Download Functional dissection of the baculovirus late expression factor

Journal of General Virology (2003), 84, 1817–1826
DOI 10.1099/vir.0.19083-0
Functional dissection of the baculovirus late
expression factor-8 gene: sequence requirements
for late gene promoter activation
Jane S. Titterington,3 Tamara K. Nun4 and A. Lorena Passarelli
Correspondence
Lorena Passarelli
[email protected]
Received 3 January 2003
Accepted 13 March 2003
Molecular, Cellular and Developmental Biology Program, Division of Biology, Kansas State
University, 232 Ackert Hall, Manhattan, KS 66506-4901, USA
The late expression factor-8 gene (lef-8) of Autographa californica M nucleopolyhedrovirus
encodes the largest subunit of the virally encoded DNA-directed RNA polymerase specific for
the transcription of late and very late viral genes. The sequence of lef-8 predicts a C-terminal
motif of 13 amino acids that is conserved in other polymerases. Detailed mutagenesis
throughout lef-8 was performed, including this C-terminal motif, to define sequences required
for late promoter activation. It was found that the conserved C-terminal motif was critical for
late gene expression. In addition, regions throughout the entire lef-8-encoding sequence were
important for optimal function, suggesting complex protein–protein and protein–DNA
interrelationships in the late gene-specific viral transcriptosome.
INTRODUCTION
Baculoviruses belong to the family Baculoviridae, a diverse
family of invertebrate-specific viruses with large, enveloped,
double-stranded circular DNA genomes (Burgess, 1977;
Schafer et al., 1979). Autographa californica M nucleopolyhedrovirus (AcMNPV), the best-studied baculovirus, has a
biphasic replication cycle producing two forms of the virus
with identical genetic makeup and nucleocapsid structure:
the budded virus spreads systemically within the insect
and the occluded virus spreads infection naturally in the
wild when ingested by a host (reviewed by O’Reilly et al.,
1992). Upon infection of permissive cells with AcMNPV,
viral genes are transcribed during three phases, designated
early, late and very late. Early genes are transcribed prior
to viral DNA replication by the host RNA polymerase II
and host transcription accessory factors and, in some
cases, also require specific virus factors. Their promoter
regions resemble those of host promoters, supporting their
dependence on the host transcription apparatus (reviewed
by Friesen, 1997). In contrast, expression of late and very
late genes is dependent on viral DNA replication and
requires viral late expression factor (lef) genes for optimal
expression in transient reporter gene expression assays. A
total of 22 late/very late expression factors have been
identified (Li et al., 1999; Lu & Miller, 1995; Rapp et al.,
1998; Todd et al., 1995) with differential requirements for
late and very late promoters and in different cell lines. The
3Present address: University of Kansas Medical Center, Kansas City,
KS 66160, USA.
4Present address: University of North Carolina, Chapel Hill, NC 27599,
USA.
0001-9083 G 2003 SGM
lef genes include the subunits of the viral DNA-directed
RNA polymerase, an a-amanitin- and tagetitoxin-resistant
enzyme, and genes involved in viral genome replication
(Glocker et al., 1993; Grula et al., 1981; Guarino et al., 1998b;
Huh & Weaver, 1990; Li et al., 1999; Lu & Miller, 1995; Rapp
et al., 1998; Todd et al., 1995). Unlike early genes, late and
very late genes are transcribed from a transcription
initiation and promoter sequence, basically consisting of
only four nucleotides (TAAG) (Ooi et al., 1989; Rankin
et al., 1988; Rohrmann, 1986).
Baculoviruses are the only nuclear-replicating DNA viruses
that use a virally encoded multisubunit polymerase to
transcribe late and very late genes (Guarino et al., 1998b).
Poxviruses are other eukaryotic viruses with DNA genomes
that encode a complex DNA-directed RNA polymerase
but, unlike baculoviruses, they replicate in the cytoplasm
of permissive cells and rely on their encoded products to
carry out most of their DNA and RNA biosynthetic
reactions (reviewed by Moss, 2001). African swine fever
virus, a cytoplasmic double-stranded DNA virus with
genetic similarities to poxviruses and iridoviruses, also
encodes a DNA-directed RNA polymerase. Baculoviruses
could have evolved this enzyme to preferentially and
efficiently transcribe viral genes over host genes during
the post-replication phase or to discriminate expression of
early viral genes in a tightly regulated manner.
Four lef genes, lef-8, lef-4, lef-9 and p47, were found to be
part of an RNA polymerase activity isolated from virusinfected cells specific for the transcription of late and very
late promoter templates in vitro (Guarino et al., 1998b). This
simple four-subunit enzyme has the ability to bind DNA
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Printed in Great Britain
1817
J. S. Titterington, T. K. Nun and A. L. Passarelli
(Guarino et al., 1998b) and, potentially, to modify the 59
(Gross & Shuman, 1998; Guarino et al., 1998a; Jin et al.,
1998) and 39 ends (Jin & Guarino, 2000) of transcripts.
Although the specific role of each subunit in transcription
is not known, the product of lef-4 (LEF-4) has RNA 59triphosphatase, nucleoside triphosphatase and guanylyltransferase activities, predicting its role as a capping enzyme
(Gross & Shuman, 1998; Guarino et al., 1998a; Jin et al.,
1998). LEF-9 contains five of seven residues of the motif
NADFDGD present in the large subunits of DNA-directed
RNA polymerases (Broyles & Moss, 1986; Lu & Miller,
1994). This motif is part of the catalytic centre of RNA
polymerases, but whether this motif is important for the
function in LEF-9 is not known. Less is known about the
role of p47 in transcription, but a virus with a temperaturesensitive p47 allele is defective in the production of late and
very late proteins at non-permissive temperatures (Carstens
et al., 1994; Partington et al., 1990).
The AcMNPV lef-8 gene was first discovered as one of 19
genes required for the expression of late and very late genes
in SF-21 insect cells (Passarelli et al., 1994). It encodes a
protein, LEF-8, that predicts a 102 kDa product with a
conserved C-terminally positioned sequence motif of 13
amino acids, GXKX4HGQ/NKGV/I, also found at the C
terminus of the b or b9 subunits of DNA-directed RNA
polymerases in animals, plants, eubacteria and archaeobacteria (Passarelli et al., 1994). However, LEF-8 has no
other obvious sequence similarities to known RNA polymerases. Furthermore, this 13-residue motif is located
within the Escherichia coli RNA polymerase conserved
region H and has been proposed to be part of the catalytic
site of the E. coli enzyme complex (Schultz et al., 1993).
In this study, we performed a detailed deletion analysis of
LEF-8, the largest subunit of the AcMNPV DNA-directed
RNA polymerase complex, in order to define domains
important for expression from a late viral promoter. Sitespecific mutagenesis analysis of the C-terminal motif
sequence within LEF-8, which is part of the catalytic
pocket of homologous polypeptides, revealed the importance of this motif in activity. Mutations throughout lef-8
had negative effects on its function, suggesting the possibility that multiple surfaces of the protein are important
for its function in transcription.
METHODS
Cells. The lepidopteran cell line IPLB-SF-21 (SF-21) (Vaughn et al.,
1977) was grown at 27 uC in TC-100 medium (Invitrogen) supplemented with 10 % foetal bovine serum (Invitrogen) and 0?26 %
tryptose broth (O’Reilly et al., 1992).
lef library and reporter plasmid constructs. The 19 plasmids,
each encoding an AcMNPV lef gene (lef-1 to lef-12, ie-1, ie-2, p143,
p47, 39K, p35 and dnapol) necessary for optimal late promoter gene
expression, hereafter referred to as the lef library, have been described previously and shown to be expressed and able to activate
late promoters (Rapp et al., 1998). The expression of each LEF is
controlled by the Drosophila melanogaster heat shock protein 70
1818
promoter, and the coding sequences are fused to both the influenza
virus haemagglutinin (HA) epitope and polyhistidine tags at the N
terminus. The plasmid pCAPCAT (Thiem & Miller, 1990), containing the late promoter of the major capsid gene, vp39, in front of the
bacterial reporter gene encoding chloramphenicol acetyltransferase
(CAT), was used to monitor activation of late genes.
Mutagenesis. The plasmid described above containing lef-8,
pHSEpiHislef8 (Rapp et al., 1998), was used as a template to make
all of the mutations within lef-8. Although lef-8 has a dual tag at its
N terminus, its activity is equivalent to that of the native lef-8 in
transient gene expression assays (Rapp et al., 1998; data not shown)
and this tagged version of lef-8 will be referred to as wild-type lef-8.
All site-directed mutations and N-terminal deletions were confirmed
by nucleotide sequence analysis and other deletions and mutations
introducing EcoRI sites were confirmed by restriction endonuclease
digestion. Mutations within the RNA polymerase homologous motif
were created using the Transformer Site-Directed Mutagenesis kit
(Clontech), whereas the remaining mutations were introduced using
the Quik-Change Mutagenesis kit (Stratagene). Oligonucleotides
used for mutagenesis are shown in Table 1, except for oligonucleotides with the complementary sequence needed for the Quik-Change
mutagenesis method.
C-terminal truncations within LEF-8 were made by introducing a BglII
site every 50 amino acids (on average, at aa 482, 530, 581, 633, 684, 735,
776 and 825) followed by a premature stop codon, TGA, which is
also found in the wild-type LEF-8 sequence, thus truncating the
polypeptide from that amino acid to the last amino acid (aa 876).
An arginine and a serine provided by the restriction site were thus
inserted before the stop codon. Numbers in the plasmid names indicate
the amino acids in LEF-8 that were deleted (e.g. Del 482–876).
Oligonucleotides used for C-terminal truncations were lef8BglIITGA482, lef8BglIITGA-530, lef8BglIITGA-581, lef8BglIITGA-633,
lef8BglIITGA-684, lef8BglIITGA-735, lef8BglIITGA-776, and
lef8BglIITGA-825, where the numbers correspond to the amino acid
position in LEF-8 where the BglII restriction site was inserted
(Table 1).
N-terminal deletions within LEF-8 were made by amplifying the
lef-8 sequence with oligonucleotides lef8 : 879-900 and lef8 : 40017BglII or lef8 : 604-21BglII between the XhoI site within the lef-8
ORF and either amino acid 66 or 134 that was preceded by a BglII site.
This amplified sequence was then inserted, maintaining the correct
reading frame, into pHSEpiHislef8 at the XhoI and BglII sites. The BglII
site in pHSEpiHislef8 is positioned immediately downstream of the
epitope tags and upstream of the lef-8 ORF.
Internal deletions were made by replacing two pairs of LEF-8 amino
acids with a pair of EcoRI sites encoding the amino acids glutamic acid
and phenylalanine approximately every 50 amino acids throughout
the ORF and being careful to introduce these amino acids at the
most conserved positions to cause the least disruption. The plasmids
containing these EcoRI sites were digested with EcoRI and ligated,
thereby creating a deletion. Thus, we generated a panel of single
EcoRI substitutions every 50 amino acids and one containing two
EcoRI substitutions spaced 50 amino acids apart throughout LEF-8.
Oligonucleotides were designated lef8RI-X, where X is the LEF-8
amino acid number where the insertion occurred. Plasmid clone
names denote where one (e.g. RI 99; one amino acid position noted)
or two (e.g. RI 99,153; two amino acid positions noted and separated
by a comma) EcoRI sites were introduced or whether a deletion
between two EcoRI sites was made (e.g. Del 99–153; two amino acid
positions noted and separated by a hyphen).
Co-transfections and CAT assays. Approximately 16106 cells
in 35 mm dishes were co-transfected for 4 h at 27 uC using 3–6 ml
of a 1?5 : 1 sonicated mixture of N-[2,3-(dioleoyloxy)propyl]N,N,N-trimethylammonium chloride salt (Avanti Polar Lipids) and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Journal of General Virology 84
Mutational analysis of AcMNPV lef-8
Table 1. Oligonucleotides used for the mutagenesis of lef-8
Oligonucleotide sequences*
Mutation type and position
EcoRI mutations
CACAGATCTACGGAATTCGTTCAAGATTTC
GTTGCGCTCTTAATGAATTCCTCAGTTGCGTAATG
GGCAGATTTTTGGAATTCCCCAACATAATG
CAAGACGACGTCGAATTCGCTCGAGACGTG
CACAAGCAACAACTCGTGGAATTCATAAAAATTATTATGAATCACG
GCCGACGACGACGAATTCACGGTGGCGAAC
CCCAATCAACAGGAATTCAGCAGCAATAAC
GAAATTTATTGGCAGTGAATTCCACGGCGAAATGAC
CGACGTTCAAGACGACGAATTCCTGATCGCGTTTAATG
CGTTAATCATCACGAATTCATGATATGCATC
CGATGACGTCAAAGAATTCATGTCCAAGTTGG
GAGGAAAATTGCGAATTCGGTTTACCAAATGGC
GCGCTGCCCATTTGTGAATTCAACAACAAAGTG
CATGGCCGGTGTGTTGGTGGAATTCGCAAAGATTAATTGGGTG
CCAGCATGGTGGAATTCGGCGACAACG
CTGTCGCCCGTCGAATTCTTGTCTCGCCAG
CCCGACAATATTTTCAAAGAATTCATTAAAACAAGCC
CTGCGGCGAATTCAACGTGG
C-terminal deletions
GACACCCTACGAAAGATCTTGATATAAACATTC
CCACGCCCGTACCCAGATCTTGAATTGTGTCCCTAACC
GTTTAAATTGTGGACGTTGAGATCTTGAGACAATAAACTCATGACC
CGAATAGTAGCGACAGATCTTGATACGTTGCGCTAGACG
CGTTTACAAAGTGTACGTTTACAGATCTTGACAAATTAAAAATCAAAAAATTG
CAGAAAGGTGTGTTTAGATCTTGAAGCGAAGACCTGACCG
GAGCGCAAATATGTGAGATCTTGAGGTGGAAATCATGACG
GTCGAAGGCACTAGATCTTGAGATCAATGGACAAAGAATC
N-terminal deletions
GAAGATCTTTCGGCACGCGCTTAGAC
GAAGATCTGAGAAGCACATCAATCGC
CAGTTCTATCAAATAGGCGTGC
Region H homologous motif mutations
GTGGCATTCACGCTCAGAAAGGTGTG
GTGGCATTCACAGTCAGAAAGGTGTG
GGAAGGAATAGCAATATGTGGCATTCAC
GGAAGGAATAAGAATATGTGGCATTCAC
CACGGTCAGGCAGGTGTGTTTAACC
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
EcoRI
at
at
at
at
at
at
at
at
at
at
at
at
at
at
at
at
at
at
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
aa
BglII+TGA
BglII+TGA
BglII+TGA
BglII+TGA
BglII+TGA
BglII+TGA
BglII+TGA
BglII+TGA
3
53
99
153
202
255
306
354
408
456
506
553
603
652
701
759
809
859
at
at
at
at
at
at
at
at
aa
aa
aa
aa
aa
aa
aa
aa
Designation
lef8RI-3
lef8RI-53
lef8RI-99
lef8RI-153
lef8RI-202
lef8RI-255
lef8RI-306
lef8RI-354
lef8RI-408
lef8RI-456
lef8RI-506
lef8RI-553
lef8RI-603
lef8RI-652
lef8RI-701
lef8RI-759
lef8RI-809
lef8RI-859
482
530
581
633
684
735
776
825
lef8BglIITGA-482
lef8BglIITGA-530
lef8BglIITGA-581
lef8BglIITGA-633
lef8BglIITGA-684
lef8BglIITGA-735
lef8BglIITGA-776
lef8BglIITGA-825
BglII before aa 67
BglII before aa 135
nt 8604–8621D
lef8 : 400-17BglII
lef8 : 604-21BglII
Lef8 : 879-900
GRA at position 729
GRS at position 729
KRA at position 723
KRR at position 723
KRA at position 731
LEF8
LEF8
LEF8
LEF8
LEF8
G729A
G729S
K723A
K723R
K731A
*Restriction endonuclease recognition sites are underlined.
DPassarelli et al. (1994).
L-a-phosphatidylethanolamine
(Sigma) lipids, 2 mg pCAPCAT and
0?5 mg of each lef in the lef library (19 plasmids). Wild-type lef-8
in pHSEpiHislef8 was used in co-transfections or substituted for
lef-8 carrying a mutation as indicated. The vector plasmid
pBlueScript (Stratagene) was used in each co-transfection reaction
to maintain a constant concentration of DNA in each reaction if
needed. Cells were harvested 48 h after co-transfection, a protein
lysate was then obtained and CAT activity was assayed, as described
previously (Passarelli & Miller, 1993). Each transfection was performed between three and nine times and the average of these
experiments is presented.
Immunodetection. Approximately 16106 cells were transfected
with 2 mg of an HA- and histidine-tagged LEF-8, as described above.
http://vir.sgmjournals.org
Due to difficulties in detecting LEF-8 expression, we routinely
used N–CBZ–LEU–LEU–LEU–AL (MG 132, Sigma), a proteasome
inhibitor, to increase the levels of accumulated protein available for
detection. At 24 h post-transfection, the proteasome inhibitor MG
132 was added to a final concentration of 50 mg ml21 and the cells
were incubated for 30 min at 27 uC. Cells pre-treated with MG 132
were then incubated at 42 uC for 30 min to induce expression of
lef-8 from the heat shock 70 promoter. LEF-8 was allowed to be
expressed for 2 h at 27 uC before harvesting cells. Cells were washed
twice with PBS and collected with 100 ml of Laemmli’s loading
buffer. Proteins were resolved by 8 % SDS-PAGE, transferred to a
PVDF membrane (Pierce) and immunodetected with a 1 : 1000
dilution of HA.11 monoclonal antibody (Covance), 1 : 3000 dilution
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
1819
J. S. Titterington, T. K. Nun and A. L. Passarelli
of goat anti-mouse IgG–horseradish peroxidase (Bio-Rad) and
SuperSignal chemiluminescent substrate (Pierce). Images were prepared using Adobe Photoshop 7.0.
RESULTS
Analysis of the predicted polypeptide sequence of lef-8 does
not reveal overall homology to other known polypeptides
except to other baculovirus lef-8 homologues. The most
obvious similarity is in the C-terminal motif of 13 amino
acids (aa 721–733 of LEF-8) and flanking residues to other
RNA polymerases in several organisms; however, other
domains found in these evolutionarily conserved enzymes
are not obvious in lef-8. Thus, in order to begin studying
the function of this simple viral RNA polymerase complex,
we performed mutagenesis throughout the coding sequence
of LEF-8 to map regions required for function.
The lef-8 sequence encodes 876 amino acids and predicts
a 102 kDa polypeptide, the third largest predicted polypeptide in the AcMNPV sequence. To analyse regions
critical for function, we created a panel of both terminal and
internal deletions of approximately 50 amino acids in
length. In the process of constructing these deletion sets, we
substituted between one and four amino acids by inserting
one or two EcoRI sites at one or two positions approximately 50 amino acids apart. In addition to being useful for
generating deletions, these EcoRI mutants also effectively
introduced point mutations throughout the lef-8 sequence
and allowed us to evaluate the importance of single amino
acids in late gene expression. A schematic of the mutagenesis
strategy is illustrated in Fig. 1.
Mutations in the LEF-8 RNA polymerase
homologous motif
A C-terminal motif of 13 amino acids positioned within
region H of RNA polymerases has been proposed to be
part of the catalytic centre of the enzyme and crucial for
transcription. However, the importance of this motif,
GIKICGIHGQKGV, in LEF-8 function had not been determined. We made alanine substitutions at three conserved
Fig. 1. Schematic diagram showing deletion clones of lef-8. The top line represents wild-type lef-8 and the box indicates the
approximate position of the LEF-8 region H homologous motif. N and C indicate the N- and C-termini of LEF-8, respectively.
The next two lines represent N-terminal deletions of 66 and 134 amino acids, respectively. N-terminal deletions retain the
initiation methionine codon as well as in-frame HA and polyhistidine tags. Numbering in the deletions refers to the amino acid
numbers in the native LEF-8 sequence. An in-frame BglII site was used after the tags to bridge the N- and C-termini. The
subsequent eight lines represent C-terminal deletions of decreasing size. The C terminus of each clone contains a BglII
followed by the native stop codon. The last 17 lines represent internal in-frame lef-8 deletions of approximately 50 amino
acids, each containing an in-frame EcoRI site. Del, deletion; RI, EcoRI; bp, base pairs.
1820
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Journal of General Virology 84
Mutational analysis of AcMNPV lef-8
amino acids, K723, G729 and K731 (Fig. 2A). Altering either
lysine reduced late gene expression to background levels
(Fig. 2B, compare column 2 to columns 3 and 5).
Surprisingly, the G729RA mutation reduced expression
only 40 %. This glycine and the preceding residue, H728, are
invariant in the subunits of all non-baculovirus RNA
polymerases in the databases, except for that encoded by
poxviruses. The vaccinia virus A24R (rpo132) gene product
has a serine preceded by a tyrosine at these positions
(Amegadzie et al., 1991). Changing G729 to serine introduces
a longer side-chain to the general amino acid structure but
maintains hydrophilicity. This change reduced expression
to nearly background levels (Fig. 2B, compare columns
4–6). The importance of these invariant residues was
demonstrated by introducing a conserved change. Changing
K723 to arginine reduced expression 10-fold (Fig. 2B,
compare columns 1 and 7). All LEF-8 mutants were
expressed, as assessed by immunoblotting (Fig. 2C).
N- and C-terminal LEF-8 deletions
Deletion of LEF-8 amino acids 2–66 or 2–134 abolished
expression of CAT from the late capsid, vp39, promoter
(Fig. 3A). This is consistent with three internal mutations
in this region deleting amino acids 3–53, 53–99 and 99–
153 (see below and Fig. 4), and one or two amino acid
substitutions in this region (see below and Fig. 5). A
Western blot showing expression of each terminal deletion
is shown in Fig. 3(B).
All of the plasmids tested containing deletions of the C
terminus of LEF-8 did not stimulate the late promoter
significantly above background (Fig. 3C) but were expressed
(Fig. 3D). This is consistent with results obtained with
EcoRI mutations in the region between amino acid 506 and
859 (Fig. 5). Each C-terminal deletion included at least one
amino acid essential for function (Fig. 5A), except for the
C-terminal deletions of amino acids 776–876 and 825–876,
where other residues may be important for function. In
the region between amino acids 776 and 876, we only
changed one base pair but conserved the predicted amino
acid sequence; both of these mutants, RI 809 and RI 859,
exhibited wild-type levels of activity (Fig. 5A).
Internal LEF-8 deletions
Fig. 2. Mutagenesis of the LEF-8 region H homologous motif.
(A) Amino acid sequence of the LEF-8 13-residue motif homologous to part of region H of the E. coli RNA polymerase b
subunit. Boldface letters highlight invariant residues in RNA
polymerases. The first and last LEF-8 amino acids in this
sequence motif are shown in parentheses. (B) The late major
capsid promoter controlling the chloramphenicol acetyltransferase (cat) gene was transfected with the lef library (column 1)
or the lef library lacking lef-8 (columns 2–7), as noted by the
labelled line under the graph. A plasmid containing lef-8 was
substituted for lef-8 containing mutations, as indicated below
each column. The value of 100 % CAT activity has been
assigned to the activity obtained from the activation of the late
promoter by the complete lef library. (C) Wild-type LEF-8 and
LEF-8 containing mutations in the motif shown in (A), as indicated below each lane, were expressed in SF-21 cells and
detected by immunoblotting using the anti-HA.11 monoclonal
antibody.
http://vir.sgmjournals.org
Internal deletions of approximately 50 amino acids were
made throughout LEF-8 by deleting and religating between
EcoRI sites introduced at the deletion endpoints. All of
the plasmids containing these deletions within lef-8 were
unable to substitute for the wild-type lef-8 (Fig. 4A, compare column 1 to columns 3–19), suggesting there are
regions important for function throughout the entire
length of the polypeptide. All of the mutant proteins
were expressed at levels similar to wild-type LEF-8, except
for Del 652–701, which exhibited slightly lower levels of
expression (Fig. 4B). Nevertheless, this region contained at
least one important element for function, since RI 652
(Fig. 5A) was not functional.
Targeted amino acid substitutions within LEF-8
EcoRI mutations throughout lef-8 where one or two amino
acids were substituted showed that there is very little room
for change in the lef-8 sequence. All mutations decreased
LEF-8 activity, except one at amino acid 553 and one at
amino acid 701 (the last two mutations, RI 809 and RI 859,
did not change the amino acid sequence; Fig. 5A). Both
RI 553 and RI 701 are regions of LEF-8 that are not well
conserved when aligned to other baculovirus LEF-8
sequences (see supplementary data Figs 1 and 2 at JGV
Online, http://vir.sgmjournals.org). Three mutations gave
over 50 % activity but did not fully substitute for wildtype lef-8 (RI 255, RI 306 and RI 408). One third of the
mutations with one EcoRI abolished late gene expression to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
1821
J. S. Titterington, T. K. Nun and A. L. Passarelli
Fig. 3. Effects of N- (A) and C-terminal (C)
LEF-8 deletions on late gene promoter activation. The lef library, lef library lacking lef-8
or lef library lacking lef-8 but containing a
lef-8-deletion plasmid were co-transfected
into cells with pCAPCAT, as indicated
beneath panels (A) and (C). The value of
100 % CAT activity has been assigned to
the activity obtained from the activation of
the late promoter by the complete lef library.
Immunodetection of HA-tagged LEF-8 and
deletion LEF-8 clones (B, D) with antiHA.11 monoclonal antibody, as indicated
below each lane, is shown.
A
background levels (RI 153, RI 354, RI 456, RI 603, RI 652
and RI 759) and five other mutations resulted in 50 % or
lower activity (RI 3, RI 53, RI 99, RI 202 and RI 506). Most
of the substituted residues are conserved among LEF-8
sequences, while the least conserved are RI 53, RI 202 and RI
506 (see supplementary data Figs 3, 4 and 5, respectively, at
JGV Online, http://vir.sgmjournals.org). All mutant LEF-8
proteins were expressed, except for RI 456 (Fig. 5A).
However, it is likely that a mutation at this site would be
deleterious, since the double EcoRI mutations RI 408,456
and RI 456,506 were inactive, even though mutations at RI
408 and RI 506 gave some activity above background
(Fig. 5). Expression of RI 354 was very low but the double
mutants containing an RI 354 mutation also confirmed
the likelihood that this mutation would abolish function
(Fig. 5). Finally, we could not detect any expression from
RI 652,701 and cannot make any certain conclusions about
this mutation (Fig. 5B).
B
Fig. 4. Effects of internal LEF-8 deletions on late promoter
activity. (A) The lef library (column 1) or lef library lacking lef-8
(column 2) but with a deletion clone (columns 3–19), as specified below each column, were transfected into SF-21 cells
along with the late promoter reporter gene to monitor late promoter activation. Cells were harvested 48 h post-transfection
and lysates were analysed for CAT activity and compared to
the relative CAT activity in column 1 set at 100 %. (B) Expression
from lef-8 deletion constructs was observed by immunoblotting
with anti-HA.11 monoclonal antibody and compared to HAtagged LEF-8, as indicated below each corresponding column.
Each row corresponds to a separate immunoblot.
1822
Interestingly, all double EcoRI mutations had similar activity
to that of the least active or inactive single EcoRI mutation,
except for two double EcoRI mutations, RI 3,53 and RI 53,99
(Fig. 5). RI 53,99 had almost wild-type LEF-8 activity but
neither RI 53 nor RI 99 gave more than 50 % of wild-type
LEF-8 activity. It is possible that if these two regions interact
in the same molecule, one mutation may compensate for
the other. A reaction testing RI 53 and RI 99 on separate
plasmids rather than the double mutation did not yield
activity much higher than RI 53 alone (data not shown).
DISCUSSION
To explore the function of the AcMNPV RNA polymerase, a
simple yet evolutionarily dissimilar enzyme, we began by
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Journal of General Virology 84
Mutational analysis of AcMNPV lef-8
Fig. 5. Effects of amino acid substitutions
within LEF-8 on late gene expression.
Glutamic acid and phenylalanine, encoded
by the recognition site of EcoRI, were substituted for one to four amino acids in the
LEF-8 sequence. One EcoRI site was introduced about every 50 amino acids (A) or
two sites were introduced and spaced by
about 50 amino acids (B) in LEF-8 at the
amino acid noted below each lane. The lef
library (columns 1) or the lef library lacking
lef-8 (columns 2) and containing a construct
with EcoRI mutations, as noted below the
remaining columns, were tested for their
ability to substitute for wild-type lef-8 in
activation of the major capsid late promoter.
The value of 100 % CAT activity has been
assigned to the activity obtained from the
activation of the late promoter by the complete lef library. Expression from each clone
tested is shown below the columns. In panel
(A), mutant constructs were tested for
expression in three different experiments and
compared to wild-type LEF-8, as illustrated
by separate rows.
performing detailed mutagenesis on its largest subunit, one
which contains a putative catalytic motif conserved in
region H of the E. coli b RNA polymerase subunit. We
individually altered three highly conserved RNA polymerase amino acids in LEF-8 that correspond to the active
centre in region H of the E. coli b subunit. This region
has been cross-linked to a substrate probe on initiating
NTPs (Mustaev et al., 1991). Changing K723 of LEF-8 to
alanine completely abolished the ability of LEF-8 to
activate late promoters. The conservative substitution of
K723 for arginine still resulted in a drastic reduction of
late gene expression. Surprisingly, the substitution of the
http://vir.sgmjournals.org
corresponding amino acid in the bacterial enzyme, K1065, to
an arginine did not inactivate the catalytic function leaving
initiation complexes in the abortive initiation stage. Thus,
K1065 in the E. coli RNA polymerase is critical for the
transition between transcription initiation and elongation
(Mustaev et al., 1991). This lysine residue is also conserved
in monomeric RNA polymerases, highlighting the importance of this residue within the motif in both multimeric
and monomeric enzymes. Substitution of K723 in LEF-8
for either alanine or another basic residue, arginine, also
abolished function. Unexpectedly, a construct in which the
highly conserved RNA polymerase motif residue G729 was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
1823
J. S. Titterington, T. K. Nun and A. L. Passarelli
substituted for alanine still retained over 50 % activity.
However, its substitution for serine, which is functional
in the vaccinia virus RNA polymerase subunit containing
this motif, drastically reduced activity. Thus, there is very
little room for change in this motif and this has been
apparent by its high conservation in RNA polymerases
from both unicellular and multicellular organisms and in
baculovirus LEF-8 sequences, including the divergent Culex
nigripalpus NPV (CuniNPV) (see supplementary data
Fig. 2 at JGV Online, http://vir.sgmjournals.org).
Both termini of the protein were essential for function.
Since the first two N-terminal deletions, amino acids 2–66
and 2–134, reduced late gene expression to background
levels, we did not test any additional mutations from the N
terminus. In addition, internal deletions and EcoRI mutations in that region also abolished function, suggesting that
the N terminus of the polypeptide is important for function. The structure of the N-terminal domain of the T7
RNA polymerase undergoes a dramatic reorganization
during elongation complex formation and this substrateinduced change may be a conserved mechanism in multisubunit RNA polymerases (Tahirov et al., 2002; Yin &
Steitz, 2002). Likewise, deletions from the C terminus to
approximately the middle of the polypeptide did not
support late gene expression. It was anticipated that
deletions that included the C-terminal H region RNA
polymerase homologous motif would not be functional,
since single amino acid mutations in that region abolished
function. However, we also found three deletions that did
not include this motif, starting at amino acids 825, 776 or
735 and extending to the end of the polypeptide, did not
stimulate expression from the late gene promoter.
Four observations in other systems help understand the
functional importance of the region downstream of region
H. First, a number of residues in the N- and C-terminal
regions flanking the RNA polymerase homologous motif
of LEF-8 are conserved between AcMNPV LEF-8 and
other RNA polymerases. This region of homology extends
between amino acid 691 and 765 of LEF-8. Second, protein–
RNA cross-linking interactions in the active centre of the
transcription elongation centre of the E. coli RNA polymerase mapped a continuous region of over 30 amino
acids between the beginning of region H (corresponding to
the motif in LEF-8) and the C terminus of the b subunit as
a region participating in catalysis (Markovtsov et al., 1996).
Third, H1237 in the E. coli b subunit, which is about 174
amino acids downstream of the start of the motif in region
H, affected the transition from initiation to elongation of
transcription (Mustaev et al., 1991). Although the region
downstream of the region H motif is not as long in the
baculovirus polypeptide as it is in the bacterial enzyme,
there are six histidines downstream of this motif that may
be important for this function. Alternatively, other conserved residue(s) located at the C terminus of the LEF-8
polypeptide may be required for function. Fourth, it is
known that lethal mutations in the Drosophila second
1824
largest RNA polymerase subunit map to the C terminus,
further emphasizing that this region is crucial for function
(Chen et al., 1993).
A total of 17 deletions of approximately 50 amino acids
were made throughout LEF-8. In all cases, activity was
under 10 % of that resulting when the wild-type lef-8 was
present. Although smaller deletions could have been made,
LEF-8 is among the largest baculovirus predicted polypeptides, and we chose to begin our studies by trying to scan
arbitrary 50 amino acid regions through the length of the
predicted polypeptide sequence. Instead of constructing
smaller deletions, in the process of making these deletions,
we substituted one to four amino acids throughout LEF-8
with the restriction endonuclease recognition cleavage
sequence for EcoRI and all of these were tested for function.
While all but two altered LEF-8 proteins were expressed
in SF-21 cells, the possibility remains that the mutations
affected the correct folding of the polypeptide rendering it
inactive. However, judging from the accrued knowledge
of how eukaryotic transcriptases operate, we know that
RNA polymerases are usually multimeric and interact with
a number of other factors in order to transcribe. This implies
that regions throughout the polypeptide may be required
for either protein–DNA or protein–protein interactions or
association with polymerizing substrates at the active site
and lack of one interaction may eliminate optimal function.
In the E. coli enzyme, it is known that b-D, b-H, b9-D and
b9-G regions co-ordinate Mg2+ in the active centre where
the initiating ribonucleotide chain is being synthesized.
Mg2+ is a critical requirement for in vitro transcription
of late AcMNPV promoter templates (Funk et al., 1998;
Glocker et al., 1992, 1993; Guarino et al., 1998b; Mans &
Knebel-Mörsdorf, 1998; Xu et al., 1995). We suggest that the
baculovirus RNA polymerase has conserved the modular
organization of the catalytic pocket where sequences in
different subunits are proximal in space to form the active
site. A modular organization may allow other regulatory
factors the opportunity to interact with a subunit containing one catalytic motif (Mustaev et al., 1997). Also, this
organization may be important for the reported stretching
of the active centre during elongation (Mustaev et al., 1993).
Thus, this modular arrangement may also allow for the
divergence of other regions in the LEF-8 polypeptide that
lie outside the catalytic centre. Furthermore, the protein
sequences of most, but not all, b-like RNA polymerase
subunits in the database are larger than that of LEF-8
(Passarelli et al., 1994). Although the homology between
LEF-8 and b-like RNA polymerase subunits is not as
obvious outside region H, viral LEF-8 sequences may have
condensed their function in a smaller polypeptide chain
allowing for little variation in sequence. It is possible that
the structure of this viral polymerase is similar to that of
other polymerases that are dissimilar in primary structure
but have a common function. The crystal structures of
the monomeric T7 RNA polymerase, Klenow and human
immunodeficiency virus type 1 reverse transcriptase share a
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Journal of General Virology 84
Mutational analysis of AcMNPV lef-8
common structure and these structural analyses led to the
identification of polymerase substrate specificity elements
(Sousa et al., 1993). The recent structures of yeast RNA
polymerase II and the bacterial Thermus aquaticus core
polymerase also share architectural similarities (Cramer
et al., 2000; Zhang et al., 1999). Thus, several polymerases
studied to date have evolved conserved sequences, function
and structure, thus preserving the nature of transcription
in unicellular and multicellular organisms.
AcMNPV RNA polymerase is composed of at least four
subunits, but the interactions among these subunits are
not known. There is preliminary evidence that Bombyx
mori NPV (BmNPV) LEF-8 and LEF-9 interact (Acharya
& Gopinathan, 2002). This is not unexpected, since both
polypeptides contain regions that may form the catalytic
centre of the enzyme. As mentioned before, LEF-8 has a
motif homologous to the b-H region and LEF-9 has the
short seven-residue stretch homologous to b9-D, two
regions at the heart of the enzyme. It is not known if the
other transcription-specific LEFs co-operate via protein–
protein interactions with the viral RNA polymerase.
BmNPV with a temperature-sensitive mutation within
LEF-8 was defective in vivo and cell culture, affecting late
and very late processes. The mutation was mapped to a
single nucleotide that changed A542 to valine (Shikata et al.,
1998). The corresponding amino acid in AcMNPV, amino
acid 541, is conserved at the nucleotide and amino acid
level. This amino acid is also conserved in all NPVs except
for the divergent CuniNPV (see supplementary data Fig. 1
at JGV Online, http://vir.sgmjournals.org). Deletion of
AcMNPV LEF-8 amino acids 506–553, which encompass
this residue, resulted in an inactive protein.
Small alterations that changed one to four amino acids
in LEF-8 tested in our assay all affected expression of late
genes, except in three cases in which two amino acids were
substituted (RI 553, RI 701 and RI 53,99; Fig. 5), again
denoting the significance of each region for function. The
lack of flexibility for introducing mutations in lef-8 suggests
that the transcription-associated requirements of the polypeptide are dispersed throughout its sequence. In addition,
alignment of the baculovirus LEF-8 sequences available
shows sequence conservation blocks throughout the entire
protein and this suggests there is very little room for variability. These functions may include DNA or protein interactions or tertiary structure requirements that are conserved
in RNA and DNA polymerases of prokaryotic and eukaryotic organisms. This is the first detailed analysis of a key
late gene-specific baculovirus RNA polymerase subunit.
The panel of mutations that we have constructed will aid in
detailing the steps necessary for late viral gene activation.
REFERENCES
Acharya, A. & Gopinathan, K. P. (2002). Characterization of late gene
expression factors lef-9 and lef-8 from Bombyx mori nucleopolyhedrovirus. J Gen Virol 83, 2015–2023.
Amegadzie, B. Y., Holmes, M. H., Cole, N. B., Jones, E. V., Earl, P. L.
& Moss, B. (1991). Identification, sequence, and expression of the
gene encoding the second-largest subunit of the vaccinia virus DNAdependent RNA polymerase. Virology 180, 88–98.
Broyles, S. S. & Moss, B. (1986). Homology between RNA
polymerases of poxviruses, prokaryotes, and eukaryotes: nucleotide
sequence and transcriptional analysis of vaccinia virus genes
encoding 147-kDa and 22-kDa subunits. Proc Natl Acad Sci U S A
83, 3141–3145.
Burgess, S. (1977). Molecular weights of Lepidopteran baculovirus
DNAs: derivation by electron microscopy. J Gen Virol 37, 501–510.
Carstens, E. B., Chan, H., Yu, H., Williams, G. V. & Casselman, R.
(1994). Genetic analyses of temperature-sensitive mutations in
baculovirus late expression factors. Virology 204, 323–337.
Chen, Y., Weeks, J., Mortin, M. A. & Greenleaf, A. L. (1993). Mapping
mutations in genes encoding the two large subunits of Drosophila
RNA polymerase II defines domains essential for basic transcription
functions and for proper expression of developmental genes. Mol
Cell Biol 13, 4214–4222.
Cramer, P., Bushnell, D. A., Fu, J. & 7 other authors (2000).
Architecture of RNA polymerase II and implications for the transcription mechanism. Science 288, 640–649.
Friesen, P. D. (1997). Regulation of baculovirus early gene expres-
sion. In The Baculoviruses, pp. 141–170. Edited by L. K. Miller. New
York: Plenum.
Funk, C. J., Harwood, S. H. & Rohrmann, G. F. (1998). Differential
stability of baculovirus late transcription complexes during initiation
and elongation. Virology 241, 131–140.
Glocker, B., Hoopes, R. R., Jr & Rohrmann, G. F. (1992). In vitro
transactivation of baculovirus early genes by nuclear extracts from
Autographa californica nuclear polyhedrosis virus-infected Spodoptera
frugiperda cells. J Virol 66, 3476–3484.
Glocker, B., Hoopes, R. R., Jr, Hodges, L. & Rohrmann, G. F. (1993).
In vitro transcription from baculovirus late gene promoters: accurate
mRNA initiation by nuclear extracts prepared from infected
Spodoptera frugiperda cells. J Virol 67, 3771–3776.
Gross, C. H. & Shuman, S. (1998). RNA 59-triphosphatase,
nucleoside triphosphatase, and guanylyltransferase activities of
baculovirus LEF-4 protein. J Virol 72, 10020–10028.
Grula, M. A., Buller, P. L. & Weaver, R. F. (1981). a-amanitin-resistant
viral RNA synthesis in nuclei isolated from nuclear polyhedrosis
virus-infected Heliothis zea larvae and Spodoptera frugiperda cells.
J Virol 38, 916–921.
ACKNOWLEDGEMENTS
We are very grateful to Erin Harvey for excellent technical assistance
and Kimberly Krager for constructing a number of LEF-8 internal
deletion clones. We thank Mandar Deshpande, Youping Deng and Erin
http://vir.sgmjournals.org
Crouch for help with figures and Angela Iseli and Erin Crouch for
providing cells. We are also thankful to Rollie Clem for critical reading
of the manuscript. This work was supported by the Cooperative
State Research, Education and Extension Service, National Research
Initiative Competitive Grants Program, US Department of Agriculture, under agreement number 2001-35302-09983 and by the
NIH COBRE awards IP20RR16433 and IP20RR15563. J. S. T. was
supported, in part, by the Howard Hughes Medical Institute award
number 52003057. This is contribution number 03-70-J from the
Kansas Agricultural Experiment Station.
Guarino, L. A., Jin, J. & Dong, W. (1998a). Guanylyltransferase
activity of the LEF-4 subunit of baculovirus RNA polymerase. J Virol
72, 10003–10010.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
1825
J. S. Titterington, T. K. Nun and A. L. Passarelli
Guarino, L. A., Xu, B., Jin, J. & Dong, W. (1998b). A virus-encoded
Passarelli, A. L., Todd, J. W. & Miller, L. K. (1994). A baculovirus
RNA polymerase purified from baculovirus-infected cells. J Virol 72,
7985–7991.
gene involved in late gene expression predicts a large polypeptide
with a conserved motif of RNA polymerases. J Virol 68, 4673–
4678.
Huh, N. E. & Weaver, R. F. (1990). Identifying the RNA polymerases
that synthesize specific transcripts of the Autographa californica
nuclear polyhedrosis virus. J Gen Virol 71, 195–201.
Jin, J. & Guarino, L. A. (2000). 39-end formation of baculovirus late
RNAs. J Virol 74, 8930–8937.
Rankin, C., Ooi, B. G. & Miller, L. K. (1988). Eight base pairs
encompassing the transcriptional start point are the major
determinant for baculovirus polyhedrin gene expression. Gene 70,
39–49.
Jin, J., Dong, W. & Guarino, L. A. (1998). The LEF-4 subunit of
baculovirus RNA polymerase has RNA 59-triphosphatase and ATPase
activities. J Virol 72, 10011–10019.
Rapp, J. C., Wilson, J. A. & Miller, L. K. (1998). Nineteen baculovirus
Li, L., Harwood, S. H. & Rohrmann, G. F. (1999). Identification of
Rohrmann, G. F. (1986). Polyhedrin structure. J Gen Virol 67,
additional genes that influence baculovirus late gene expression.
Virology 255, 9–19.
1499–1513.
open reading frames, including LEF-12, support late gene expression.
J Virol 72, 10197–10206.
Lu, A. & Miller, L. K. (1994). Identification of three late expression
Schafer, M. P., Rohrmann, G. F., Heine, U. & Beaudreau, G. S.
(1979). DNA from two Orgyia pseudotsugata baculoviruses:
factor genes within the 33?8- to 43?4-map-unit region of Autographa
californica nuclear polyhedrosis virus. J Virol 68, 6710–6718.
molecular weight determination by means of electron microscopy
and restriction endonuclease analysis. Virology 95, 176–184.
Lu, A. & Miller, L. K. (1995). Differential requirements for baculovirus
late expression factor genes in two cell lines. J Virol 69, 6265–6272.
Schultz, P., Célia, H., Riva, M., Sentenac, A. & Oudet, P. (1993).
Mans, R. M. W. & Knebel-Mörsdorf, D. (1998). In vitro transcription
of pe38/polyhedrin hybrid promoters reveals sequences essential for
recognition by the baculovirus-induced RNA polymerase and for the
strength of very late viral promoters. J Virol 72, 2991–2998.
Markovtsov, V., Mustaev, A. & Goldfarb, A. (1996). Protein–RNA
interactions in the active center of transcription elongation complex.
Proc Natl Acad Sci U S A 93, 3221–3226.
Moss, B. (2001). Poxviridae: The viruses and their replication. In
Fields Virology, 4th edn, pp. 2849–2883. Edited by D. M. Knipe &
P. M. Howley. Philadelphia: Lippincott Williams & Wilkins.
Mustaev, A., Kashlev, M., Lee, J. Y., Polyakov, A., Lebedev, A.,
Zalenskaya, K., Grachev, M., Goldfarb, A. & Nikiforov, V. (1991).
Mapping of the priming substrate contacts in the active center of
Escherichia coli RNA polymerase. J Biol Chem 266, 23927–23931.
Three-dimensional model of yeast RNA polymerase I determined
by electron microscopy of two-dimensional crystals. EMBO J 12,
2601–2607.
Shikata, M., Sano, Y., Hashimoto, Y. & Matsumoto, T. (1998).
Isolation and characterization of a temperature-sensitive mutant of
Bombyx mori nucleopolyhedrovirus for a putative RNA polymerase
gene. J Gen Virol 79, 2071–2078.
Sousa, R., Chung, Y. J., Rose, J. P. & Wang, B.-C. (1993). Crystal
structure of bacteriophage T7 RNA polymerase at 3?3 Å resolution.
Nature 364, 593–599.
Tahirov, T. H., Temiakov, D., Anikin, M., Patlan, V., McAllister, W. T.,
Vassylyev, D. G. & Yokoyama, S. (2002). Structure of a T7 RNA
polymerase elongation complex at 2?9 Å resolution. Nature 420,
43–50.
Mustaev, A., Kashlev, M., Zaychikov, E., Grachev, M. & Goldfarb, A.
(1993). Active center rearrangement in RNA polymerase initiation
Thiem, S. M. & Miller, L. K. (1990). Differential gene expression
mediated by late, very late, and hybrid baculovirus promoters. Gene
91, 87–94.
complex. J Biol Chem 268, 19185–19187.
Todd, J., Passarelli, A. L. & Miller, L. K. (1995). Eighteen baculovirus
Mustaev, A., Kozlov, M., Markovtsov, V., Zaychikov, E. & Denissova,
L. (1997). Modular organization of the catalytic center of RNA
genes, including lef-11, p35, 39K, and p47, support late gene
expression. J Virol 69, 968–974.
polymerase. Proc Natl Acad Sci U S A 94, 6641–6645.
Ooi, B. G., Rankin, C. & Miller, L. K. (1989). Downstream sequences
Vaughn, J. L., Goodwin, R. H., Tompkins, G. J. & McCawley, P.
(1977). The establishment of two cell lines from the insect Spodoptera
augment transcription from the essential initiation site of a
baculovirus polyhedrin gene. J Mol Biol 210, 721–736.
Xu, B., Yoo, S. & Guarino, L. A. (1995). Differential transcription
O’Reilly, D. R., Miller, L. K. & Luckow, V. A. (1992). Baculovirus
Expression Vectors: a Laboratory Manual. New York: W. H. Freeman.
Partington, S., Yu, H., Lu, A. & Carstens, E. B. (1990). Isolation of
frugiperda (Lepidoptera: Noctuidae). In Vitro 13, 213–217.
of baculovirus late and very late promoters: fractionation of
nuclear extracts by phosphocellulose chromatography. J Virol 69,
2912–2917.
temperature sensitive mutants of Autographa californica nuclear
polyhedrosis virus: phenotype characterization of baculovirus
mutants defective in very late gene expression. Virology 175, 91–102.
Yin, Y. W. & Steitz, T. A. (2002). Structural basis for the transition
Passarelli, A. L. & Miller, L. K. (1993). Three baculovirus genes
Zhang, G., Campbell, E. A., Minakhin, L., Richter, C., Severinov, K. &
Darst, S. A. (1999). Crystal structure of Thermus aquaticus core RNA
involved in late and very late gene expression: ie-1, ie-n, and lef-2.
J Virol 67, 2149–2158.
1826
from initiation to elongation transcription in T7 RNA polymerase.
Science 298, 1387–1395.
polymerase at 3?3 Å resolution. Cell 98, 811–824.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:54:00
Journal of General Virology 84