* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA
Biochemistry wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Genomic library wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Gene regulatory network wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA supercoil wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Genetic engineering wikipedia , lookup
Epitranscriptome wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Biosynthesis wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Point mutation wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Gene expression wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Chapter 8 Microbial Genetics part A Life in term of Biology – Growth of organisms • Metabolism is the sum of all chemical reactions that occur in living organisms to maintain life. – determined by the enzymes present in the cells – DNA carry the information for enzymes synthesis – Multiplication of organisms -increase number of the population • Heredity – save the characteristics of the species • DNA hold the information to build and maintain the cells and pass genetic traits to offspring How DNA carry information? • DNA molecules in the cells exist as a double-stranded helix; – Two molecules form the double helix • A hydrogen bonds with T (2 hydrogen bonds) • C hydrogen bonds with G (3 hydrogen bonds) • Four bases A,T,C, and G – the four letters of genetic language • The linear sequence of bases provides the actual information DNA - double helix structure - Chromosome • A chromosome is an organized structure of DNA and protein that is found in cells. – It is a single piece of coiled DNA – Contain DNA-bound proteins, which serve to package the DNA and control its functions. • In eukaryotic - linear molecules associated with histones and various proteins that regulate genetic activity – Different organisms have different number of chromosomes (2n) • Human – 46, Yeast - 32, Dog – 78 • In bacteria - one chromosome which is circular structure, associated with different proteins (no histones) • The chromosome of E. coli, for example, contains about 4 million base pairs and is approximately 1000 times longer than the cell. What genes are ? • A gene is the basic unit of heredity in a living organism. • A gene specifies a trait of the organism - thousands of basic biochemical processes that comprise life • Gene - Segment of DNA (sequence of bases) that encodes a functional product - A protein - Functional RNA – an RNA molecule that is not translated into a protein - Transfer RNA (tRNA) - Ribosomal RNA (rRNA), - Smal RNAs (siRNA) Gene Structure • Gene - contains both: – "coding" sequences that determine what the gene does (sequences that are transcribed into mRNA molecule) – "non-coding" sequences that determine when the gene is active (expressed) Gene DNA Promoter Regulatory region Non–coding sequences • Not all of the DNA encode genes Coding sequence Terminology • Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated. • Chromosome: Structure containing DNA that physically carries hereditary information; the chromosomes contain the genes • Gene: A segment of DNA that encodes a functional product, usually a protein • Genome: All the genetic information in a cell (entire DNA) • Genotype: All genes of an organism. The genetic composition of an organism. • Phenotype: The expression of the genes, the proteins of the cell and the properties they confer on the organism The Flow of Genetic Information Parent cell DNA expression recombination Genetic information is used within a cell to produce the proteins needed for the cell to function. Transcription Genetic information can be Insert Fig 8.2 transferred between cells of the same generation. replication Genetic information can be transferred between generations of cells. New combinations of genes Translation Cell metabolizes and grows Recombinant cell Daughter cells The Flow of Genetic Information Parent cell DNA expression recombination Vertical flow of genetic information Genetic information is used within a cell to produce the proteins needed for the cell to function. Genetic information can be Insert Fig 8.2 transferred between cells • Replication - The DNA in a cell isof the duplicated same generation. before the cell divides, so each daughter cell receives the same genetic information New combinations replication Genetic information can be transferred between generations of cells. of genes Transcription Replication Translation DNA Cell metabolizes and grows DNA Recombinant cell Daughter cells Vertical flow of genetic information (Replication) is the basis for biological inheritance • The process starts with one double-stranded DNA molecule and produces two identical copies of the molecule. Replication 1 DNA molecule DNA polymerase 2 identical DNA molecules • Each strand of the original double-stranded DNA molecule serves as template for the production of the complementary strand • Because each daughter double-stranded DNA molecule contains one original and one new strand, the replication process is called semi conservative DNA • Polymer of nucleotides: Adenine, Thymine, Cytosine, and Guanine • "Backbone" is deoxyribosephosphate • Strands are held together by hydrogen bonds between A-T and C-G • Strands are antiparallel 5’…..AAGCTTA…. 3’ 3’…..TTCGAAT…. 5’ Figure 8.3b Figure 8.4 DNA replication 5’ end 5’ end 3’ end 3’ end 3’ end 3’ end 5’ end 5’ end Enzyme – DNA polymerase – add nucleotides in 5’ 3’ direction DNA replication Figure 8.6 DNA replication • DNA replication begins when enzyme helicase unwinds a segment of the DNA and breaks the hydrogen bonds between the two complementary strands of DNA. • Replication fork - the junction where the double-stranded DNA splits apart into 2 single strands • DNA is copied by enzyme DNA polymerase in the 5 3 direction – Leading strand synthesized continuously – Lagging strand synthesized discontinuously • Initiated by an RNA primer • Okazaki fragments • RNA primers are removed and Okazaki fragments joined by a DNA polymerase and DNA ligase • DNA polymerase makes mistakes with frequency 10-9 bases mutation Bacterial DNA replication • Bacterial chromosome is circular • Replication is initiated at a particular sequence in a genome - origin of replication. • Forms two replication forks • DNA replication proceed in two directions – Bidirectional Figure 8.6b Figure 8.7 The Flow of Genetic Information Parent cell DNA Flow of genetic information within a cell – when a gene is expressed:replication recombination • DNA is transcribed to produce RNA expression Genetic information is used within a cell to produce the proteins needed for the cell to function. Genetic information can Genetic information can be Insert Fig 8.2 (mRNA, rRNA, tRNA, siRNA) be transferred between transferred between cells generations of cells. of the same generation. • mRNA is then translated into proteins. Transcription New combinations of genes Transcription Translation Cell metabolizes and grows Translation DNA RNA Double stranded Single stranded Recombinant cell Protein Daughter cells Chain of amino acids 1. Transcription RNA polymerase DNA RNA mRNA tRNA rRNA siRNA • DNA transcription is a process that involves the transcribing of genetic information from DNA to RNA – DNA gene sequence is a template for synthesis of RNA • RNA polymerase - enzyme responsible for the transcription of DNA • Only genes are transcribed Transcription GENE sequence DNA RNA Promoter sequence coding sequence terminator sequence AUG…………………………… • Transcription begins when RNA polymerase binds to the specific DNA sequence of the gene promoter • Transcription proceeds in the 5 3 direction of RNA sequence • Complementary base are A-U (UTP) and G-C • Only one of the DNA strands is transcribed DNA 3’….. AATTACGACCCAATTGAGGC …. 5’ antisense strand RNA 5’AUGUGGGUUAACUCCG….. 3’ DNA 5’…. TTAATGTGGGTTAACTCCG……3’ sense strand • Transcription stops when it reaches the terminator sequence Eukaryotic mRNA • Transcription - in the nucleus • Coding sequence of eukaryotic genes consist of: – Exons – code for amino acids order in proteins – Introns – no coding sequence • mRNA is synthesize as a precursor (exons + introns) and undergo splicing (processing, introns are deleted and exons are connected) – One mRNA – more then one protein – Variability • One gene → more than one mRNA→ more than one protein Nucleus Bacterial mRNA • Bacterial genes don’t have introns • Bacterial mRNA does not undergo splicing • One bacterial mRNA could carry sequences for more then one protein (usually with related metabolic functions) • One promoter - One mRNA Promoter sequence coding sequence terminator sequence DNA mRNA AUG……..….AUG…………..AUG……….. protein1 protein2 protein3 (enzyme1) (enzyme2) (enzyme3) • DNA – gene with specific sequence of bases (DNA letters) A, T, G, C • RNA – complementary to the DNA with bases (RNA letters) A, U, G, C Translation Transcription Gene expression and genetic language • Protein – sequence of amino acids ( only 20 amino acids) • Genetic code • –Variability 4, 42=16, 43=64 • Codon - three-base segments of mRNA that specify amino acids. • All organisms have the same codons to specify the particular amino acid Genetic code • The genetic code is degenerate; – most amino acids are coded for by more than one codon. • Of the 64 codons: – 61 are sense codons (which code for amino acids), – 3 are nonsense codons (which do not code for amino acids) are stop signals for translation. • The start codon, AUG, codes for methionine. Protein Met - Phe -Ser - Arg……Val mRNA AUGUUUUCCAGG…GUGUGA Start Stop One codon: Met, Trp. Two codons: Asn, Asp, Cys, Gln, Glu, His, Lys, Phe, Tyr, Three codons: Ile, STOP ("nonsense"). Four codons: Ala, Gly, Pro, Thr, Val. Five codons: none. Six codons: Arg, Leu, Ser. Figure 8.9 Translation • Translation is the process in which the information in the nucleotide base sequence of mRNA (codons of mRNA) is converted to the order of amino acid sequence of a protein. • Transfer RNA (tRNA) - a small RNA, each containing about 80 nucleotides. – A tRNA molecules has two functional sites: • Recognize a specific codon (anticodon sequence) – For each sense codon these is a tRNA with complementary antisense codon • Binds to a specific amino acid (at 3’ end) – Transport the required amino acid to the ribosomes • The site of translation is the ribosome. Figure 8.2 • • • • mRNA Ribosomal subunits Met-tRNA Amino acid Figure 8.9, step 1 Translation 1. Initiation of translation – AUG codon – Met tRNA 2. Elongation – protein synthesis 3. Termination – Stop codon Translation • In Eukaryotic cells: – Transcription – nucleus – Translation – EPR • In Bacterial cells there is no nucleus – The transcription and translation processes go simultaneously. mRNA AUG……..UAA… AUG…….…UAA AUG.……UAA.. protein1 (enzyme1) protein2 (enzyme2) protein3 (enzyme3) Gene expression and cell energy • Genes, through transcription and translation, direct the synthesis of proteins, many of which serve as enzymes • The very enzymes used for cellular metabolism. • Protein synthesis requires a tremendous expenditure of energy • The regulation of protein synthesis is important to the cell’s energy economy. The cell conserves energy by making only those proteins needed at a particular time • There are 2 classes of genes – Structural genes • genes that code for any protein or RNA molecules that are required for normal enzymatic or structural functions in the cell – Regulatory genes • genes that code for protein and RNA molecules whose function is to regulate the expression of other genes The Operon model of gene expression • GENE sequence Operon DNA Promoter Operator Coding sequence (regulatory region) non–coding sequences Bacteria mRNA AUG……..Stop….AUG…..Stop…..AUG……Stop protein1 protein2 protein3 (enzyme1) (enzyme2) (enzyme3) • In bacteria - a group of coordinately regulated structural genes with related metabolic functions is organized as a unit - Operon – Promoter (sequence), operator (sequence) and structural genes ( sequence) are called an operon. • The promoter and operator are sites that control structural gene transcription. • Structural genes are expressed as a single messenger RNA. The Operon model of gene expression • Promoter is the site to which RNA binds • Expression of structural genes is regulated by a regulatory protein - repressor protein • In the operon model a regulatory gene codes for the repressor protein • The repressor protein acts by binding to a site on the DNA. • The site on the DNA to which the repressor protein binds is called an Operator. • Activity of the repressor protein depends on the presence or absence of an Effector substance. Lac Tryptophan Figure 8.14.1 Learning objectives • Define genetics, genome, chromosome, gene, genetic code, genotype, phenotype, and genomics. • Describe how DNA serves as genetic information. • Describe the process of DNA replication. • Describe protein synthesis, including transcription, RNA processing, and translation. • Describe the operon model of gene expression