y., MuÈhlbauer E. &
Elsaesser F. (1997) Ontogeny of growth hormone and LHb-, and
FSHb- and a-subunit mRNA levels in the porcine foetal
and neonatal anterior pituitary. Journal of Neuroendocrinology
9, 439±49.
Green P., Falls K. & Crooks S. (1990) Documentation from CRIMAP,
Version 2.4. Washington University School of Medicine, St Louis,
MO, USA.
Hanley N.A., Ikeda Y., Luo X. & Parker K.L. (2000) Steroidogenic
factor 1 (SF-1) is essential for ovarian development and function.
Molecular Cell Endocrinology 25, 27±32.
Little D.P., Braun A., Darnhofer-Demar B. & Koster H. (1997)
Identi®cation of apolipoprotein E polymorphisms using temperature cycled primer oligo base extension and mass spectrometry.
European Journal of Clinical Chemistry and Clinical Biochemistry 35,
545±8.
Ma E., Milewski N., Grossmann R., Ivell R., Kato Y. & Ellendorff F.
(1994) Proopiomelanocortin gene expression during pig pituitary
and brain development. Journal of Neuroendocrinology 6, 201±9.
Ma E., Klempt N., Grossman R., Ivell R., Kato Y. & Ellendorff F.
(1996) Expression of GH, TSHb, LHb, and FSHb genes during
fetal pituitary development in the pig. Experimental Clinical
Endocrinology and Diabetes 104, 464±72.
Meier B.C., Price J.R., Parker G.E., Bridwell J.L. & Rhodes S.J. (1999)
Characterization of the porcine Lhx3/LIM-3/P-Lim LIM homeodomain transcription factor. Molecular and Cellular Endocrinology
147, 65±74.
Netchine I., Sobrier M.L., Krude H. et al. (2000) Mutations in LHX3
result in a new syndrome revealed by combined pituitary hormone de®ciency. Nature Genetics 25, 182±6.
Patten B.M. (1948) Embryology of the Pig, 3rd edn. The Blakiston
Company, New York, NY, USA.
Rohrer G.A., Alexander L.J., Keele J.W., Smith T.P.L. & Beattie C.W.
(1994) A microsatellite linkage map of the porcine genome.
Genetics 136, 231±45.
Rohrer G.A., Alexander L.J., Hu Z., Smith T.P.L., Keele J.W. &
Beattie C.W. (1996) A comprehensive map of the porcine
genome. Genome Research 6, 371±91.
Rohrer G.A., Ford J.J., Wise T.H., Vallet J.L. & Christenson R.K.
(1999) Identi®cation of quantitative trait loci affecting female
reproductive traits in a multigeneration Meishan±White composite swine population. Journal of Animal Science 77, 1385±91.
Rohrer G.A. (2000) Identi®cation of quantitative trait loci affecting
birth characters and accumulation of backfat and weight in a
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350
349
350
Smith et al.
Meishan±White composite resource population. Journal of Animal
Science 78, 2547±53.
Sharma K., Sheng H.Z., Lettieri K., Li H., Karavanov A., Potter S.,
Westphal H. & Pfaff S.L. (1998) LIM homeodomain factors Lhx3
and Lhx4 assign subtype identities for motor neurons. Cell 95,
817±28.
Sheng H.Z., Zhadanov A.B., Mosinger B. Jr, Fujii T., Bertuzzi S.,
Grinberg A., Lee E.J., Huang S.P., Mahon K.A. & Westphal H.
(1996) Speci®cation of pituitary cell lineages by the LIM
homeobox gene Lhx3. Science 272, 1004±7.
Sloop K.W., Meier B.C., Bridwell J.L., Parker G.E., McCutchan
Schiller A. & Rhodes S.J. (1999) Differential activation of pituitary
hormone genes by human Lhx3 isoforms with distinct DNA
binding properties. Molecular Endocrinology 13, 2212±25.
Sloop K.W., Showalter A.D., Von Kap-Herr C., Pettenati M.J. &
Rhodes S.J. (2000a) Analysis of the human LHX3 neuroendocrine transcription factor gene and mapping to the subtelomeric
region of chromosome 9. Gene 245, 237±43.
Sloop K.W., McCutchan Schiller A., Blanton J.R. Jr, Meier B.C.,
Rohrer G., Smith T.P.L. & Rhodes S.J. (2000b) Biochemical and
genetic characterization of the porcine Prophet of Pit-1 pituitary
transcription factor. Molecular and Cellular Endocrinology 168,
77±87.
Sonstegard T.S., Lopez-Corrales N.L., Kappes S.M., Beattie C.W. &
Smith T.P.L. (1997) Comparative mapping of bovine and human
chromosome 2 identi®es segments of conserved synteny containing the bovine mh locus. Mammalian Genome 8, 751±5.
Yasue H., Harumi T. & Awata T. (1994) Assignment of GRP78
gene to swine chromosome 1q2.12®q2.13 by ¯uorescent in situ
hybridization. Hereditas 121, 203±5.
Zhadanov A.B., Copeland N.G., Gilbert D.J., Jenkins N.A. & Westphal H. (1995) Genomic structure and chromosomal localization
of the mouse LIM/homeobox gene Lhx3. Genomics 27, 27±32.
Zhao L., Bakke M., Krimkevich Y., Cushman L.J., Parlow A.F., Camper
S.A. & Parker K.L. (2001) Steroidogenic factor 1 (SF1) is essential
for pituitary gonadotrope function. Development 128, 147±54.
Ó 2001 International Society for Animal Genetics, Animal Genetics, 32, 344±350