Download Reflection on Lloyd/Rhind Genetics Unit First and Foremost

Reflection on Lloyd/Rhind Genetics Unit
First and Foremost this has been an extremely rewarding experience for not only
me students, but for myself as a Biology instructor as well. Mr. Rhind has been
supportive in every way towards helping us all better grasp the genetics topics we
attempted to cover. His knowledge and patience were key to making this unit work so
successfully.
I found that the Journaling and DNA extraction Labs were very effective tools in
allowing for follow up conversation long after the lessons were presented. Even know as
we start Cell Reproduction the students will go back to these activities to help each other
understand chromosome number differences between organisms, and these are in their
own conversations, not teacher directed. The Access Excellence lab is something that I
will continue to use to address replication, transcription, translation for direct instruction
and review. However, I will make a few changes. In another attachment on the website
labeled “Mutation Lab Handouts” you will find the templates that we used as a class to
model the three processes mentioned above. This tactile activity was a true inquiry
activity in that the students had to take what they knew about the processes from class
notes, reading, and movie clips, and make it happen in front of them. As we know this is
not as easy as it sounds for someone that is first learning these topics. The templates
allowed students to physically move around their ideas and easily see where their
misunderstandings were. As an instructor it also allowed me to see where both
individuals and the class as a whole were confused. I did not stop the mistake of using
tRNA instead of mRNA to translate into amino acids when I first saw it happening. I
allowed them to share their responses (Next time I will have them write their polypeptide
strand on the board) and then have a discussion as to why they were not the same. They
had to initiate the discussion and find the mistakes which they did by repeating each step
out loud and then defending their decisions to each other, I was merely a referee. Also
next time I will be sure to use Velcro on the paper cutouts and to be sure that the cutting
and preparation is done in after classroom time at school or at home for “homework” or
extra credit.
Now for the main event, the Cavinine Resistance Lab. Although not all of my
students were able to participate as at a Technical High School we have A and Z week
classes, the students who did participate did an excellent job sharing and describing their
results with the other students. First know that this lab is a strongly teacher dependent
activity where although the students help prepare the petri dishes the instructor must be
pro-active in ensuring that the labels and times are done correctly. The results, not the
process are key to this lab and the students really picked up on it. They were able to
directly relate back to the journal question and then rewrite their ideas based on what they
had learned, including the technical processes. We then took some time to use the NSTI
BLAST service to look up the actual nucleotide sequences and said mutations, which
amazed them, and made me proud that they could understand the processes that were
taking place as we went through the BLAST.
The seminar and research paper was a rewarding culminating activity that the
students are still trying to do again as they all have strong opinions that they want to let
everybody else know. I am pretty sure we will use the process again at the end of the
meiosis unit where we discuss sperm and egg production and inevitably infertility. As
Worcester is a center for Stem Cell Research the activity will fit nicely there.
All in all the experience I have had with GENA has been more than I had
originally anticipated. The community involvement is something that I plan to continue
to utilize in Worcester Technical High School’s future plans for a science fair. Thank
you to the GENA community and to Nick Rhind for allowing myself and my students to
benefit from this experience.
GENA Project 2008-2009 Academic Year
Learning Cycle: Genetics in Ninth Grade Biology, Honors, College, and Inclusion Classes
Christine Lloyd, Worcester Technical High School
Nick Rhind, University of Massachusetts Worcester Medical School
Rationale: To address misconceptions and get students actively engaged in genetics.
Our goal is to use yeast as a common theme throughout the entire academic year. Yeast as an
organism addresses genetic, classification, and cellular biology. In the genetic unit we will
emphasize on the DNA mutations and how they may cause phenotypic, or observed, changes
as well as genotypic only, or silent, mutations. The following are the strategies we will use to
teach the genetics portion of the collaboration.
5E Lesson plans are on pp 3-4
(1) Do Now & Journal: The students will complete the Do Now question of the day: After
attempting to extract DNA from a strawberry, yeast, and human cell, which will have
DNA present? A. Strawberry B. Yeast C. Human Cell D. Human and Strawberry
E. All of the above. Then they will then complete a journal entry: Explain your answer
and tell me what the DNA would look like and how much will there be (list in
hierarchy). pp 5
(2) DNA Extraction Lab: Students will extract DNA from Yeast, Human, and Strawberry
cells as am inquiry activity. They will need to compare and contrast what they see in
each result and then to what their original idea of what DNA did look like. pp 6-8
(3) Teacher Directed Learning: Students will take notes, and watch a short clip from
United Streaming (DNA the building block of life). pp 9-10
(4) Modeling DNA structure: Students will now model DNA with both beads and paper
models to assess their ability to match the nucleic acids. The teacher will relate color
choices to electrician color code (this is a technical high school) pp 11-13
(5) Scale Measurement: Students will view a scale model of DNA and then relate that to
the amount of DNA found in step 2. Then the students will practice drawing other
objects to scale. (Again this is a technical high school) pp 14
(6) Modeling DNA ,Do Now Question Repeat: These will be independent activities used
to assess the students. pp 15 -16
(7) Do Now & Journal: The students will complete the Do Now question of the day as a
journal: If I were to open a poisonous gas canister in the classroom and close the
windows and doors, what would happen to all of us? If one person happened to
survive, what would have allowed them to survive? pp17-18
-1-
(8) Canavinine Resistance Lab: Students will conduct canavinine resistance lab on yeast
using UV exposure as experimental variable as an inquiry lab. They will need to
explain why some of the cells were able to survive and others were not based on the
principles of control and experimental groups as well as independent and dependent
variables. (Due to the length necessary for this lab the students will take all week to
complete the activity) pp 19 - 20
(9) Genes DNA and Mutation Lab: A six group adaptation of Access Excellences lab
with a relay race type motivation to it. pp 21 -26
(10) Short Research Paper & Socratic Seminar: In a short research project students will
choose one silent and one observed DNA mutation and complete a one page paper and four
slide power point presentation that explains each in terms of DNA structure, replication,
and mutation. They must also address the nature vs. nurture debate. Discussion: Through a
Socrates Circle method students and teacher will discuss human relations to silent and
observed mutations as well as nature vs. nurture or “luck”. They will be assessed using the
rubric of Claim, Evidence, and Reasoning pp 27-31
(11) Unit Exam: An MCAS based unit exam. pp 32-38
5 E’s Lesson Plan
Standard
-2-
3.1 = Describe the basic structure(double helix, sugar phosphate backbone, linked by
complimentary nucleotide pairs) of DNA, and describe its function in genetic inheritance.
Objectives
SWBAT Identify and Build a DNA double helix.
Understand that DNA is present in all living things.
Engage
Do Now = After attempting to extract DNA from a strawberry, yeast, and human cell, which
will have DNA present? A. Strawberry B. Yeast C. Human Cell D. Human and
Strawberry E. All of the above
Explain your answer and tell me what the DNA would look like and how much will there be
(list in hierarchy).
Explore
Have them extract DNA from Yeast, Strawberry, and Human cells. Asking them to compare
and contrast what they see in each result and then comparing that to what they thought DNA
would have looked like.
Explain
Notes, video, modeling with DNA Beads and Paper models (Have consistency in colors) T =
Red, G= Black, C = Blue, A = Green {Relate to electrician consistency of colors}
Extend
Relate back to chemistry in organic molecules. Bring in scale measurements and how “Big”
DNA is. Talk about how much DNA you would get from each of the above experiments and
relate to size and amount of each.
Evaluate
Have students build a DNA model with a specific structure in their own given a specific
sequence. Have them answer Do Now question again.
Resources
Access Excellence Intro to DNA extractions
Strawberry extraction of Christine and Forrest
-3-
5 E’s Lesson Plan
Standard
3.3 = Explain how mutations in the DNA sequence of a gene may or may not result in
phenotypic change in an organism.
Objectives
SWBAT Define mutation.
Identify mutations that are either silent or observed.
Compare & Contrast silent vs observed mutations.
Recognize that mutations have helped organisms survive
Define adaptive mutation
Engage {Nick will find if there is a gene in people that makes them immune to a chemical}
Do Now = If I were to open a poisonous gas canister in the classroom and close the windows
and doors, what would happen to all of us?
If one person happened to survive, what would have allowed them to survive?
Explore
Have students conduct canavinine resistance lab on yeast using UV exposure as experimental
variable. {helpful in can. Condition but put them in condition with arg.}
Explain
Notes, video, modeling with paper models (Six groups adaptation of access excellence genes
DNA & mutation lab)
Extend melanin in UV or high altitude or cold weather adaptation
Readdress engage question {will it pass down to the next generation inheritance}
{Expected result would be no UV =’s 1-2 with UV =’s 200+ induced mutants.}
Discuss human resistance to disease (HIV {look in Christine & Forests packet}– women in
Africa have a gene that makes them resistance to HIV; Malaria – sickle cell anemia makes
those who have it immune to malaria) {Blood Lines from PBS – genetic discrimination}
Nature vs Nurture - they could survive because of luck or learned physical ability to hold their
breath, etc.
Evaluate
Questions at end of lab using rubric of Claim, Evidence, reasoning.
Resources
Access Excellence Genes DNA & Mutation
Assessing Students… rubric
-4-
Agenda 11.13
Objectives: SWBAT Extract DNA from living
organisms
Do Now:
After attempting to extract DNA from a strawberry,
yeast, and human cell, which will have DNA
present?
A. Strawberry
B. Yeast
C. Human Cell
D. Human and Strawberry
E. All of the above.
Explain your answer and tell me what the DNA would
look like and how much will there be (list in hierarchy)
Homework: Lab Report
Agenda 11.13
Strawberry and Yeast DNA Extraction Lab
Exit Slip
After attempting to extract DNA from a
strawberry, yeast, and human cell, which
will have DNA present?
A. Strawberry
B. Yeast
C. Human Cell
D. Human and
Strawberry
E. All of the above.
Explain your answer and tell me what the DNA
would
look like and how much will there be (list in
hierarchy)
-5-
Extracting DNA from Strawberries (Christine & Forrest)
You will never be able to eat a strawberry again without thinking of how much DNA is
in it!
Background:
Why use strawberries?
Strawberries are soft and easy to crush. Most interestingly, strawberries have EIGHT
copies of each chromosome – that is a lot of DNA in each cell!
You will need, for one extraction:
- mortar and pestal
- 1 strawberry
- 2 teaspoons DNA extraction buffer
- Gauze, cut into squares
- Funnel
- Ice cold ethanol or Isopropyl rubbing alcohol
- Test tube with lid
- Long stick
The DNA extraction buffer:
Makes 500ml (enough for 50 extractions)
50ml shampoo (or 25ml liquid dish washing detergent)
7.5g kitchen salt (1 teaspoon)
450ml water
What to do:
1. Wash the strawberry and remove the sepals (the green leaves)
2. Place the strawberry in the mortar and crush it with the pestal.
3. Add 10ml of the DNA extraction buffer to the mortar and squish again for 1 minute.
4. Place a funnel in the test tube. Place the strip of gauze in the funnel.
5. Pour the strawberry-shampoo mixture into the gauze. Let the mixture filter into the
tube.
6. Carefully pour 10 ml of ice-cold isopropyl alcohol into the tube.
7. Keep the tube still at eye level; do not shake it; for 1 minute.
8. Scoop out the DNA with the stick.
9. Spread the DNA out on the black card labeled Strawberry DNA and leave it to dry.
HOW DOES IT WORK?
Crushing the strawberries breaks open many of the strawberry cells, where the DNA is.
The soap in the extraction buffer breaks down the membranes of the cells, releasing the DNA.
The salt makes the DNA molecules stick together, and separate from the proteins.
The gauze will retain cell debris and unmashed pieces of fruit.
The DNA will pass through the gauze into the test tube.
DNA is not soluble in alcohol, so it precipitates.
What you see are long, rope-like DNA molecules in the alcohol.
Once the DNA dries, you should be able to see its stringy, spider-web structure.
-6-
See Your DNA
2 Spit the water into your cup. Pour this into a
large test tube containing 1 teaspoon (5 ml) 25
percent liquid detergent.
FROM NOVA ONLINE NOVA Activity Cracking the Code
3 Cap tube and gently rock it on its side for 2–3
minutes. The detergent will break open the cell
membrane to release the DNA into the soap
solution. Do not be too vigorous while mixing!
DNA is a very long molecule. Physical abuse
can break it into smaller fragments, a
process known as shearing.
4 Open and slightly tilt the tube and pour 1
teaspoon (5 ml) fluid ounces of the chilled 95
percent ethanol down the side of the tube so
that it forms a layer on the top of your soapy
solution.
5 Allow tube to stand for 1 minute.
6 Place a thin acrylic or glass rod into the tube.
7 Stir or twirl the rod in one direction to wind
the DNA strands onto the rod. Be careful to
minimize mixing of the ethanol and soapy
layers. If too much shearing has occurred, the
DNA fragments may be too short to wind
up, and they may form clumps instead. You can
try to scrape these out with the rod.
8 After you have wrapped as much DNA onto
the rod as you can, remove the rod and
scrape/shake the DNA into a small tube
containing the rest of the 95 percent
ethanol. Your DNA should stay solid in this
solution.
DNA contains the instructions for making you. How
you look, what blood type you have, even your
tendency to get some diseases. It is found inside the
nucleus in just about every single cell of your body.
In this activity, you’ll break away the membrane
around the cell and its nucleus so that you can see
your very own DNA.
Procedure
1 This procedure will collect some of the
buccal cells that line the inside of your mouth.
These cells are continuously being sloughed off
by your cheeks. Swill 2 teaspoons (10 ml) 0.9
percent salt water in your mouth for 30
seconds. This amount of swishing will actually
become quite laborious—hang in there!
-7-
YEAST DNA EXTRACTION
Materials
dry yeast
Adolph's natural meat tenderizer
beaker
distilled water
non-iodized salt
glass stirring rod
thermometer
Palmolive detergent
graduated
blender
15 ml test tube
ice cold ethanol
test tube rack
250 ml beaker
Solutions
detergent/salt solution:
20 ml detergent
20 g non-iodized salt
180 ml distilled water
5% meat tenderizer solution:
5 g tenderizer
95 ml distilled water
Protocol
1. Mix 1 package of dry yeast with 40 ml of 50oC hot tap water to dissolve the yeast in a
beaker. Keep mixture covered and warm for about 20 minutes.
2. Add 40 ml detergent/salt solution.
3. Place mixture in a blender and blend 30 sec-1 minute on high.
4. Pour mixture back into the beaker, add 15 ml of meat tenderizer solution, and stir 1
minute.
5. Place 6 ml of mixture into a test tube.
6. Pour 6 ml of ice cold ethanol carefully down the side of the tube to form a layer.
7. Let the mixture sit undisturbed 2-3 minutes until bubbling stops.
8. You will see a precipitate in the alcohol. Swirl a glass stirring rod at the interface of the
two layers.
9. The precipitate is DNA.
10. Place the DNA on the black card marked Yeast DNA.
-8-
Slide 1
___________________________________
Agenda 3.18
Objectives:
SWBAT Identify and Label the base code
pairs.
Do Now:
Within an individual mouse, four different mutations occurred
in different genes, located on separate chromosomes and
in different cells, as shown in the table below.
Cell Type
Chromosome
Normal
Phenotype
Mutated
Phenotype
fur color
black fur
white fur
chromosome 3
eye color
brown eyes
blue eyes
chromosome 2
fur thickness
thick fur
thin fur
chromosome 1
tail length
long tail
short tail
skin
chromosome 4
gamete
muscle
nerve
Trait
___________________________________
___________________________________
___________________________________
Which of these mutations could be passed on to the mouse's
offspring?
A.white fur
B.blue eyes
C.thin fur
D.short tail
___________________________________
___________________________________
___________________________________
___________________________________
Slide 2
Activities
___________________________________
DNA Extraction Lab
Notes & Video
Practice
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
Slide 3
3/18/2008
___________________________________
DNA, RNA, and Protein Synthesis
Deoxyribose Nucleic Acid: DNA.
Base Pairing Rules: Complementary base pairs
are found in equal amounts in DNA.
AKA (Chargarffs Rule)
___________________________________
___________________________________
Purine: double ring of N and C
Adenine and Guanine
___________________________________
Pyrimidine: single ring of N and C
Cytosine and Thymine
___________________________________
___________________________________
___________________________________
-9-
Slide 4
3/18/2008
___________________________________
DNA, RNA, and Protein Synthesis
Ribosenucleic Acid: RNA
*mRNA – messenger RNA takes the DNA
message
*tRNA – translation RNA translates the
message into proteins
___________________________________
___________________________________
___________________________________
*rRNA – ribosomal RNA stays in the ribosome
to assist with protein synthesis.
___________________________________
___________________________________
___________________________________
Slide 5
3/18/2008
___________________________________
DNA, RNA, and Protein Synthesis
DNA Replication: The process by which DNA is copied during
Interphase. Two complementary strands are created.
Mutation: Error during replication
Transcription: When mRNA decodes one strand of DNA and travels
with it out of the nucleus to the ribosomes.
Translation: When tRNA translates mRNA in three letter codons to
produce proteins.
Ribosenucleic Acid: RNA
*mRNA – messenger RNA takes the DNA message
*tRNA – translation RNA translates the message into proteins
*rRNA – ribosomal RNA stays in the ribosome to assist with
protein synthesis.
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
Slide 6
___________________________________
Exit Slip
The diagram below shows a strand of DNA
matched to a strand of messenger RNA.
What process does this diagram represent?
___________________________________
___________________________________
___________________________________
A.mutation
C.transcription
___________________________________
B.respiration
D.translation
___________________________________
___________________________________
- 10 -
DNA - The Double Helix
Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
the cell including cell reproduction, and heredity. Chromosomes are microscopic, threadlike strands composed of the chemical DNA (short for
deoxyribonucleic acid). In simple terms, DNA controls the production of proteins within the cell. These proteins in turn, form the structural
units of cells and control all chemical processes within the cell. Think of proteins as the the building blocks for an organism, proteins make up
your skin, your hair, parts of individual cells. How you look is largely determined by the proteins that are made. The proteins that are made is
determined by the sequence of DNA in the nucleus.
Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. Hence
you hear it commonly referred to as the gene for baldness or the gene for blue eyes. Meanwhile, DNA is the chemical that genes and
chromosomes are made of. DNA is called a nucleic acid because it was first found in the nucleus. We now know that DNA is also found in
organelles, the mitochrondria and chloroplasts, though it is the DNA in the nucleus that actually controls the cell's workings.
In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix (color the title black), which
is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all
the phosphates pink (one is labeled with a "p"). Color all the deoxyriboses blue (one is labeled with a "D") .
The rungs of the ladder are pairs of 4 types of nitrogen bases. The bases are known by their coded letters A, G, T, C. These bases always
bond in a certain way. Adenine will only bond to thymine. Guanine will only bond with cytosine. This is known as the "Base-Pair Rule". The
bases can occur in any order along a strand of DNA. The order of these bases is the code the contains the instructions. For instance
ATGCACATA would code for a different gene than AATTACGGA. A strand of DNA contains millions of bases. (For simplicity, the image
only contains a few.)
Color the thymines orange.
Color the adenines green.
Color the guanines purple.
Color the cytosines yellow.
Note that that the bases attach to the sides of the ladder at the sugars and not the phosphate.
The DNA helix is actually made of repeating units called nucleotides. Each nucleotide consists of three molecules: a sugar (deoxyribose), a
phosphate which links the sugars together, and then one of the four bases. Two of the bases are purines - adenine and guanine. The
pyrimidines are thymine and cytosine. Note that the pyrimidines are single ringed and the purines are double ringed. Color the nucleotides
using the same colors as you colored them in the double helix.
The two sides of the DNA ladder are held together loosely by hydrogen bonds. The DNA can actually "unzip" when it needs to replicate - or
make a copy of itself. DNA needs to copy itself when a cell divides, so that the new cells each contain a copy of the DNA. Without these
instructions, the new cells wouldn't have the correct information. The hydrogen bonds are represented by small circles. Color the hydrogen
bonds grey.
Messenger RNA
So, now, we know the nucleus controls the cell's activities through the chemical DNA, but how? It is the sequence of bases that determine
which protein is to be made. The sequence is like a code that we can now interpret. The sequence determines which proteins are made and the
proteins determine which activities will be performed. And that is how the nucleus is the control center of the cell. The only problem is that
the DNA is too big to go through the nuclear pores. So a chemical is used to to read the DNA in the nucleus. That chemical is messenger
RNA. The messenger RNA (mRNA) is small enough to go through the nuclear pores. It takes the "message" of the DNA to the ribosomes
and "tells them" what proteins are to be made. Recall that proteins are the body's building blocks. Imagine that the code taken to the ribosomes
is telling the ribosome what is needed - like a recipe.
Messenger RNA is similar to DNA, except that it is a single strand, and it has no thymine. Instead of thymine, mRNA contains the base Uracil.
In addition to that difference, mRNA has the sugar ribose instead of deoxyribose. RNA stands for Ribonucleic Acid. Color the mRNA as you
did the DNA, except:
Color the ribose a DARKER BLUE, and the uracil brown.
- 11 -
The Blueprint of Life
Every cell in your body has the same "blueprint" or the same DNA. Like the blueprints of a house tell the builders how to construct a house,
the DNA "blueprint" tells the cell how to build the organism. Yet, how can a heart be so different from a brain if all the cells contain the same
instructions? Although much work remains in genetics, it has become apparent that a cell has the ability to turn off most genes and only work
with the genes necessary to do a job. We also know that a lot of DNA apparently is nonsense and codes for nothing. These regions of DNA
that do not code for proteins are called "introns", or sometimes "junk DNA". The sections of DNA that do actually code from proteins are
called "exons".
Name ______________________________________
1. Write out the full name for DNA. _____________________________________________
2. What is a gene? _______________________________________________________
3. Where in the cell are chromosomes located?
_______________________________________________________
4. DNA can be found in what two organelles?
_________________________________________________________
5. What two scientists established the structure of DNA?
______________________________________________
6. What is the shape of DNA? ______________________________________
7. What are the sides of the DNA ladder made of? ________________________________________
8. What are the "rungs" of the DNA ladder made of?
_______________________________________________________
9. What sugar is found in DNA? _______________________ In RNA? ____________________
10. How do the bases bond together? A bonds with _____
G bonds with _______
11. The two purines in DNA are ______________________________________________________.
12. DNA is made of repeating units called
_______________________________________________________
13. Why is RNA necessary to act as a messenger? Why can't the code be taken directly from the
DNA?
14. Proteins are made where in the cell?
15. How do some cells become brain cells and others become skin cells, when the DNA in ALL the
cells is exactly the same. In other words, if the instructions are exactly the same, how does one cell
become a brain cell and another a skin cell?
16. Why is DNA called the "Blueprint of Life"?
- 12 -
Name __________________________________ Color the images according to the instructions.
- 13 -
Name: _____________________________
Partner: ______________________
Human Dimensions
In this activity, you and your group are going to find out your human body dimensions.
You and your group will be taking turns measuring each other. You will all record your
own data on your own chart. Then you will convert the measurements to mm, then write
them in scientific notation. Next we will be making graphs comparing your data to the
class’ data. Finally we will be drawing ourselves to scale.
cm
Dimensions
Armspan
Fingertip to Fingertip)
Height
(Head to Toe)
Leg Length
(Floor to Waist)
Arm Length
(Fingertip to Shoulder)
Knee to Floor
Waist to Knee
Forearm
(Wrist to Elbow)
Foot
(Heel to Toe)
Head Length
(Top to Chin)
Hand Span
(Tip of Thumb to Pinkie)
Hand Length
(Wrist to Middle Fingertip)
Neck Length
Shoulder to Waist
Foot Width
(At Widest Point)
Thumb Length
(Knuckle to Tip)
- 14 -
mm
Notation
Agenda 11.14
Objectives:
SWBAT Construct a DNA molecule based on Chargaff’s rule
Do Now:
Which of the following statements best describes a DNA molecule?
A. It is a double helix.
B. It contains the sugar ribose.
C. It is composed of amino acids.
D. It contains the nitrogenous base uracil
Homework:
Read p.203 answer questions 1-3
Build your own model of DNA. At least 20 nucleotides long for
each side of the double helix.
Agenda 11.14
1.
2.
3.
4.
5.
Review Lab & Journal Entries
Discuss Size of DNA
Video on DNA
Notes on DNA Structure
Practice Constructing DNA
- 15 -
11/14/2008
DNA Structure
Deoxyribose Nucleic Acid: DNA
Double Helix Shape
Base Pairing Rules: Complementary base pairs
are found in equal amounts in DNA.
AKA (Chargarffs Rule)
Adenine pairs with Thymine
Guanine pairs with Cytosine
Purine: double ring of N and C
Adenine and Guanine
Pyrimidine: single ring of N and C
Cytosine and Thymine
DNA Building
One DNA strand has the following nucleotide
sequence:
ATGAGC
Construct this DNA strand and the complementary
strand to make a 12 nucleotide DNA Double Helix.
Key:
T = Yellow, G= Orange, C = Blue, A = Green
Hollow White = Phosphate, Black = Sugar,
Solid White = Hydrogen Bond
Exit Slip
What is the complementary strand to DNA
strand ATGGCT?
a. TTCGAT
b. TACCGA
c. GCAATC
d. CGTTAG
- 16 -
Agenda 11.21
Objectives:
SWBAT Model replication, transcription, and translation
Observe Silent and Observed Mutations
Do Now:
The diagram below represents
part of a process that occurs
in cells.
Which process is represented?
A. Meiosis
B. Transcription
C. Replication
D. Translation
Homework:
MCAS Open Response Question
Agenda 11.21
1.
2.
3.
Replicate DNA and transcribe into mRNA
then translate into amino acids
Make Mutations
Cavinine Resistance Lab
- 17 -
In 1950, Erwin Chargaff and colleagues examined the
chemical composition of DNA and demonstrated that
the amount of adenine always equals that of thymine,
and the amount of guanine always equals that of
cytosine. This observation became known as Chargaff's
rule.
a. Based on current knowledge of the structure of DNA,
explain the basis of Chargaff's rule.
b. The diagram below represents a single-stranded
segment of DNA.
In your Student Answer Booklet, write the
complementary DNA strand that would form from this
strand during replication. Use the letters A, C, G, and T
to designate the bases: A = adenine; C = cytosine; G =
guanine; T = thymine.
c. Why is Chargaff's rule so important to DNA's ability to
replicate itself accurately?
Journal Entry
If I were to open a poisonous gas canister in
the classroom and close the windows and
doors, what would happen to all of us?
If one person happened to survive, what
would have allowed them to survive?
Exit Slip
In phenylketonuria (PKU), an enzyme
that converts one amino acid into another
does not work properly. Which of the
following is the most likely cause of
this genetic condition?
A. an error in the transcription of the gene for
the enzyme
B. a mutation in the DNA sequence that
codes for the enzyme
C. an excess of the amino acids necessary to
produce the enzyme
D. a structural variation in the amino acid
- 18 -
Yeast Mutation Lab
Goal: To demonstrate the cytotoxic and mutagenic effect of UV by measuring cell survival and
isolating canavanine-resistant mutants after UV exposure.
Background: Ultraviolet light causes DNA damage, which can lead to mutation and cell death.
As a practical example, UV-induced cell death causes sunburn and UV-induced mutagenesis
causes skin cancer. However, mutations are not all bad. They provide the genetic diversity
that fuels evolution. For instance, canavanine is toxic to yeast cells; it is an arginine analog
that disrupts protein function if incorporated during translation. Canavanine is taken up by
yeast cells through the product of the CAN1 gene, an arginine transporter. Mutations that
compromise CAN1 function prevent canavanine up-take and make cells resistant to the drug.
So, CAN1 mutants survive in canavanine, while their normal sibling die.
Supplies - with amounts/lab group:
fresh yeast colonies on an agar petri dish1
SC-arg2 agar petri dishes - 10
SC-arg agar petri dishes with 60 mg/l canavanine - 5
Plating beads3 - about 5/plate, about 50 total
UV light source - any germicidal UV lamp will do4
Replica plating block and velvets5 - one velvet for each canavanine plate
Lab:
The basic plan is to expose yeast to UV light and to measure the number of cells killed (by
counting the number of colonies formed on irradiated plates) and to measure the number of
CAN1 mutants formed (by counting the number of colonies on canavanine plates).
The first part of the lab is to measure cell killing by UV irradiation. Take a poppy-seed sized
dab of fresh yeast and suspend it in 10 ml of water. Put about 5 plating beads and 200 µl water
on each of 5 SC-arg agar plates. Add 1 µl of the dilute yeast to each plate. Shake gently to
spread the water and yeast across the plate. Let the plate dry and dump off the beads. Each
plate should now have 100-500 yeast cell on it. Put one plate aside as a control and irradiate
the other 4 with 3-fold increasing doses of UV, for instance 10, 30, 90 and 270 seconds (see
note 4). Let yeast colonies grow up on all the plates for 3-4 days at room temperature or 2-3
days in a 30˚C incubator. Count the colonies on the plates to determine the percent of cells
killed at the various doses.
The second part of the lab is to measure CAN1 mutant induction by UV irradiation. Plate cells
on 5 SC-arg agar plates, as above, but instead of using 200 µl of water and 1 µl of yeast diluted
in 10 mls, use 200 µl of yeast diluted in 1 ml; this plating should give you about 200,000 cells
per plate. UV irradiate as above. Allow the yeast to grow overnight6. Take the plates, which
should have a thin lawn of yeast on them, and replica plate them to SC-arg/canavanine plates.
Let CAN1 mutant colonies grow up. Count the number of colonies on the plates and divide the
fraction surviving at each dose in the first part to determine the CAN1 mutation rate.
- 19 -
Notes:
1 Any haploid, arginine prototrophic, CAN1+ (sensitive to canavanine) strain will do. Such
yeast are available from any yeast research lab and from lab supply companies, including
WARD'S Natural Science <http://wardsci.com>. They need to be haploid so that there is only
one allele of CAN1 to mutate. They need to be prototrophic for arginine because CAN1
mutants cannot take up arginine from the medium and thus must be able to make their own. To
get colonies, streak a small amount of yeast out on a agar plate with a toothpick and let the
cells grow into colonies for 3-4 days at room temperature or 2-3 days in a 30˚C incubator. Use
the yeast within a week or store sealed in the fridge for up to several month. Restreak stored
yeast before using.
2 SC-arginine is synthetic complete medium without arginine. It is available from lab reagent
companies, including Sunrise Science <http://www.shop.sunrisescience.com> (by special
order). Arginine in the medium counteracts the effect of canavanine.
3 Plating beads are 5 mm glass beads (vwr.com #26396-596) used for spreading yeast on
plates. They can be rinsed, sterilized and reused.
4 The one parameter that probably needs to be determined empirically is how much UV light
to use. If you know the output of your UV lamp or have a UV meter, aim for about 100 J/m2.
If you don't, you can empirically determine the amount of UV to use by plating out cells on
several plates, exposing them to UV at a constant distance (about 6-8 inches from the bulb
works well) for a range of times; 5 seconds to 2 minutes is a good first guess. Let colonies
grow up on the plates for several days and compare colony numbers to an unirradiated control
to determine cell survival. Use the amount of UV that kills about 50% of cells as the lowest
dose in your experiments.
5 Replica plating blocks are cylindrical blocks just narrower than the petri dishes. You cover
them with a piece of velvet and press the plate to be replicated face down onto the velvet.
When the plate is removed some of the yeast stays behind on the velvet and a new plate can be
pressed onto the velvet to make a replica of the original plate. Many scientific supply
companies sell replica plating equipment, including Sunrise Science
<http://www.shop.sunrisescience.com>. I am told you can use a disk of filter paper, but I have
never tried.
6 The recovery after mutagenesis and before selection is to allow CAN1 mutant cells to grow.
If you select immediately after mutagenesis, the CAN1 mutant cells will still have the arginine
transporter and will die.
- 20 -
http://www.accessexcellence.org/RC/AB/WYW/wkb
ooks/PAP/mutations.php
(Link to activity) Six groups will work as separate teams.
Activity 1: Genes, DNA, and Mutations
Objective
Students will model two ways in which genetic mutations can cause genetic disease as an
observed mutation or produce a silent mutation.
Background Information
Genetic information is stored in a cell as deoxyribonucleic acid, or DNA, which are strands
that are paired, as in the rungs of a ladder, and consists of pairs of four nucleotide bases-adenine (A), guanine (G), cytosine (C), and thymine (T). Genes within DNA can be hundreds
or thousands of base pairs long, with each gene having a specific sequence of nucleotide bases.
The DNA inherited by an organism directs the activities of each cell by specifying the
synthesis of proteins from amino acids. The formation of proteins from the genetic information
requires two main steps: transcription and translation.
During transcription, the double-stranded DNA partly unwinds. The individual strands act as a
template for the creation of messenger RNA (mRNA). Messenger RNA is a single-stranded
nucleic acid that contains the sugar ribose. It consists of four nucleotide bases--adenine (A),
guanine (G), cytosine (C), and uracil (U). These bases follow the same base-pairing rules that
govern DNA replication (where guanine pairs with cytosine, thymine pairs with adenine)
except that uracil, rather than thymine, pairs with adenine. Information for the sequence of
amino acids is contained in the mRNA in groups of three bases, known as codons. Once the
mRNA strand has been formed, it moves to the ribosomes in the cytoplasm of the cell, where
translation, or protein synthesis, takes place.
Translation involves another type of molecule known as transfer RNA (tRNA), which is an Lshaped structure that has three bases on one end (known as an anti-codon) and an amino acid
attached to the other end. The ribosomes in the cell link the anticodon on the tRNA with the
complementary codon on the mRNA. The amino acids on the tRNA detach from the tRNA and
link together in the specified order to form the protein. The tRNA then moves away from the
mRNA and is free to pick up another amino acid of the same type to add to another protein
chain.
- 21 -
Translation of messenger RNA into protein.
Many genetic disorders are due to mutations, or changes in the nucleotide sequence of
DNA. There are two main types of mutations within a gene: base-pair substitutions and basepair insertions or deletions. A base-pair substitution is the replacement of one nucleotide and
its partner with another pair of nucleotides. This type of mutation may cause either no change
in the protein; a small, insignificant change in the protein; or a major alteration. For example,
people with sickle-cell anemia have an adenine-thymine pair instead of a thymine-adenine pair
in their hemoglobin gene; this substitution results in a major change in the hemoglobin
molecule. A base-pair insertion or deletion occurs when one or more nucleotide pairs are
inserted or deleted in a gene. Usually insertion and deletion mutations cause more damage than
the single-pair substitutions because they may drastically change the sequences of the codons
downstream from the mutation.
Materials
For each group:
Handouts:
DNA and mRNA Patterns
tRNA Patterns and Amino Acid Codes
2. Scissors
3. Paper
4. Pen or pencil
o
o
Preparation
Duplicate Handouts to distribute to students. Have a handful of students either stay after to cut
out the pieces or give it as an extra credit assignment over the weekend. I also plan to use
Velcro instead of glue next year in order to be able to reuse the pieces. Paperclips turned out to
be very hard to keep together.
- 22 -
Instructions
1. Have students cut out the DNA sequence patterns from Handout 1 (see Preperation) and
put pieces together side-by-side (attaching phosphate to sugar) to form the following
single-strand sequence:
CTTTTATAGTAGATACCACAAAGG
2. Explain to students that they have just built a sequence for part of the gene that can
cause cystic fibrosis.
3. Have the students cut out the mRNA and tRNA pieces from Handouts 1 and 2 (Again
see preparation). Have them build a strand of mRNA by matching the ribonucleic bases
to the complementary bases on the DNA strand.
4. Once students have created the mRNA strand, have them model translation using the
tRNA pieces. Students should match the tRNA pieces to the corresponding codon on
the mRNA strand. Tell them to use the amino acid chart on the bottom of Handout 2 to
determine the amino acids that are carried by the tRNA. Students should record the
sequence of amino acids on a separate piece of paper. ( I also had students cut out the
names of the amino acids to complete the tactile activity and in order to check for
understanding immediately, but they still had to write the sequence down (see next
step))
5. Next, explain that students will be making base-pair substitutions in the original DNA
sequence. Have them change the nucleotide in the 15th position (from the left) of the
original DNA sequence to cytosine. Have students make the appropriate changes in the
mRNA and tRNA strands, and record the changes, if any, to the amino acid sequence.
Then ask students to change the nucleotide in the 15th position to adenine. Once again
have them record the corresponding change, if any, in the amino acid sequence.
6. Now tell students that they will be making a deletion in the original DNA sequence.
Have them remove the nucleotides in the 13th, 14th, and 15th positions. Then have
students move the nucleotide pieces to the left to close the gap that is created. Have
them make the appropriate changes in the mRNA and tRNA strands, and record the
changes, if any, to the amino acid sequence.
- 23 -
Discussion Questions
1. Does changing the sequence of nucleotides in the DNA strand always result in a
different amino acid sequence? Why or why not?
2. If the thymine in the 15th position of the sequence is changed to cytosine, the person
does not have cystic fibrosis. However, if the thymine in the 15th position is changed to
adenine, the person does have cystic fibrosis. What are some reasons this might occur?
3. Suppose that in the original DNA strand the adenine in the 14th position were changed
to cytosine. Do you think a person with the change would have cystic fibrosis? Why or
why not?
4. What happened to the amino acid sequence when you deleted three bases from the
original DNA strand?
5. What do you think would happen if a single nucleotide were added somewhere in the
sequence. Explain your answer.
- 24 -
Isoleucine
Leucine
Phenylalanine Methionine
(Start)
Alanine
Glycine
Threonine
Serine
Tryptophan
Glutamine
Histidine
Glutamic
Acid
Lysine
Arginine
Isoleucine
Leucine
Phenylalanine Methionine
(Start)
Alanine
Glycine
Threonine
Serine
Tryptophan
Glutamine
Histidine
Glutamic
Acid
Lysine
Arginine
- 25 -
Valine
Cysteine
Proline
Tyrosine
Asparagine
Asparatic
Acid
Stop
Valine
Cysteine
Proline
Tyrosine
Asparagine
Asparatic
Acid
Stop
- 26 -
Research Paper & Socratic Seminar
Overview :
Prior to this unit, students will have studied basic scientific method,
biochemistry, DNA structure, and Replication, Transcription, and Translation. This
activity will extend the structure of DNA and RNA and their functions (Central Dogma).
They will discuss the ethical and social issues that have come about as a result of
DNA technology and biotechnology.
Essential Question(s), Topics, Enduring Understanding(s):
Essential Question(s): If you choose to have genetic testing done,
who should have access to this information? Should we do
prenatal testing for diseases that today are incurable? Why or
why not? Would you want to be tested for diseases that will show
up later in your life (ie. Huntingdon’s disease or Alzheimer’s)?
Why or why not?
Essential Understanding(s): Students will understand that new
advances in DNA technology will lead to ethical and social issues
that will impact our lives.
- 27 -
Knowledge and Skills: .
Knowledge:
Explain what DNA fingerprinting is and its uses.
Name some prenatal genetic tests that may be done.
Name and describe several genetic diseases that
individuals may be tested for during their lives.
Skills:
Analyze the pros and cons of genetic testing.
Discuss some ethical or social issues that result from
biotechnology.
Performance Task for Bioethics:
Parents today are becoming more aware of DNA technology and genetic
testing and they want to talk to someone knowledgeable about the
possibility of a genetic disease in their own family. You are a genetic
counselor and a husband and wife asked you to research a particular
genetic disorder and the type of genetic testing that could be used. The
parents are not only concerned about the disease, but also ethical and
social issues that could result from the genetic testing.
1) You will need to research a genetic disorder and the testing involved and
write up a report for the parents. This report should include:
Genetic information, for example, gene or chromosome defect
and possible protein(s) affected.
Symptoms
- 28 -
Treatments
Type of testing available
Gene therapy used?
2) You will also organize a bioethics forum which includes a panel of individuals
who will discuss the ethical and social issues that could result from genetic
testing. The panel should include at least a physician, geneticist,
biotechnologist and a bioethics professor.
3) You will need to design a detailed written invitation explaining topics to be
discussed, and bios and role of the individuals on the panel. This invitation will
be given to the husband and wife who you did the report for and also many of
your other clients who have come to you with questions and concerns about
genetic testing.
4) After the forum on genetic testing, you need to make a poster summarizing
the forum information in a pros and cons format. This poster will be on
display in the waiting room of your office.
For this task, students will be assessed on the content of the genetic disorder report,
organization of the bioethics panel, the scientific detail of the written invitation, the
content of the pro/cons poster, the level of participation in the Socratic Seminar.
- 29 -
Additional Evidence(s) of Understanding:
Students will participate in a Socratic Seminar dealing with a current article on
bioethics or gene therapy. The article will be based on current research or political
decisions at the time of the debate (we focused on the octo-mom). Afterwards
students will answer a question in their portfolios regarding the seminar information.
Activities Used:
Current articles dealing with DNA, bioethics and biotechnology
will be handed out throughout the unit. Sometimes students will
have to answer certain questions referring to the article and they
will be asked to summarize and analyze the information. It may
be a written homework to be graded or it may be homework to
read and then come in the next day to discuss it.
A Socratic Seminar will be conducted with this unit as the
culminating activity. I find the selection of the article has to match
the dynamics of class: Portfolio entry will be made after the
seminar.
- 30 -
Claim Evidence and Reasoning Technique Rubric for
Research Paper and Socratic Seminar
Component
Claim - A conclusion that
answers the original
question
0
Does not make a claim or
makes an inaccurate claim.
---------------------Uses a non-genetic disorder
as topic.
Level
1 to 2
Makes an accurate but
incomplete claim.
--------------------Uses a genetic disorder that
could also be caused
"environmentally" (i.e.
diabetes, lung cancer, etc.)
3
Makes an Accurate and
complete claim.
- - - - - - - - - -- - - - - - - - - - - - Uses an appropriate genetic
disorder.
Evidence - Scientific data
that supports the claim.
The data needs to be
appropriate and sufficient
to support the claim.
Does not provide evidence,
or only provides inappropriate
evidence (Evidence that does
not support claim).
---------------------States a false cause for
genetic disorder or uses a
non-genetic disorder as topic.
Provides appropriate, but
insufficient evidence to
support claim. May include
some inappropriate evidence.
--------------------Uses an appropriate genetic
disorder but does not identify
all possible causes or
treatments available.
Provide appropriate and
sufficient evidence to support
claim.
---------------------Includes an appropriate
genetic disorder and all
possible causes and
treatments for the disease.
Reasoning - A
justification that links the
claim and evidence. It
shows why the data
counts as evidence by
using appropriate and
sufficient scientific
principles.
Does not provide reasoning,
or only provides reasoning
that does not link evidence to
claim.
---------------------Provides an inappropriate
reasoning statement like "the
genetic disease is contagious
because the mother gives it
to the child.
Repeats evidence and links it
to the claim. May include
some scientific principles, but
not sufficient.
--------------------Provides an incomplete
generalization like "since
diabetes can be diagnosed
later in life the mutated cells
must be hidden until then."
and cannot identify the
appropriate amino acid
sequence causing the
mutation.
Provides accurate and
complete reasoning that links
evidence to claim. Includes
appropriate and sufficient
scientific principles.
---------------------Includes a complete
generalization that includes
the amino acid sequence that
is involved in the studied
genetic mutation.
Rebuttal - Recognizes
alternative explanations
and provides counter
evidence for why the
alternative explanation is
not appropriate.
Does not recognize that
alternative explanations exist
and does not provide a
rebuttal or makes an
inaccurate rebuttal.
---------------------Does not look at ethical side
of genetic treatment
Recognizes alternative
explanations and provides
appropriate but insufficient
counter evidence and
reasoning in rebutting the
alternative explanation.
- - - - - - - - - - - - - - - - - - - -- Identifies that alternative
ideas may exist regarding the
ethical decision to treat or
test for genetic treatment but
does not provide explanation
as to why the benefit is
greater than the risk or vice
versa.
Recognizes alternative
explanations and provides
appropriate and sufficient
counter evidence and
reasoning in rebutting the
alternative explanation.
- - - - - - - - - - - - - - - - - - - -- - Identify and explain alternative
ethical opinions besides their
own and provide evidence to
support the benefit of their
own versus those of others.
- 31 -
DNA
Multiple Choice
Identify the choice that best completes the statement or answers the question.
____
____
____
____
____
____
____
____
1. The primary function of DNA is to
a. make proteins.
b. store and transmit genetic information.
c. control chemical processes within cells.
d. prevent mutations.
2. Molecules of DNA are composed of long chains of
a. amino acids.
c. monosaccharides.
b. fatty acids.
d. nucleotides.
3. Which of the following is not part of a molecule of DNA?
a. deoxyribose
c. phosphate
b. nitrogenous base
d. ribose
4. A nucleotide consists of
a. a sugar, a protein, and adenine.
b. a sugar, an amino acid, and starch.
c. a sugar, a phosphate group, and a nitrogenous base.
d. a starch, a phosphate group, and a nitrogenous base.
5. The part of the molecule for which deoxyribonucleic acid is named is the
a. phosphate group.
b. sugar.
c. nitrogenous base.
d. None of the above; DNA is not named after part of the molecule.
6.
Refer to the illustration above. The entire molecule shown in the diagram is called a(n)
a. amino acid.
c. polysaccharide.
b. nucleotide.
d. pyrimidine.
7. The scientists credited with establishing the structure of DNA are
a. Avery and Chargaff.
c. Mendel and Griffith.
b. Hershey and Chase.
d. Watson and Crick.
8. Watson and Crick built models that demonstrated that
a. DNA and RNA have the same structure.
b. DNA is made of two chains in a double helix.
c. guanine forms hydrogen bonds with adenine.
d. thymine forms hydrogen bonds with cytosine.
- 32 -
____
____
____
____
____
____
____
____
____
____
____
9. Chargaff’s rules, the base-pairing rules, state that in DNA
a. the amount of adenine equals the amount of thymine.
b. the amount of guanine equals the amount of cytosine.
c. the amount of guanine equals the amount of thymine.
d. Both a and b
10. The base-pairing rules state that the following are base pairs in DNA:
a. adenine—thymine; uracil—cytosine.
b. adenine—thymine; guanine—cytosine.
c. adenine—guanine; thymine—cytosine.
d. uracil—thymine; guanine—cytosine.
11. ATTG : TAAC ::
a. AAAT : TTTG
c. GTCC : CAGG
b. TCGG : AGAT
d. CGAA : TGCG
12. Which of the following is not true about DNA replication?
a. It must occur before a cell can divide.
b. Two complementary strands are duplicated.
c. The double strand unwinds while it is being duplicated.
d. The process is catalyzed by enzymes called DNA mutagens.
13. During DNA replication, a complementary strand of DNA is made for each original DNA strand. Thus,
if a portion of the original strand is CCTAGCT, then the new strand will be
a. TTGCATG.
c. CCTAGCT.
b. AAGTATC.
d. GGATCGA.
14. The function of tRNA is to
a. synthesize DNA.
b. synthesize mRNA.
c. form ribosomes.
d. transfer amino acids to ribosomes.
15. Which of the following types of RNA carries instructions for making proteins?
a. mRNA
c. tRNA
b. rRNA
d. All of the above
16. RNA differs from DNA in that RNA
a. is sometimes single-stranded.
b. contains a different sugar molecule.
c. contains the nitrogenous base uracil.
d. All of the above
17. Which of the following is not found in DNA?
a. adenine
c. uracil
b. cytosine
d. None of the above
18. RNA is chemically similar to DNA except that its sugars have an additional oxygen atom, and the base
thymine is replaced by a structurally similar base called
a. uracil.
c. cytosine.
b. alanine.
d. codon.
19. In RNA molecules, adenine is complementary to
a. cytosine.
c. thymine.
b. guanine.
d. uracil.
- 33 -
mRNA: CUCAAGUGCUUC
Genetic Code:
____ 20. Refer to the illustration above. Which of the following is the series of amino acids encoded by the piece
of mRNA shown above?
a. Ser—Tyr—Arg—Gly
b. Val—Asp—Pro—His
c. Leu—Lys—Cys—Phe
d. Pro—Glu—Leu—Val
____ 21. Refer to the illustration above. Which of the following would represent the strand of DNA from which
the mRNA strand was made?
a. CUCAAGUGCUUC
b. GAGUUCACGAAG
c. GAGTTCACGAAG
d. AGACCTGTAGGA
____ 22. Refer to the illustration above. The anticodons in tRNA for the codons in the mRNA in the diagram are
a. GAG—UUC—ACG—AAG.
b. GAG—TTC—ACG—AAG.
c. CUC—GAA—CGU—CUU.
d. CUU—CGU—GAA—CUC.
____ 23. During translation, a ribosome binds to
a. DNA.
c. protein.
b. mRNA.
d. a peptide bond.
- 34 -
____ 24. Suppose that you are given a polypeptide sequence containing the following sequence of amino acids:
tyrosine, proline, aspartic acid, isoleucine, and cysteine. Use the portion of the genetic code given in the
table below to determine the DNA sequence that codes for this polypeptide sequence.
mRNA
UAU, UAC
CCU, CCC, CCA, CCG
GAU, GAC
AUU, AUC, AUA
UGU, UGC
____ 25.
____ 26.
____ 27.
____ 28.
____ 29.
____ 30.
Amino acid
tyrosine
proline
aspartic acid
isoleucine
cysteine
a. AUGGGUCUAUAUACG
b. ATGGGTCTATATACG
c. GCAAACTCGCGCGTA
d. ATTGGGCTTTAAACA
Each of the following is a type of RNA except
a. carrier RNA.
c. ribosomal RNA.
b. messenger RNA.
d. transfer RNA.
During transcription,
a. proteins are synthesized.
c. RNA is produced.
b. DNA is replicated.
d. translation occurs.
Transcription is the process by which genetic information encoded in DNA is transferred to a(n)
a. RNA molecule.
c. uracil molecule.
b. DNA molecule.
d. transposon.
Each nucleotide triplet in mRNA that specifies a particular amino acid is called a(n)
a. mutagen.
c. anticodon.
b. codon.
d. exon.
During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of
a growing protein chain when
a. the ribosomal RNA anticodon is paired up with the messenger RNA codon.
b. the transfer RNA anticodon is paired up with the messenger RNA codon.
c. a “stop” codon is encountered.
d. the protein chain sends a signal through the nerve cells to the brain.
An error in DNA replication can cause
a. mutations.
c. genetic variation.
b. cancer.
d. All of the above
____ 31.
In phenylketonuria (PKU), an enzyme that converts one amino acid into another does not
work properly. Which of the following is the most likely cause of this genetic condition?
a. an error in the transcription of the
gene for the enzyme
b. a mutation in the DNA sequence
that codes for the enzyme
c. an excess of the amino acids
necessary to produce the enzyme
d. a structural variation in the amino
acid modified by the enzyme
- 35 -
____ 32.
The mold Aspergillus flavus grows on grain. A. flavus produces a toxin that binds to DNA
in the bodies of animals that eat the grain. The binding of the toxin to DNA blocks
transcription, so it directly interferes with the ability of an animal cell to do which of the
following?
a. transfer proteins from
the endoplasmic reticulum to
Golgi complexes
b. transport glucose across
the cell membrane into
the cytoplasm
c. produce ATP using energy
released from glucose and
other nutrients
d. send protein-building instructions
from the nucleus to the cytoplasm
and ribosomes
____ 33.
Which of the following best describes the result of a mutation in an organism's
DNA?
a. The mutation creates entirely
new organisms.
b. The mutation may produce
a zygote.
c. The mutation causes damage
when it occurs.
d. The mutation may cause
phenotypic change.
- 36 -
Essay
34. The chart below shows some triplets from a DNA sequence (codons) and their corresponding
amino acids.
DNA Codon
Amino Acid
AGA
Arginine
AGG
Arginine
AGC
Serine
AGT
Serine
GGA
Glycine
GGT
Glycine
GGC
Glycine
GGG
Glycine
TTG
Leucine
TGG
Tryptophan
TCG
Serine
TCT
Serine
A sequence of DNA in a gene reads
.
A. What is the sequence of amino acids that is produced when this gene is translated?
, what will the sequence of amino acids
B. If the DNA is mutated to read
be?
C. Rewrite the original DNA sequence with a single mutation that would not change the
sequence of amino acids.
D. Explain how a mutation can change the DNA but not change the amino acid sequence.
- 37 -
35. In 1950, Erwin Chargaff and colleagues examined the chemical composition of DNA and
demonstrated that the amount of adenine always equals that of thymine, and the amount of
guanine always equals that of cytosine. This observation became known as Chargaff's rule.
a. Based on current knowledge of the structure of DNA, explain the basis of
Chargaff's rule.
b. The diagram below represents a single-stranded segment of DNA. In your
Student Answer Booklet, write the complementary DNA strand that would
form from this strand during replication. Use the letters A, C, G, and T to
designate the bases: A = adenine; C = cytosine; G = guanine; T = thymine.
c. Why is Chargaff's rule so important to DNA's ability to replicate itself
accurately?
- 38 -
Making a Model of DNA
Instructions
1) Colour the individual structures on the worksheet as follows:
adenine = red
guanine = blue
phosphate = brown
thymine = green
cytosine = yellow
deoxyribose = purple
2) Cut out each structure.
3) Using the small symbols (squares, circles and stars) on the structures as guides,
line up the bases, phosphates and sugars.
4) Glue the appropriate pairs together to form nucleotides.
5) Construct the right side of your DNA molecule by putting together in sequence a
cytosine, thymine, guanine and adenine nucleotide.
6) Complete the left side of the DNA ladder by adding complementary nucleotides or
nucleotides that fit. Your finished model should resemble a ladder.
7) To show replication of your model, separate the left side from the right side on your
desk, leaving a space of about 15 to 20 cm.
8) Using the remaining nucleotides, add to the left side of the model to build a new
DNA molecule. Do the same with the separated right side.
9) Tape or glue the nucleotides together to form two complete identical DNA ladders
or molecules.
10) Answer the following questions.
1 of 9
Making a Model of DNA
Questions
a) When constructing the DNA molecule, what did you notice about the orientation of
the two strands?
b) Define replication.
c) What DNA strand would bond opposite
S----P----S----P----S----P----S----P----S----P----S
T
G
G
A
C
C
d) How does DNA of yellow perch differ from human DNA?
e) Would yellow perch DNA be closer to walleye DNA or deer DNA? Why?
2 of 9
MANITOBA FISHERIES @ http://www.gov.mb.ca/conservation/fish/
Sugar
Phosphate
Backbone
Base Pairs
A
P
T
S
C
S
A
S
S
P
A
P
S
P
T
P
S
P
G
P
Sugar
Phosphate
Backbone
T
S
S
P
C
P
Base Pair
G
S
S
P
G
P
S
Nucleotide
C
S
P
MANITOBA FISHERIES @ http://www.gov.mb.ca/conservation/fish/
Making a Model of DNA
Example
3 of 9
Making a Model of DNA
Cut out sheet
Guanine
Adenine
Cytosine
Thymine
Guanine
Adenine
Cytosine
Thymine
Guanine
Adenine
Cytosine
Thymine
Guanine
Adenine
Cytosine
Thymine
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
4 of 9
Making a Model of DNA
Cut out sheet
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
5 of 9
Making a Model of DNA
Cut out sheet
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Deoxyribose
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
Phosphate
6 of 9
Making a Model of DNA
Answer key
1) Colour the individual structures on the worksheet as follows:
adenine = red
guanine = blue
phosphate = brown
thymine = green
cytosine = yellow
deoxyribose = purple
2) Cut out each structure.
3) Using the small symbols (squares, circles and stars) on the structures as guides,
line up the bases, phosphates and sugars.
4) Glue the appropriate pairs together to form nucleotides.
Deoxyribose
Purple
Adenine
Red
Thymine Nucleotide
Deoxyribose
Purple
Thymine
Phosphate
Brown
Green
Guanine Nucleotide
Phosphate
Brown
Deoxyribose
Purple
Phosphate
Brown
Guanine
Blue
Cytosine Nucleotide
Deoxyribose
Purple
Cytosine
Adenine Nucleotide
Phosphate
Brown
Yellow
5) Construct the right side of your DNA molecule by putting together in sequence a
cytosine, thymine, guanine and adenine nucleotide.See next page.
6) Complete the left side of the DNA ladder by adding complementary nucleotides or
nucleotides that fit. Your finished model should resemble a ladder. See next page.
7) To show replication of your model, separate the left side from the right side on your
desk, leaving a space of about 15 to 20 cm.
8) Using the remaining nucleotides, add to the left side of the model to build a new
DNA molecule. Do the same with the separated right side.
9) Tape or glue the nucleotides together to form two complete identical DNA ladders
or molecules.
10) Answer the following questions.
7 of 9
Making a Model of DNA
Answer key
5) Construct the right side of your DNA model
by putting together in sequence a cytosine,
thymine, guanine and adenine nucleotide.
Phosphate
Cytosine
Deoxyribose
Guanine
Deoxyribose
Phosphate
Phosphate
Adenine
Deoxyribose
Thymine
Deoxyribose
Phosphate
Phosphate
Deoxyribose
Guanine
Cytosine
Deoxyribose
Phosphate
Phosphate
Phosphate
Adenine
Thymine
6) Complete the left side of the DNA ladder by
adding complementary nucleotides or
nucleotides that fit. Your finished model
should resemble a ladder.
Deoxyribose
Deoxyribose
8 of 9
Making a Model of DNA
Answer key
QUESTIONS:
a) When constructing the DNA molecule, what did you notice about the orientation of
the two strands?
One of the strands is inverted.
b) Define replication.
Replication is the process by which genetic material, a single-celled organism or a virus
reproduces or makes a copy of itself.
c) What DNA strand would bond opposite
S----P----S----P----S----P----S----P----S----P----S
T
G
G
A
C
C
A
C
C
T
G
G
d) How does DNA of yellow perch differ from human DNA?
DNA of yellow perch would be different from human DNA since it would have
different chromosomes and different nucleotide pairings.
e) Would yellow perch DNA be closer to walleye DNA or deer DNA? Why?
Yellow perch DNA would be closer to walleye DNA because they are both species of fish.
Their genetic make-up would be very similar since they are more closely related to each
other than to deer.
9 of 9