* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download RC 2 Student Notes
Human genome wikipedia , lookup
Expanded genetic code wikipedia , lookup
DNA profiling wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genomic library wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
SNP genotyping wikipedia , lookup
Designer baby wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Frameshift mutation wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenomics wikipedia , lookup
Genetic code wikipedia , lookup
Molecular cloning wikipedia , lookup
Microsatellite wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Primary transcript wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Microevolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Biology Reporting Category 2: Mechanisms of Genetics Name:______________________________ DNA “Facts” Composed of a nucleotide. A nucleotide has 3 1 parts: sugar, phosphate group, and nitrogen base 2 The sugar is deoxyribose 7 Found in all living organisms 8 3 Structure/shape is two strands twisted into a double helix coil with ladder-like hydrogen bonds connecting the complementary nitrogen bases 9 Undergoes replication in the cell cycle (S phase) The sequence of DNA bases determines the amino acid sequence in proteins because of transcription and translation with RNA; the sequence of the DNA bases is often called the “genetic code” 4 Determines which proteins a cell makes (protein synthesis); these proteins determine the cell’s activities and the organisms’ genetic traits 10 5 Carries genetic information from the parent cell (because of mitosis) to the new daughter cells 11 6 Called the “blueprint of life” 12 11 Every DNA molecule in every organism has the same components in common: a sugar- phosphate backbone and 4 nitrogen bases (A,T,C,G) The sequence of nitrogen bases in the DNA molecule of each organism makes the organism unique Is found in the nucleus of eukaryotic cells and in the cytoplasm of prokaryotic cells DNA Structure 12 11 Phosphate 12 Deoxyribose sugar 13 Nitrogenous Bases 14 Weak hydrogen bond between bases 15 Sugar-phosphate backbone 13 DNA Nitrogenous Bases Purines 14 Pyrimidines Adenine Thymine Guanine Cytosine DNA Base Pairing A pairs with T 15 C pairs with G Chargaff’s Rules DNA has a 1:1 ratio of pyrimidine and purine bases; the amount of -Guanine = Cytosine, Adenine = Thymine Create a complementary strand from the following template strands of DNA: TTTAAACCCGGGATACGGGTATG DNA and Heredity The structure of DNA makes it possible for traits to be passed on from one generation to another because even though DNA is extremely long, it can easily be uncoiled and separated into two strands for DNA replication (coping process by which a cell duplicates its DNA). DNA Replication Model of Protein Synthesis Cell replication transcription DNA translation RNA In Cytoplasm at Ribosomes Protein Synthesis Nucleus RNA “Facts” Nucleic acid that uses genetic information from DNA to produce proteins Structure is single stranded Sugar is ribose Proteins Proteins are chains of amino acids Amino acids are determined by codons A codon is a sequence of 3 nucleotides (like AAA or CGG) from the mRNA (which was set from the DNA) Leaves nucleus to make proteins by attaching to ribosomes in cytoplasm No thymine nitrogen base in RNA; Uracil instead Complementary bases: C pairs with G A pairs with U Use mRNA on the codon chart to determine amino acid sequence of protein chain Changes in DNA (Mutations) A mutation is the insertion, deletion, or substitution of a nitrogen base(s) in a sequence of DNA. Mutations can result in a harmful, beneficial, or neutral change in DNA sequence, depending on the amino acid produced from the mutation. A mutation is passed to the offspring only if the mutation occurs in a gamete (sex cell = sperm or egg cell). Mutation Type None (Normal) Substitution Analogy THE FAT CAT ATE THE RAT THE BAT CAT ATE THE RAT Mutation Type (Frameshift) Deletion Insertion Analogy THE ATC ATA TE THER AT THE ZFA TCA TAT ETH ERA T Genetics & Meiosis A gene is a segment of DNA; carries instructions for expression of traits (eye color, hair color, etc.) A pair of inherited genes controls a trait One member of the inherited pair of genes comes from each parent, often called alleles. Alleles are represented as letters: B b T t The alleles are the result of sexual reproduction in parents’ gametes (sex cells) through meiosis. The outcome of meiosis is greater genetic variation due to crossing over of chromosomes. Main Ideas Dominant Alleles (capital letters)-controlling allele: B T Homozygous Alleles-two alleles of the pair (one from each parent) are identical. Both may be dominant (BB) or recessive (bb) Genotype-genetic makeup of an organism; represented by the allele letters (B b T t) Punnett Square Recessive Alleles (lower case letters)-hidden allele: b t Heterozygous Alleles-two alleles of the pair (one from each parent) are NOT identical. One is dominant and other is recessive (Bb or bB) Phenotype-physical appearance of organism; description of the letter (brown hair, tall) Monohybrid Cross-cross involving one trait from each parent (4 squares in the Punnett Square) Dihybrid Cross-cross involving two traits from each parents (16 squares in the Punnett Square) Pedigree Graphic organizer to map genetic traits between generations Mother: BBTt Punnett Square-graphic organizer used to show the probable results of a genetic cross between the parents BT Bt BT Bt Father: BbTt BT Bt BT BT Bt BT BT Bt Bt Bt BT BT Bt BT BT Bt Bt Bt bT bT BT bT Bt bT BT bT Bt bt bt BT bt Bt bt BT bt Bt Karyotype Chart of metaphase chromosome pairs to study chromosome number/disease relationships Mendelian Genetics-laws about the inheritance of genetic traits (dominate, recessive, one allele from each parent, alleles for one trait combine independent of the alleles for another trait DNA-Protein Synthesis Top 10 1. Nucleotides build nucleic acids 2. DNA is a double helix 3. The backbone of DNA is sugar & phosphate 4. DNA does not leave the nucleus 5. Only DNA contains Thymine 6. Only RNA contains Uracil 7. Transcription is in the nucleus 8. Translation is at the ribosomes 9. Use mRNA for the Genetic Code chart 10. DNA -> RNA -> Protein