Download and GvpD-mediated transcription regulation of the p

Microbiology (2004), 150, 1829–1838
DOI 10.1099/mic.0.27078-0
GvpE- and GvpD-mediated transcription
regulation of the p-gvp genes encoding gas
vesicles in Halobacterium salinarum
Annette Hofacker,3 Kerstin-Maike Schmitz, Alexander Cichonczyk,
Simone Sartorius-Neef and Felicitas Pfeifer
Correspondence
Felicitas Pfeifer
[email protected]
Received 4 February 2004
Revised
16 March 2004
Accepted 22 March 2004
Institut für Mikrobiologie und Genetik, Technische Universität Darmstadt, Schnittspahnstr. 10,
D-64287 Darmstadt, Germany
The transcription of the 14 p-gvp genes involved in gas vesicle formation of Halobacterium
salinarum PHH1 is driven by the four promoters pA, pD, pF and pO. The regulation of these
promoters was investigated in Haloferax volcanii transformants with respect to the endogenous
regulatory proteins GvpE and GvpD. Northern analyses demonstrated that the transcription
derived from the pA and pD promoters was enhanced by GvpE, whereas the activities of the pF
and pO promoters were not affected. Similar results were obtained using promoter fusions with
the bgaH reporter gene encoding an enzyme with b-galactosidase activity. The largest amount
of specific b-galactosidase activity was determined for pA-bgaH transformants, followed by
pF-bgaH and pD-bgaH transformants. The presence of GvpE resulted in a severalfold induction
of the pA and pD promoter, whereas the pF promoter was not affected. A lower GvpE-induced
pA promoter activity was seen in the presence of GvpD in the pA-bgaH/DEex transformants,
suggesting a function of GvpD in repression. To determine the DNA sequences involved in the
GvpE-mediated activation, a 50-nucleotide region of the pA promoter was investigated by
4-nucleotide scanning mutagenesis. Some of these mutations affected the basal transcription,
especially mutations in the region of the TATA box and the putative BRE sequence element, and
also around position ”10. Mutant E, harbouring a sequence with greater identity to the consensus
BRE element, showed a significantly enhanced basal promoter activity compared to wild-type.
Mutations not affecting basal transcription, but yielding a reduced GvpE-mediated activation,
were located immediately upstream of BRE. These results suggested that the transcription
activation by GvpE is in close contact with the core transcription machinery.
INTRODUCTION
3Present address: Klinische Pharmakologie, Klinikum der Universität
Frankfurt, Theodor Stern Kai 7, D-60590 Frankfurt, Germany.
produced throughout growth, together with minor amounts
of the p-gvpACNO co-transcript. In addition, the p-gvpO
mRNA is formed predominantly during exponential
growth (Offner et al., 1996). The second gene cluster, pgvpDEFGHIJKLM, is transcribed from two promoters,
located upstream of p-gvpD (pD promoter) and p-gvpF
(pF promoter) (Fig. 1). The pD promoter is only active in
the stationary growth phase, resulting in the p-gvpDE
transcript and the formation of the two regulatory proteins
GvpD and GvpE. In contrast, the p-gvpFGHIJKLM transcript is present only during the exponential growth phase
of Hbt. salinarum (Offner & Pfeifer, 1995; Offner et al.,
1996). The functions of most of the Gvp proteins encoded
by p-gvpFGHIJKLM have not yet been determined, but
they are required for gas-vesicle formation, presumably as
accessory or minor structural gas-vesicle proteins (Offner
et al., 2000).
The GenBank accession numbers for the p-vac subfragment
sequences reported in this paper are X64729 (p-gvpACNO) and
X55648 (p-gvpDEFGHIJKLM).
In the present study, we investigated the regulation of the
four p-vac promoters in Haloferax volcanii transformants.
The formation of gas vesicles of the halophilic archaeon
Halobacterium salinarum PHH1 requires 14 gvp genes,
which are located in the p-vac region on plasmid pHH1
and arranged as p-gvpACNO and p-gvpDEFGHIJKLM gene
clusters (Horne et al., 1991; Englert et al., 1992a; see Fig. 1).
The p-vac region is related to the gvp1 gene cluster present
in two copies in the genome sequence of Halobacterium
species strain NRC-1 (Ng et al., 2000), but as a single copy in
Hbt. salinarum PHH1. The major (GvpA) and minor
(GvpC) gas vesicle structural proteins are encoded by the
p-gvpACNO gene cluster, which is transcribed from the pA
promoter. Relatively large amounts of p-gvpA mRNA are
0002-7078 G 2004 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
Printed in Great Britain
1829
A. Hofacker and others
Fig. 1. Genetic map of the p-vac region
encoding gas vesicles in Hbt. salinarum. The
14 p-gvp genes are indicated by boxes
labelled A and C through O. Arrows above
the map indicate the length and direction of
transcripts. The thick lines below the map
represent the fragments used as probes for
the Northern analyses presented in Fig. 2.
The thinner lines indicate the subfragments
used to insert in the halobacterial vector
plasmids pJAS35 (indicated) and pWL102
(all others).
This halophilic archaeon lacks gvp genes and offers a clean
genetic background for these investigations. One of the
four promoters (pA, driving the expression of the p-gvpA
gene) has already been studied in Hfx. volcanii transformants with respect to the action of GvpE (Gregor &
Pfeifer, 2001). The basal pA promoter activity results in
minor amounts of the 0?27 kb p-gvpA transcript, whereas
transformants containing p-gvpA and the p-gvpE gene
expressed under fdx-promoter control in pJAS35 (A/pEex
transformants) produce large amounts of p-gvpA mRNA,
demonstrating the transcriptional activator function of
GvpE. The pA promoter was also fused to the bgaH reading
frame, which encodes an enzyme with b-galactosidase
activity (Gregor & Pfeifer, 2001). The bgaH reading frame
has been isolated from a superblue mutant of Haloferax
alicantei (now Haloferax lucentensis) (Holmes et al., 1997;
Holmes & Dyall-Smith, 2000), and is useful as a reporter
gene. The pA-bgaH transformants exhibit the basal pA
promoter activity, while b-galactosidase activities increased
10- to 15-fold are found in pA-bgaH/pEex transformants
(Gregor & Pfeifer, 2001). The GvpE protein resembles a
basic leucine-zipper (bZIP) protein, and mutations in the
putative DNA binding region DNAB, and in conserved
residues of the leucine-zipper helix AH6 in GvpE, result in
the complete loss of its activator function (Krüger et al.,
1998; Plößer & Pfeifer, 2002).
The basal transcription machinery of archaea appears to
be a simpler version of the eukaryotic transcription system
(Bell & Jackson, 1998). A 12-subunit RNA polymerase,
the TATA-box binding protein TBP, and the transcription
factor TFB constitute the archaeal preinitiation complex.
The TATA box is a highly conserved 8 bp sequence located
24–28 nt upstream of the transcription start site. An analysis of this sequence element in hyperthermophilic archaea
indicates that it constitutes the TBP-binding site, especially
when TBP is complexed with TFB (Kosa et al., 1997;
Littlefield et al., 1999). The TFB-responsive element BRE,
a purine-rich region of 7 bp with the consensus sequence
cRnaAnt, is located upstream and adjacent to the TATA
box (Qureshi & Jackson, 1998; Bell et al., 1999a; Littlefield
et al., 1999). BRE defines the orientation of the preinitiation complex, and is also important for promoter strength
in hyperthermophilic archaea. Structural data obtained with
the ternary transcription initiation complex of Pyrococcus
1830
woesei indicate that TFB contacts TBP and DNA sequences
up and downstream of the TATA box (Kosa et al., 1997;
Littlefield et al., 1999). Additional proteins involved in
transcription are TFEa and the cleavage induction factor
TFS (Bell et al., 1999b, 2001; Hausner et al., 2000; Hanzelka
et al., 2001). In vitro analyses indicate that TFE has a
stimulatory function and stabilizes the interaction between
TBP and the TATA box when promoter recognition is not
optimal.
In vitro transcription systems are available for methanogenic and hyperthermophilic archaea, and have been used
to study the formation of the preinitiation complex and
the action of various transcription regulators (Hochheimer
et al., 1999; Bell et al., 1999a; Brinkman et al., 2000;
Enoru-Eta et al., 2000; Leonard et al., 2001; Ouhammouch
et al., 2003). However, an in vitro transcription system is
not available for halophilic archaea. The majority of the
studies on the transcriptional activator protein GvpE have
been done in vivo. It is not yet known just how GvpE
activates transcription at the pA promoter, and whether
it activates other p-vac promoters besides pA.
A second regulatory protein, GvpD, appears to be involved
in the repression of gas vesicle formation, at least in the
case of Haloferax mediterranei (Englert et al., 1992b; Pfeifer
et al., 1994, 2001). Studies on the mc-vac region involved in
the gas-vesicle formation of Hfx. mediterranei indicate an
overproduction of gas vesicles in DD transformants lacking
GvpD, which can be reduced to wild-type level in DD/Dex
transformants (Englert et al., 1992b; Pfeifer et al., 1994).
At the transcript level, the amount of mc-gvpA mRNA is
similar in ADDE (lacking GvpD) and ADE transformants,
but comparison of b-galactosidase activities found in the
respective mcA-bgaH-DDE and mcA-bgaH-DE transformants
shows a reduction of the mcA-promoter activity in the
presence of GvpD (Zimmermann & Pfeifer, 2003). It is
possible that the high stability of the mc-gvpA mRNA, with a
half-life of 160 min in Hfx. volcanii (Jäger et al., 2002), is
the reason for these differences. The amino acid sequence
of GvpD indicates a conserved p-loop motif near the
N-terminus typical of ATP/GTP binding proteins and
important for the repressor function of GvpD (Pfeifer
et al., 2001). The GvpD and GvpE proteins of Hfx.
mediterranei are able to interact in vitro, and it is likely
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
Microbiology 150
Transcription regulation in Halobacterium salinarum
that this also occurs in vivo (Zimmermann & Pfeifer,
2003). The GvpD protein encoded by the p-vac region
might have a similar function in the repression of gasvesicle formation.
In this report, we investigated the regulation of the four
promoters of the p-vac region in Hfx. volcanii transformants. The basal promoter activities were determined
and compared to the promoter activites found in the
presence of GvpE and/or GvpD. The results indicated that
GvpE activated the pD promoter in addition to pA, and
that the pA-bgaH construct showed less activity when
GvpD was present in addition to GvpE. In contrast, neither
the pF nor the pO promoters were affected. We also analysed the pA promoter by a 4 nt scanning mutagenesis
within a 50 nt region to determine the sequences important
for basal and GvpE-induced transcription in vivo.
METHODS
Constructs used for the scanning mutagenesis. The mutant
Constructs used for transformation of Hfx. volcanii WFD11
and reporter-gene analysis. The Hfx. volcanii growth medium
and growth conditions (Pfeifer et al., 2001), the p-vac construct containing the entire p-vac region (Offner & Pfeifer, 1995), and the Eex
and pA-bgaH constructs (Gregor & Pfeifer, 2001) have been
described previously. The A construct contained a 500 bp XbaI–
BamHI p-gvpA fragment (position 21–520 in X64729, p-gvpACNO
sequence; primer pair used was pA-XbaI, 59-CTCCGTATCTAGAAGTACGAC-39 and 39-pgvpA-BamHI, 59-CGTCAGCGTAGGATCCGAACTCCTGCTG-39; restriction sites are shown in italics). The
O construct contained a 483 bp XbaI–BamHI p-gvpO fragment
(position 2592–3074 in X64729; primer pair used was pO-XbaI,
59-GCGCGAAGATCTAGAATCCGCGATCG-39 and 39-pgvpOBamHI, 59-CGCCTTTCTGGATCCCTACGGTCAGTC-39), and the
D construct the 1778 bp XbaI–Acc65I fragment encompassing
p-gvpD (positions 7–67 of X64729 and 1–1717 of X55648, pgvpDEFGHIJKLM sequence; the primer pair used was p-59D-XbaI,
59-GGATGTGTCTAGATTCACCAGTCG-39 and 39pD-Pst/Kpn, 59CATCGATGTCTGCTGCAGGTACCTCCAGCAAGTCG-39). Each of
these fragments was inserted in pWL102 (Lam & Doolittle, 1989).
The F construct contained a 1007 bp BamHI–EcoRV fragment
encompassing p-gvpF (position 1953–2959 in X55648) originally
derived from an amplification of a p-gvpFGH fragment using the
primer pair pE-BamHI (59-CATATCGACGGGATCCTCCTTCTTCTG-39) and pH-EcoRI (59-CGTGAATTCTGCTTGTGTTTTTGC-39).
The 1007 bp BamHI–EcoRV subfragment was inserted in pBSIISK+,
excised as a BamHI–KpnI fragment, and inserted in pWL102.
Fragment DE was amplified as a 2354 bp XbaI–Acc65I fragment
[positions 7–67 of X64729 and 1–2293 of X55648; primer pair
p-59D-XbaI and pE2-Acc65I (59-GATCTTCCTGTCTGCAGGTACCGTATGCCATGGGG-39)]. 59D is a 503 bp XbaI–BamHI subfragment
of D (positions 7–67 of X64729 and 1–442 of X55648), and leadD
was amplified as a 190 bp XbaI–BamHI fragment [positions 7–67 of
X64729 plus 1–130 of X55648; primer pair p-59D-XbaI and leaderp-D-Bam (59-GGGAATAACAGGATCCCGGTGTAGTCTG-39)]. All
these fragments were inserted in pWL102. The fragments Dex and
DEex were amplified as a 1635 bp NcoI–Acc65I Dex fragment [position 82–1717 in X55648; primer pair 59-pD-NcoI (59-CTGGAGAGAAGCCATGGGTTCACCCAATC-39) and 39pD-Pst/Kpn] and a
2210 bp NcoI–Acc65I DEex fragment (position 82–2293 in X55648;
primer pair 59-pD-NcoI and pE2-Acc65I) and inserted in the expression vector pJAS35 (Pfeifer et al., 1994).
The construction of pD-bgaH, pF-bgaH and pO-bgaH involved the
http://mic.sgmjournals.org
amplification of the respective promoter fragment [pD: 161 bp
XbaI–NcoI fragment, positions 7–67 of X64729 plus 1–100 of
X55648, primer pair p-59D-XbaI and leader–p-D-NcoI (59-GGTGAGCCATGGTGGGTGAACTCAT-39); pF: 275 bp XbaI–NcoI fragment,
position 2007–2281 of X55648, primer pair pF-XbaI (59-AGAACTGCTCTAGAATCTCCGGCGGCTG-39) and leader-p-F-NcoI (59GATACCGTATGCCATGGGGTTCTCAGTCATTGG-39); pO: 84 bp
XbaI–NcoI fragment, position 2591–2674 of X64729, primer pair
pO-XbaI (59-GCGCGAAGATCTAGAATCCGCGATCG-39) and
leader-p-O-NcoI (59-CAGATCGATCCATGGCTGGATCTGCCATG39)]. These promoter fragments were fused with the 2203 bp NcoI–
BamHI fragment, encompassing the bgaH reading frame [position
2362–4564 of U70664; primers bgaH-NcoI (59-CATTGTCCATGGCAGTTGGTGTCTG-39) and bgaH-BamHI (59-GTGACGCGGATCCGCGTGTGTAC-39)] and inserted in pBSIISK+. After DNA sequence
determination of the promoter–bgaH fusion region, the respective
fragments encompasssing pX-bgaH were transferred as XbaI–BamHI
fragments to pWL102. Both vectors used in this study (pWL102 and
pJAS35) are low-copy-number plasmids with <10 copies per cell.
The Genbank accession numbers of the p-vac subfragments are given
in the footnote.
pA promoters were constructed by recombinant PCR, fused to the
bgaH reading frame and inserted into pWL102. The desired 4 nt
mutations were introduced using pA-bgaH in pBSIISK+ as template. The oligonucleotides used for this procedure are summarized
in Table 1. Two PCR reactions were performed to amplify overlapping subfragments harbouring the mutations in the overlap. The
first PCR was carried out with the primers 01b through 09b, in combination with pA-XbaI. In the case of primers N1b through N4b, the
primer M13 reverse (complementary to a pBSK sequence) was used
in order to obtain large enough fragment sizes for the gel extraction.
The second series of PCR was performed with oligonucleotides 01a
through 09a, and N1a through N4a, together with primer bgaHextra (59-TATCGGTCGGTCAGCACG-39). Each of the amplified
fragments was purified by gel electrophoresis and eluted using the
Ultrafree-DA system (Millipore). The two overlapping subfragments
were used as templates together with the primers pA-XbaI and
bgaH-extra for the third PCR amplification. In each case, a 512 bp
fusion fragment containing the mutated pA promoter was obtained
and subsequently fused to the 59-terminal part of bgaH. The fragments were purified by gel electrophoresis and eluted using the
QIAquick gel extraction kit (Qiagen). The various 120 bp pA
mutant promoter fragments were excised from these constructs as
XbaI–NcoI fragments and were used to substitute the 120 bp wildtype pA promoter in pA-bgaH in vector pBSIISK+. The correct
mutation and the fusion of the pA promoter to bgaH were determined by DNA-sequence analysis in each case. The various 2?3 kb
pA-bgaH fragments were isolated as XbaI–BamHI fragments and
inserted in pWL102.
Selection of transformants and b-galactosidase assay. Prior
to the transformation of Hfx. volcanii, each construct was passaged
through the Escherichia coli dam2 strain GM 1674 to avoid a halobacterial restriction barrier. Transformation was done as described
by Pfeifer & Ghahraman (1993), and transformants were selected
on agar plates containing 6 mg mevnolin ml21 (for the selection
of pWL102) and 0?2 mg novobiocin ml21 (for the selection of
pJAS35). Mevinolin is a derivative of lovastatin, and was obtained as
a generous gift of MSD Sharp & Dohme GmbH (Haar, Germany).
The amount and presence of the desired constructs in each transformant were controlled by analysis of the isolated plasmids. The
b-galactosidase activity in cell lysates of Hfx. volcanii pA-bgaH
transformants was measured by ONPG assay, as described by
Holmes et al. (1997). The protein concentration was determined by
the Bradford assay (Ausubel et al., 1988), using BSA as standard.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
1831
A. Hofacker and others
Table 1. Oligonucleotides used for scanning mutagenesis
of the Hbt. salinarum pA promoter
Underlined nucleotides indicate mutations compared to the
respective p-vac sequence.
Primer
Sequence (5§–3§)
A-N01a
A-N01b
B-N02a
B-N02b
C-N03a
C-N03b
D-01a
D-01b
E-02a
E-02b
F-N04a
F-N04b
G-03a
G-03b
H-04a
H-04b
I-05a
I-05b
J-06a
J-06b
K-07a
K-07b
L-08a
L-08b
M-09a
M-09b
GACATAACGAACTATGAAACCATAC
GTATGGTTTCATAGTTCGTTATGTC
CATAACGACTGACTGAACCATACAC
GTGTATGGTTCAGTCAGTCGTTATG
CGACTGGTGGTTGCATACACATC
GATGTGTATGCAACCACCAGTCGT
GTGAAACCATCGGTATCCTTATGT
ACATAAGGATACCGATGGTTTCAC
ACTGGTGAAAGTCGACACATCCTT
AAGGATGTGTCGACTTTCACCAGT
GAAACCATACATCGACTTATGTGATGC
GCATCACATAAGTCGATGTATGGTTTC
CATCCTTATGACTGGCCCGAGTAT
ATACTCGGGCCAGTCATAAGGATG
CCTTATGTGAGATACGAGTATAGT
ACTATACTCGTATCTCACATAAGG
TATGTGATGCAGAGGTATAGTTAG
CTAACTATACCTCTGCATCACATAAGG
GTGATGCCCGGTGCTAGTTAGAGA
TCTCTAACTAGCACCGGGCATCAC
ATGCCCGAGTCGCCTTAGAGATGG
CCATCTCTAAGGCGACTCGGGCAT
CCCGAGTATACGACGAGATGGGTTAATC
AACCCATCTCGTCGTATACTCGGG
CCGAGTATAGTTCACTATGGGTTAATCC
GGATTAACCCATAGTGAACTATACTCGG
Isolation of RNA and transcript analysis. RNA was isolated
from Hfx. volcanii transformants according to the method of
Chomczynski & Sacchi (1987). RNA produced during the exponential
growth phase was isolated from cultures at OD600 0?2–0?4, whereas
RNA from stationary-phase cells was isolated at OD600¢2. Northern
analyses involved electrophoresis of 5 or 10 mg RNA on denaturing
formaldehyde-containing 1?2 % (w/v) agarose gels, followed by
transfer to nylon membranes (Ausubel et al., 1988). A strand-specific
RNA probe was synthesized, using the respective p-gvp gene (A, D,
F or O) cloned in pBluescript, and used as template for the T3/T7
polymerase. The RNA was labelled using the DIG RNA labelling kit
(Roche). Northern hybridization was carried out as described by
Ausubel et al. (1988), but the hybridization solution contained 10 %
(w/v) dextran sulfate (Sigma), 1 % (w/v) SDS, and 0?5 % (w/v)
skimmed milk powder.
RESULTS
Northern analysis to determine the p-vac
promoter activities
To determine the basal activities of the four p-vac promoters, we used the constructs A, D, F and O containing
the respective p-gvp genes, including their native promoters, inserted in pWL102 (Fig. 1). In the case of the
1832
pD promoter, we also used the DE construct (containing
p-gvpDE), as well as the subfragments 59D (503 nt of
p-gvpD, including the pD promoter) and leadD (pD
promoter plus the sequence encoding the 71 nt p-gvpD
mRNA leader), to prevent the endogenous production of
this regulatory protein (Fig. 1). The p-gvpD and p-gvpE
genes, encoding the regulatory proteins GvpD and GvpE,
were expressed under fdx promoter control in the halobacterial expression vector pJAS35 (Dex, DEex and Eex
constructs, see Fig. 1). The fdx promoter is predominantly
active during the exponential growth phase, leading to the
production of a large amount of the respective regulatory
proteins (Offner et al., 2000; Gregor & Pfeifer, 2001). Hfx.
volcanii was transformed with these pWL102 constructs
or together with the pJAS35 constructs and investigated for
the presence of the respective gvp mRNAs in the presence
or absence of the regulatory proteins.
Northern analyses were done with RNA samples derived
from the exponential and stationary growth phases of these
transformants, and blots were hybridized with the respective gvp gene probe (Fig. 2). An example of a methyleneblue stained agarose gel with separated total RNA is shown
in Fig. 2(a), which demonstrates the quality and relative
amounts of 23S and 16S rRNA in these experiments. This
particular blot was used for hybridization with the p-gvpA
probe shown in Fig. 2(b). Relatively minor amounts of
the 0?27 kb p-gvpA mRNA were observed with the p-gvpA
transformant (Fig. 2b). Minor amounts of p-gvpA mRNA
were also seen in the A/Dex transformant, implying that
GvpD was not repressing the pA promoter. In both transformants, slightly larger amounts of gvpA mRNA were
observed in the samples derived from exponential growth.
The A/DEex and A/Eex transformants contained significantly
larger amounts of the p-gvpA mRNA in the exponential
growth phase, demonstrating that GvpE activated the pA
promoter (Fig. 2b). The large amounts of transcripts in
these samples were due to the early and high expression
of GvpE under fdx-promoter control in pJAS35. Similar
amounts of p-gvpA mRNA were observed in the A/DEex and
A/Eex transformants, suggesting that GvpD did not reduce
the GvpE-mediated stimulation of the pA promoter. The
O transformant produced the 0?4 kb p-gvpO mRNA
predominantly in the stationary growth phase, and no
significant alterations were seen in the O/Dex and O/Eex
transformants, suggesting that the pO promoter was
influenced neither by GvpD nor by GvpE (Fig. 2c).
The initial analyses of the pD promoter were performed
with the 59D construct (containing a 503 bp fragment
derived from the 59 region of p-gvpD) and the D construct
(Fig. 2d). The p-gvpD mRNA appears as a smear in
Northern analysis, due to rapid degradation; we used a
0?64 kb transcript derived from the 59 end of p-gvpD to
investigate the pD promoter activity (Offner & Pfeifer,
1995). Using the 59D probe, minor amounts of this
transcript were detected in the 59D and D transformants
(Fig. 2d). The respective 59D/Eex and D/Eex transformants
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
Microbiology 150
Transcription regulation in Halobacterium salinarum
Fig. 2. Northern analyses of total RNA from various Hfx. volcanii transformants. Total RNA (5 mg, a, b; 10 mg, c, d, e, f) was
isolated from exponential and stationary growth phases and separated on denaturing 1?2 % agarose gels. The leadDex, Dex,
DEex and Eex constructs harbour the respective fragments cloned in the expression vector pJAS35, and were used to
transform Hfx. volcanii containing the target genes p-gvpA, p-gvpD (or subfragments), p-gvpF or p-gvpO. (a) Methylene-blue
stained nylon membrane to detect the 23S and 16S rRNA for the assessment of the quality and quantity of the total RNA. The
same membrane hybridized with the A probe is shown in (b). Numbers on the right indicate sizes in kb. e, Exponential growth
phase; s, stationary growth phase.
contained larger amounts of this transcript (especially the
59D/Eex transformant), demonstrating that the GvpE protein was able to activate the pD promoter (Fig. 2d). The
D/Eex transformant, containing the entire p-gvpD gene,
yielded this transcript in smaller amounts in both growth
phases (Fig. 2d), possibly due to the production of GvpD.
The DE transformant containing the p-gvpDE genes in
their native arrangement produced this transcript predominantly in the stationary growth phase (Fig. 2d), similar
to the expression of these genes in the p-vac region of Hbt.
salinarum (Offner & Pfeifer, 1995).
http://mic.sgmjournals.org
Further analyses were carried out with leadD transformants
harbouring a construct containing a 190 bp fragment
encompassing the pD promoter plus DNA encoding the
71 nt p-gvpD mRNA leader (see Fig. 1). The transcription
of this fragment resulted in a 0?24 kb mRNA (Fig. 2e).
Minor amounts of this transcript were seen in the leadD
transformant, indicating the low basal activity of the pD
promoter. The Dex transformant (containing the p-gvpD
reading frame expressed in pJAS35) lacked this 0?24 kb
transcript due to the absence of the sequence encoding the
mRNA leader in this construct. Similar amounts of the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
1833
A. Hofacker and others
0?24 kb RNA were seen in leadD and leadD/Dex transformants, implying that GvpD did not repress the pD
promoter. Large amounts of the 0?24 kb transcript were
seen in the leadD/DEex and leadD/Eex transformants, which
demonstrated that GvpE was able to activate the pD
promoter (Fig. 2e). Again, the transcription was high
during exponential growth, due to the early expression of
p-gvpE or p-gvpDE under fdx promoter control in pJAS35.
No significant reduction was seen in the leadD/DEex
compared to leadD/Eex transformant, suggesting that the
presence of GvpD did not reduce the GvpE-mediated
activation of the pD promoter.
In the case of the F transformants, Northern analysis
showed the presence of a 1?2 kb p-gvpF mRNA (including
one larger and several smaller transcripts), predominantly
in the exponential growth phase (Fig. 2f). This time point
of expression was in agreement with the appearance of
the gvpFGHIJKLM mRNA in Hbt. salinarum pHH1 (Offner
& Pfeifer, 1995). Since the amount of the gvpF-specific
mRNAs was not significantly altered in the F/leadDex (used
to determine a putative effect of the p-gvpD mRNA
leader), F/Dex and F/Eex transformants, and only slightly
enhanced in the F/DEex transformants, these results suggested that the pF promoter was neither affected by GvpD
nor by GvpE.
Determination of the p-vac promoter activities
using bgaH as reporter
The four promoters of the p-vac region were also fused
with the bgaH reading frame to determine the specific
b-galactosidase activities in the respective transformants.
Each promoter fragment used encompassed the TATA box
and upstream sequence, the transcription start site, and the
region encoding the respective mRNA leader (59-UTR) of
the respective gvp gene. The p-gvpA mRNA contains a 21 nt
59-UTR, the p-gvpD mRNA a 71 nt leader, and p-gvpF a
169 nt 59-UTR (DasSarma et al., 1987; Jones et al., 1989;
Offner & Pfeifer, 1995). In contrast, the p-gvpO mRNA
starts only 1 nt upstream of the AUG initiation codon, and
does not contain an mRNA leader (Offner et al., 1996). The
mRNA leader regions of p-gvpA, p-gvpD and p-gvpF were
included, since it was not known whether and where GvpE
(and GvpD) could possibly bind. However, these 59-UTRs
may also influence the stability of the transcript and its
translation.
The resulting pA-bgaH, pD-bgaH, pF-bgaH and pO-bgaH
constructs were used to transform Hfx. volcanii, and the
colonies formed were sprayed with X-Gal for an initial
inspection of b-galactosidase activity. Colonies of the pAbgaH and pF-bgaH transformants turned dark blue, and
colonies of the pD-bgaH transformants were light blue
(data not shown). In contrast, those of the pO-bgaH
transformants remained red. The ONPG assay was used
to determine the specific b-galactosidase activities of the
various transformants (Table 2). The pA-bgaH transformant yielded a mean specific b-galactosidase activity of
1834
21 mU mg21 in stationary growth, and slightly reduced
activities were seen in the pA-bgaH/Dex transformant
(Table 2). Much higher b-galactosidase activities (25-fold
enhanced) were observed with the pA-bgaH/Eex transformant, whereas the pA-bgaH/DEex transformant showed
lower amounts (9-fold enhanced), suggesting that the
presence of GvpD reduced the GvpE-mediated activation
(Table 2). Together, these results underlined the function
of GvpE as transcriptional activator at the pA promoter,
but also implied a repressing function of GvpD in the
presence of GvpE. The basal pD promoter activities determined for the pD-bgaH transformant were very low, but
the pD-bgaH/Eex transformant yielded an almost 20-fold
increased b-galactosidase activity, demonstrating the
activation of the pD promoter by GvpE (Table 2). The
basal promoter activity of pF-bgaH was higher than that of
pD-bgaH, and not significantly altered in the presence of
Dex, Eex or DEex. These findings emphasize the fact that
the pF promoter was not affected by these regulatory
proteins (Table 2). Very minor amounts of b-galactosidase
activity were determined for the various pO-bgaH transformants, despite the fact that significant amounts of bgaH
mRNA were produced in each pO-bgaH transformant
(data not shown). These results suggested that the pObgaH mRNA was not very well translated. In summary,
the data indicated that GvpE acts as transcriptional activator at the pA and pD promoters, but also suggested that
the GvpE-mediated activation of pA was reduced in the
presence of GvpD. In contrast, the pF promoter was affected
neither by GvpD nor by GvpE.
Scanning mutagenesis to determine the
sequences required for basal transcription
initiation and GvpE-mediated activation
To determine the effect of the mutations on the basal
promoter activity and also on GvpE-induced transcription,
a 4 nt scanning mutagenesis was carried out in a 50 nt
region located upstream of the transcriptional start site of
p-gvpA mRNA (Fig. 3). The alterations were introduced
upstream of the transcriptional start site in such a way that
Table 2. Specific b-galactosidase activities of Hbt. salinarum pA, pD and pF bgaH constructs in Hfx. volcanii
transformants
Values shown represent the mean of three different cultures,
determined in stationary growth. b-Galactosidase activity is given
in mU mg protein21.
Transformant
Basal
+Dex
+Eex
+DEex
Construct
pA-bgaH
pD-bgaH
pF-bgaH
21?1±7?4
15?1±7?9
541?3±77?1
190?1±77?2
1?0±0?0
7?0±0?3
9?6±0?9
12?4±2?0
8?5±1?3
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
19?4±3?2
Microbiology 150
Transcription regulation in Halobacterium salinarum
Fig. 3. Scanning mutagenesis of the 50 nt
Hbt. salinarum pA promoter region. The
BRE sequence element is underlined and
the TATA box shaded in grey. The sequence
affecting the GvpE-mediated activation is
marked in bold. The designation +1 indicates the transcription start site. The
archaeal consensus sequences of both
promoter elements are given on top
(Littlefield et al., 1999). The mutant promoter
sequences are presented underneath the pA
wild-type sequence; dots indicate the same
nucleotide as found in the pA sequence.
Numbers on the right refer to specific
b-galactosidase activities in mU mg protein”1; the basal and GvpE-induced activities
determined in the stationary phase are given.
”1
ND, Not detectable, i.e. <0?5 mU mg
bgalactosidase activity. Thicker lines at the
bottom indicate the extent of the sequences
protected by TFB and TBP, as determined
by footprint analysis with other archaeal promoters (Hausner et al., 1996; Qureshi &
Jackson, 1998). The TFB- and TBP-binding
sites are taken from the respective crystal
structures of the core transcription machinery of hyperthermophilic archaea (Kosa et al.,
1997; Littlefield et al., 1999).
the 4 nucleotides incorporated were different from those
already found at the same position in the cA promoter or
the related mcA promoter of Hfx. mediterranei (Englert et al.,
1992a). The various mutated pA promoters were fused with
the bgaH reading frame and analysed in Hfx. volcanii
transformants for b-galactosidase activity (Fig. 4).
Six mutants (D, F, G, I, K and L) gave almost undetectable
b-galactosidase activity (<0?5 mU mg21) in the respective
pA-bgaH transformants (Fig. 4a). The promoter regions
affected in these mutants were located upstream of the
putative BRE element at position 238 to 240 (mutant
D), upstream and downstream of the TATA box (F and G),
and around position 210 (mutants K and L) (Fig. 3). The
regions altered in mutants F and G are presumably covered
by the TBP–TFB complex during transcription initiation,
analogous to the results obtained with hyperthermophilic
archaea (Hausner et al., 1996; Qureshi & Jackson, 1998;
Littlefield et al., 1999; Bell et al., 1999b). Interestingly,
mutant E, harbouring an alteration in the 59 portion of
the putative BRE element (ACAC altered to CGGT), yielded
a more than 10-fold enhanced basal pA promoter activity
(Fig. 4a). Northern analysis supported the enhanced
production of pA-bgaH mRNA in mutant E (data not
shown). The BRE element sequence exhibits a higher degree
of conservation than the original DNA sequence (Fig. 3),
and these results suggested that this element contributed
significantly to the pA promoter strength.
With respect to the GvpE-mediated activation, minor
http://mic.sgmjournals.org
activations were observed with the pA-bgaH mutants C,
D and (to a lesser extent) K (Fig. 4b). The smallest bgalactosidase activities were observed with mutants C and
D, carrying alterations upstream of the BRE sequence
element. Mutant C (region 240 to 242 altered) was not
affected in basal pA promoter activity, whereas mutant
D yielded a dramatic reduction in both basal and GvpEinduced pA-promoter activity (Fig. 4). From these results
it appeared that the region upstream and adjacent to
BRE was most important for GvpE-mediated activation.
Mutants A and B (carrying mutations further upstream),
and mutants H, I, J, L and M (with mutations closer to the
transcription start site), exhibited b-galactosidase activities
similar to those observed for the GvpE-induced pA promoter of the wild-type (Fig. 4).
DISCUSSION
In this report we investigated a putative regulation of the
four promoters pA, pD, pF and pO of the p-vac region by
the two regulatory proteins GvpD and GvpE. Northern
analyses were performed to visualize gvp mRNAs, and for a
more quantitative analysis we used bgaH, which encodes
an enzyme with b-galactosidase activity, as reporter. Use
of the bgaH reading frame excludes differences in the
stability of the respective mRNAs which might result from
differences in gvp reading frame sequence. Northern analyses suggested that the pA and pD promoter activities were
induced in the presence of GvpE, whereas the pF and pO
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
1835
A. Hofacker and others
role for GvpD in the repression of the pA promoter, since
these transformants produced less b-galactosidase activity
than pA-bgaH/Eex transformants. Earlier results on the
mc-vac region of Hfx. mediterranei have shown that transformants harbouring the subfragments ADE and ADDE do
not show a reduction in the mc-gvpA mRNA (Zimmermann
& Pfeifer, 2003). However, the reducing effect of GvpD on
GvpE-mediated mcA promoter activation can be observed
in transformants harbouring the mcA-bgaH-DE (or mcAbgaH-DDE) constructs (Zimmermann & Pfeifer, 2003). It
is possible that the very stable gvpA mRNAs are less useful
for demonstrating the reduction of the GvpE-mediated
activation of the A promoters in the presence of GvpD. The
half-life of the mc-gvpA mRNA (as determined by Northern
analysis after addition of actinomycin D) is, at 160 min,
extremely long in Hfx. volcanii transformants (Jäger et al.,
2002). The half-life of the p-gvpA mRNA appears to be
similar (unpublished data).
Fig. 4. Mean specific b-galactosidase activities determined
from the Hbt. salinarum pA-bgaH wild-type (wt) and the various
pA-bgaH mutant constructs (A–M) in Hfx. volcanii transformants in the presence or absence of GvpE. The sequence
alterations in the respective pA promoters are shown in Fig. 3.
(a) b-Galactosidase activities determined for the basal transcription; (b) GvpE-mediated activation of transcription. bGalactosidase activities ( y axes) are given in mU mg protein”1.
Note the different scales of the graphs in (a) and (b). Error
bars, ±1SD.
promoters were not affected. These results were confirmed
by the reporter gene studies. The largest specific bgalactosidase activities were determined for the pA-bgaH
transformants, followed by the pF-bgaH and pD-bgaH
transformants. The strongest promoter of the p-vac region
is thus pA, driving the expression of the major and minor
gas vesicle structural proteins. The pO-bgaH transformants
yielded almost undetectable amounts of b-galactosidase
activity, despite the normal production of mRNA. It is
possible that the five additional amino acids derived from
GvpO (MADPA) that were fused to the N-terminus of
BgaH in this construct resulted in an inactive BgaH protein. Another explanation for the lack of b-galactosidase
activity in the pO-bgaH transformant could be that the
leaderless O-bgaH transcript was not translated. An MFOLD
test (http://helix.nih.gov/docs/online/mfold/) of the first
40 nt showed that the transcript could fold in such a way
that the start codon would be buried in a stem–loop
structure, which would block translation.
A reduction of the GvpE-induced pA promoter activity
by GvpD could not be observed at the level of the p-gvpA
transcript in p-gvpA/DEex transformants. However, the
respective pA-bgaH/DEex transformants demonstrated a
1836
The combined results on the activity and regulation of the
four p-vac promoters allowed the following explanation
of the expression of p-vac in Hbt. salinarum. The early
appearance of the p-gvpFGHIJKLM and p-gvpO mRNAs
was due to the basal activities of the pF and pO promoters;
GvpE did not induce an enhanced transcription. The reductions in the p-gvpFGHIJKLM and p-gvpO mRNAs in the
stationary growth phase were not caused by GvpD, since
this protein has no influence on the pF and pO promoter
activities. The reduced amounts of these mRNAs were
presumably due to an overall reduced transcription initiation in the stationary growth phase, combined with the
degradation of the transcripts. In contrast, the increased
amounts of the p-gvpDE transcript in the stationary growth
phase could be assigned to the autoregulation of the pD
promoter by GvpE. The activation of the pD promoter and
formation of the p-gvpDE mRNA led to a larger production of GvpE, but also to a higher amount of GvpD in the
growth phase. In the case of the mc-vac region, a small
amount of GvpE is already sufficient for maximal mcA
promoter activity (Zimmermann & Pfeifer, 2003), and this
could also be true for the p-vac region of Hbt. salinarum.
The pA promoter is active throughout growth and drives
the expression of the genes encoding the gas vesicle structural proteins GvpA and GvpC. During exponential growth,
the basal pA promoter activity results in the formation of
p-gvpA mRNA, and the appearance of GvpE in stationary
growth (due to the expression of the p-gvpDE transcript)
leads to a severalfold induction of pA in this growth
phase. The production of GvpD presumably reduces the
action of GvpE, since lower b-galactosidase activity was
observed in the pA-bgaH/DEex transformants compared to
pA-bgaH/Eex transformants. It should be stressed that,
although both regulatory proteins are encoded by consecutive genes and cotranscribed, the activation by GvpE
exceeds the repressing function of GvpD. Results obtained
with these Hfx. mediterranei regulatory proteins indicate
that small amounts of mcGvpE are sufficient for a high
activity of the mcA promoter (Zimmermann & Pfeifer,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
Microbiology 150
Transcription regulation in Halobacterium salinarum
2003). Thus, GvpE is either highly active and/or binds with
high affinity to the promoter region (or to subunits of the
basal transcription machinery).
Efforts to determine the promoter region
required for the GvpE-mediated activation
The DNA sequences involved in the GvpE-mediated
activation of the pA promoter have not yet been determined. In vitro analyses demonstrate that GvpE is able to
dimerize in solution (Plößer & Pfeifer, 2002). However, all
attempts to study the DNA-binding properties of GvpE
in vitro have so far failed, mainly due to the requirement
of this halophilic protein for 2 M salt. In this report, we
tried to identify the region most important in vivo for
GvpE-mediated activation in the pA promoter. Scanning
mutagenesis was carried out with a 50 nt region located
upstream of the transcription start site of the p-gvpA gene.
Alteration of sequences found upstream or within the
BRE sequence element (mutants D, F), overlapping the
TATA box (mutant G), and around position 210 (mutants
K, L), reduced the basal transcription to almost zero
(<0?5 mU mg21 b-galactosidase activity), and also influenced the GvpE-induced activity of this promoter. Except
for the region around position 210, all of these DNA
sequences are involved in the recruitment and binding of
TBP and TFB in hyperthermophilic archaea, as demonstrated by footprint analyses (see Fig. 3) (Qureshi &
Jackson, 1998; Littlefield et al., 1999). Thus, the in vivo
analyses presented here confirmed that these promoter
sequences are also important in halophilic archaea, since
mutations strongly influence basal transcription. Some of
the mutations between the TATA box and the transcription
start site led to an increase of the GC content of this
sequence. Most likely, these additional GC base pairings
raised some conflicts with the open complex formation,
resulting in the reduced b-galactosidase activity observed in
these mutants. An almost 40-fold increase of transcription
was seen with mutant E, which contains the sequence
CGGTATC instead of ACACATC as putative BRE element
sequence in the pA promoter. This sequence exhibits a
higher degree of conservation with respect to the consensus
BRE element sequence cRnaAnt (with R=A/G, and n=any
nucleotide) determined for hyperthermophilic archaea
(Qureshi & Jackson, 1998; Littlefield et al., 1999). The
strong increase in b-galactosidase activity in this mutant
suggests that the BRE element sequence makes a major
contribution to (or even determines) the strength of the
pA promoter. Hbt. salinarum and Hfx. volcanii contain
multiple TFB proteins that might be involved in gene
regulation (Baliga et al., 2000). Since the basal promoter
activity of mutant E was already high during exponential
growth it is also possible that a different TFB protein
recognized this novel BRE element, resulting in the
enhanced transcription observed.
With respect to the GvpE-mediated activation, some of
the mutants with almost undetectable basal transcription
(mutants G, H, I and L) were induced by GvpE to a normal
http://mic.sgmjournals.org
extent, whereas others exhibited reduced activation (mutants
F, J and K). Mutant D lacked GvpE-mediated activation
entirely. It is difficult to decide whether a reduced binding
of the basal transcription machinery was responsible for
these effects, or whether the sequences altered were also
involved in the GvpE-interaction. However, mutant C,
which harbours a DNA sequence alteration upstream of
the BRE element, showed a normal amount of basal
transcription, yet the GvpE-mediated activity was strongly
reduced (<20 % of wild-type). Mutations further upstream
had no effect on basal or GvpE-induced promoter activation. The sequence AACCA, altered in mutant C, could be
the GvpE binding site. However, this sequence is not
conserved in the promoters mcA, cA and mcD that are
also stimulated by GvpE. Further analyses are required to
determine the GvpE-binding site unambiguously. Overall,
the results obtained here imply a close contact of GvpE
with the core transcription machinery. GvpE can promote
or stabilize the binding of TBP or TFB, in a similar way to
the transcriptional activator protein Ptr2 of Methanococcus
jannaschii (Ouhammouch et al., 2003).
ACKNOWLEDGEMENTS
This work received financial support from the Deutsche Forschungsgemeinschaft (PF 165/8-1 and 8-2). We thank Dagmar Gregor and
Peter Zimmermann for discussions, Bettina Basso for excellent
technical assistance, and Kathryn Nixdorff for critical reading of the
manuscript. Lovastatin was a generous gift of MSD Sharp & Dohme
GmbH (Haar, Germany).
REFERENCES
Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J.
& Struhl, K. (1988). Current Protocols in Molecular Biology, vol. 1.
New York: Greene Publishing Associates and Wiley-Interscience.
Baliga, N., Goo, Y. A., Ng, W. V., Hood, L., Daniels, C. & DaSarma, S.
(2000). Is gene expression in Halobacterium NRC-1 regulated by
multiple TBP and TFB transcription factors? Mol Microbiol 36,
1184–1185.
Bell, S. D. & Jackson, S. (1998). Transcription and translation in
archaea: a mosaic of eukaryal and bacterial features. Trends Microbiol
6, 222–228.
Bell, S. D., Cairns, S., Robson, R. & Jackson, S. (1999a). Trans-
criptional regulation of an archaeal operon in vivo and in vitro. Mol
Cell 4, 971–982.
Bell, S. D., Kosa, P., Sigler, P. & Jackson, S. (1999b). Orientation of
the transcription preinitiation complex in archaea. Proc Natl Acad
Sci U S A 96, 13662–13667.
Bell, S. D., Brinkman, A., van der Oost, J. & Jackson, S. (2001). The
archaeal TFEIIa homologue facilitates transcription initiation by
enhancing TATA-box recognition. EMBO Rep 2, 133–138.
Brinkman, A., Dahlke, I., Tuininga, J. & 7 other authors (2000). An
Lrp-like transcriptional regulator from the archaeon Pyrococcus
furiosus is negatively autoregulated. J Biol Chem 272, 38160–38169.
Chomczynski, P. & Sacchi, N. (1987). Single step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162, 156–159.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
1837
A. Hofacker and others
DasSarma, S., Damerval, T., Jones, J. & Tandeau de Marsac, N.
(1987). A plasmid-encoded gas vesicle protein gene in a halophilic
TATA-box-binding protein/transcription factor (II)B core/TATAbox. Proc Natl Acad Sci U S A 94, 6042–6047.
archaebacterium. Mol Microbiol 1, 365–370.
Krüger, K., Hermann, T., Armbruster, V. & Pfeifer, F. (1998). The
Englert, C., Krüger, K., Offner, S. & Pfeifer, F. (1992a). Three
different but related gene clusters encoding gas vesicles in halophilic
archaea. J Mol Biol 227, 586–592.
transcriptional activator GvpE for the halobacterial gas vesicle genes
resembles a basic region leucine-zipper regulatory protein. J Mol Biol
279, 761–771.
Englert, C., Wanner, G. & Pfeifer, F. (1992b). Functional analysis of
Lam, W. L. & Doolittle, W. F. (1989). Shuttle vectors for the
the gas vesicle gene cluster of the halophilic archaeon Haloferax
mediterranei defines the vac-region boundary and suggests a
regulatory role for the gvpD gene or its product. Mol Microbiol 6,
3543–3550.
archaebacterium Halobacterium volcanii. Proc Natl Acad Sci U S A
86, 5478–5482.
Leonard, P. M., Smiths, S. H., Sedelnikova, S. E., Brinkman, A. B.,
de Vos, W. M., van der Oost, J., Rice, D. W. & Rafferty, J. B. (2001).
Enoru-Eta, J., Gigot, D., Thia-Toong, T., Glansdorf, N. & Charlier, D.
(2000). Purification and characterization of Sa-Lrp, a DNA-binding
Crystal structure of the Lrp-like transcriptional regulator from the
archaeon Pyrococcus furiosus. EMBO J 20, 990–997.
protein from the extreme thermoacidophilic archaeon Sulfolobus
acidocaldarius homologous to the bacterial global transcription
regulator Lrp. J Bacteriol 182, 3661–3672.
Gregor, D. & Pfeifer, F. (2001). The use of a halobacterial bgaH
reporter gene to analyse the regulation of gene expression in
halophilic archaea. Microbiology 147, 1745–1754.
Hanzelka, B., Darcy, T. & Reeve, J. (2001). TFE, an archaeal
transcription factor in Methanobacterium thermoautotrophicum
related to eucaryal transcription factor TFEIIa. J Bacteriol 183,
1813–1818.
Hausner, W., Wettach, J., Hethke, C. & Thomm, M. (1996). Two
transcription factors related with the eucaryal transcription factors
TATA-binding protein and transcription factor IIB direct promoter
recognition by an archaeal RNA polymerase. J Biol Chem 271,
30144–30148.
Hausner, W., Lange, U. & Musfeldt, M. (2000). Transcription factor
S, a cleavage induction factor of the archaeal RNA polymerase. J Biol
Chem 275, 12393–12399.
Hochheimer, A., Hedderich, R. & Thauer, R. (1999). The DNA
binding protein Tfx from Methanobacterium thermoautotrophicum:
structure, DNA binding properties and transcriptional regulation.
Mol Microbiol 31, 641–650.
Holmes, M. & Dyall-Smith, M. (2000). Sequence and expression of a
halobacterial b-galactosidase gene. Mol Microbiol 36, 114–122.
Littlefield, O., Korkhin, Y. & Sigler, P. (1999). The structural basis for
the oriented assembly of a TBP/TFB/promoter complex. Proc Natl
Acad Sci U S A 96, 13668–13673.
Ng, W. V., Kennedy, S. P., Mahairas, G. G. & 40 other authors
(2000). Genome sequence of Halobacterium species NRC-1. Proc
Natl Acad Sci U S A 97, 12176–12181.
Offner, S. & Pfeifer, F. (1995). Complementation studies with the
gas vesicle-encoding p-vac region of Halobacterium salinarium
PHH1 reveal a regulatory role for the p-gvpDE genes. Mol
Microbiol 16, 9–19.
Offner, S., Wanner, G. & Pfeifer, F. (1996). Functional studies of the
gvpACNO operon of Halobacterium salinarium reveal that the GvpC
protein shapes gas vesicles. J Bacteriol 178, 2071–2078.
Offner, S., Hofacker, A., Wanner, G. & Pfeifer, F. (2000). Eight of
fourteen gvp genes are sufficient for the formation of gas vesicles in
halophilic archaea. J Bacteriol 182, 4328–4336.
Ouhammouch, M., Dewhurst, R., Hausner, W., Thomm, M. &
Geiduschek, E. P. (2003). Activation of archaeal transcription by
recruitment of the TATA-binding protein. Proc Natl Acad Sci U S A
100, 5097–5102.
Pfeifer, F. & Ghahraman, P. (1993). Plasmid pHH1 of Halobacterium
salinarium: characterization of the replicon region, the gas vesicle
gene cluster and insertion elements. Mol Gen Genet 238, 193–200.
Holmes, M., Scopes, R., Moritz, R., Simpson, R., Englert, C.,
Pfeifer, F. & Dyall-Smith, M. (1997). Purification and analysis of
an extremely halophilic b-galactosidase from Haloferax alicantei.
Pfeifer, F., Offner, S., Krüger, K., Ghahraman, P. & Englert, C.
(1994). Transformation of halophilic archaea and investigation of gas
Biochim Biophys Acta 1337, 276–286.
Pfeifer, F., Zotzel, J., Kurenbach, B., Röder, R. & Zimmermann, P.
(2001). A p-loop motif and two basic regions in the regulatory
Horne, M., Englert, C., Wimmer, C. & Pfeifer, F. (1991). A DNA
region of 9 kbp contains all genes necessary for gas vesicle synthesis
in halophilic archaebacteria. Mol Microbiol 5, 1159–1174.
Jäger, A., Samorsky, R., Pfeifer, F. & Klug, G. (2002). Individual gvp
vesicle synthesis. Syst Appl Microbiol 16, 569–577.
protein GvpD are important for the repression of gas vesicle
formation in the archaeon Haloferax mediterranei. Microbiology 147,
63–73.
mRNA segments in Haloferax mediterranei exhibit varying half-lives
which are differentially affected by salt concentration and growth
phase. Nucleic Acids Res 30, 5436–5443.
Plößer, P. & Pfeifer, F. (2002). A bZIP protein from halophilic
Jones, J., Hackett, N., Halladay, J., Scothorn, D., Yang, C., Ng, W. &
DasSarma, S. (1989). Analysis of insertion mutants reveals two new
Qureshi, S. & Jackson, S. (1998). Sequence-specific DNA binding by
genes in the pNRC100 gas vesicle gene cluster of Halobacterium
halobium. Nucleic Acids Res 17, 7785–7793.
Kosa, P., Ghosh, G., DeDecker, B. & Sigler, P. (1997). The
2?1-Å crystal structure of an archaeal preinitiation complex:
1838
archaea: structural features and dimer formation of cGvpE from
Halobacterium salinarum. Mol Microbiol 45, 511–520.
the S. shibatae TFIIB homolog, TFB, and its effect on promoter
strength. Mol Cell 1, 389–400.
Zimmermann, P. & Pfeifer, F. (2003). Regulation of gas vesicle
formation in Haloferax mediterranei: the two regulatory proteins
GvpD and GvpE interact. Mol Microbiol 49, 783–794.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 19:53:11
Microbiology 150