* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genomic imprinting of a placental lactogen gene in Peromyscus
Genomic library wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Metagenomics wikipedia , lookup
Human genome wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Gene therapy wikipedia , lookup
Transposable element wikipedia , lookup
Oncogenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Gene nomenclature wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Essential gene wikipedia , lookup
Public health genomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Gene desert wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
X-inactivation wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Pathogenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Ridge (biology) wikipedia , lookup
Gene expression programming wikipedia , lookup
Minimal genome wikipedia , lookup
Genome evolution wikipedia , lookup
Genome (book) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Dev Genes Evol (2001) 211:523–532 DOI 10.1007/s00427-001-0188-x O R I G I N A L A RT I C L E Paul B. Vrana · Paul G. Matteson · Jennifer V. Schmidt Robert S. Ingram · Andrew Joyce · Kelly L. Prince Michael J. Dewey · Shirley M. Tilghman Genomic imprinting of a placental lactogen gene in Peromyscus Received: 24 April 2001 / Accepted: 4 September 2001 / Published online: 17 November 2001 © Springer-Verlag 2001 Abstract The mammalian genome contains over 30 genes whose expression is dependent upon their parent-of-origin. Of these imprinted genes the majority are involved in regulating the rate of fetal growth. In this report we show that in the deer mouse Peromyscus the placental lactogen-1-variant (pPl1-v) gene is paternally expressed throughout fetal development, whereas the linked and closely related pPl1 gene is expressed in a biallelic manner. Neither the more distantly related pPl2A gene, nor the Mus Pl1 gene displays any preferential expression of the paternal allele, suggesting that the acquisition of imprinting of pPl1-v is a relatively recent event in evolution. Although pPl1 expression is temporally mis-regulated in the dysplastic placentae of hybrids between two Peromyscus species, its over-expression cannot account for the aberrant phenotypes of these placentae. We argue that the species-specific imprinting of pPl1-v, encoding a growth factor that regulates nutrient transfer from Edited by R. Balling P.B. Vrana and P.G. Matteson contributed equally to this work P.B. Vrana (✉) · P.G. Matteson · J.V. Schmidt · R.S. Ingram A. Joyce · S.M. Tilghman Howard Hughes Medical Institute and Department of Molecular Biology, Princeton University, Princeton, NJ 08544, USA K.L. Prince · M.J. Dewey Peromyscus Genetic Stock Center, Department of Biological Sciences, University of South Carolina, Columbia, SC 29208, USA Present addresses: P.B. Vrana, Department of Biological Chemistry, Medical Sciences I, D233, College of Medicine, University of California Irvine, Irvine, CA 92799–1700, USA e-mail: [email protected] Tel.: +1-949-8249464, Fax: +1-949-8242688 P.G. Matteson, Laboratory of Developmental Neurobiology, Rockefeller University, New York, NY 10021, USA J.V. Schmidt, Laboratory for Molecular Biology, Department of Biological Sciences University of Illinois at Chicago, Chicago, IL 60607, USA mothers to their offspring, is consistent with the parentoffspring conflict model that has been proposed to explain the evolution of genomic imprinting. Keywords Genomic imprinting · Placental lactogen · Peromyscus · Growth control · Placenta Introduction Genomic imprinting is the non-equivalent expression of the parental alleles of a gene based on parent-of-origin (Bartolomei and Tilghman 1997). By rendering all imprinted loci functionally hemizygous, the evolution of imprinting in mammals imposes a survival cost to the organism. For this reason there has been intense debate about the function of imprinting (Moore and Haig 1991; Hurst 1997). While the more than 30 imprinted genes discovered to date have a variety of biochemical functions and many are widely expressed, mutations in the genes disproportionately affect the rate of prenatal growth (Tilghman 1999). The placenta, the fetal-derived organ responsible for regulating nutrient transfer between mother and fetus, is often affected as well. Chief among the hormones used by the placenta to regulate nutrient transfer are the placental lactogens (PLs). In primates these genes arose from tandem duplications of the growth hormone gene (Owerbach et al. 1980; Chen et al. 1989), while in rodents and bovids the PLs arose from duplications of the prolactin gene (Prl) that encodes a secreted protein involved in lactation (Soares et al. 1991; Dietz et al. 1992). In rodents, the PL genes have remained tightly linked to Prl and to other prolactin-related genes (Jackson-Grusby et al. 1988; Shah et al. 1998). In rat (Rattus), there are three PL genes, rPl1 and rPl1-v, which are closely related to one another, and rPl2. In mouse (Mus), only mPl1 and mPl2 have been reported to date (Goffin et al. 1996). Given the role of these hormones in the placenta, it was predicted by Haig (1993) that they would be ideal targets of genomic imprinting. 524 To identify new imprinted genes, we used an allelic differential display strategy (Hagiwara et al. 1997; Schmidt et al. 2000) in which we compared placental mRNAs from two closely related species of North American deer mice, Peromyscus maniculatus (BW) and P. polionotus (PO). These mice display a high degree of polymorphism (Vrana et al. 1998, 2000), making them useful for screens that depend upon allelic differences. We report the identification of a paternally expressed gene encoding a member of the PL gene family. Additionally we show that while the Peromyscus genome contains multiple PL genes, only one of them, pPl1-v, is imprinted. Materials and methods DNA and RNA analysis The differential display screen was conducted as described in Schmidt et al (Schmidt et al. 2000). RNA for northern analysis was prepared by lithium chloride-urea extraction (Auffray and Rougeon 1980). Total RNAs were separated on formaldehydeMes or MOPS agarose gels, transferred to Hybond N+ and hybridized with radiolabeled DNA probes in Express-Hyb (Clontech) or in Church buffer (Church and Gilbert 1984). For Southern blotting genomic DNAs were separated on TAE agarose gels and washed in 2X SSC/0.1% SDS, followed by 2×15 min in 0.1X SSC/0.1% SDS. Primers used for pPl1 genotyping were 5’GAAGACACWCRCCTTTTTGCCT 3′ and 5′TGCAGTCAGCACTCAGTCATG 3′. The products were digested with Cac8I, which detects a polymorphism between the PO and BW alleles. RT-PCR imprinting assays In all RT-PCR assays to detect allelic expression of genes control reactions in the absence of reverse transcriptase were performed. Artificial mixtures of the parental RNAs were also analyzed to ensure that there was no amplification bias between the two alleles. Primers designed to simultaneously amplify pPl1-v and pPl1I cDNA are 5′CTGAGRTGCCGAGAGSTC 3′ and 5′CTTATGGTTCAAGGCTC 3′. Primers used to amplify pPl1-v cDNA selectively were 5′CTGAGRTGCCGAGAGSTC 3′ and 5′CTTATGGTTCAAGGCTC 3′. Primers for the selective amplification of pPl1 cDNA were 5′CCTCTTGGATCAAGAACTGGAG 3′ and 5′TGCAGTCAGCACTCAGTCATG 3′. Primers used for the pPl2A imprinting assay were 5′TTCTCAGAGATGCAGCTGTCG 3′ and 5′GGCACTTCAAGACTTTGAC 3′. BsaJI and MseI were used to detect pPl2A polymorphisms between PO and BW alleles. Primers to amplify an 844-bp fragment of mPl1 cDNA were 5′TCACTTGGAGCCTACATTGTGGTG 3′ and 5′CATAACTGAGGAGGGGAAAGCAT 3′. The products were digested with EarI to reveal a polymorphism in the products between C57BL/6 and Cast/Ei strains. Histology/in situ hybridization Placentae were fixed, paraffin embedded and in situ hybridization was performed according to Wilkinson and Nieto (1993). A 240-bp region from exon 5 of both pPl1 and pPl1-v and a 495-bp cDNA fragment from exons 1–2 of the H19 gene were cloned into the Topo TA dual promoter cloning vector (Invitrogen). Sp6- and T7-derived RNA probes were generated from linearized plasmids in the presence of digoxygenin to generate both sense and antisense hybridization probes. Peromyscus cDNA library screening A cDNA library was constructed by Stratagene from three PO and three BW late gestation placentae in the Uni-Zap XR vector. One million phage were screened at 50,000 plaques/plate with a 240-bp region of exon 5 of pPl1-v. Positively hybridizing clones were plaque purified, rescued and sequenced on an ABI 310 capillary sequencer. DNA sequence analysis The five Peromyscus PL cDNA sequences were used in a phylogenetic analysis with other rodent PLs. Alignments were performed with the alignment packages Clustal (as implemented in MacVector 6.5.1) and MALIGN 2.7. The latter program utilizes insertion/deletion events as phylogenetic characters, rather than just bases which can be aligned in all sequences. Multiple parameters were tested during alignment, as phylogenetic hypotheses utilizing DNA sequence data have been shown to be more sensitive to alignment variation than the methodology of tree construction (Morrison and Ellis 1997; Phillips et al. 2000). The PAUP 3.1.1 software package was used for phylogenetic tree construction. Several different transversion to transition weightings were employed including equal weights, transversions 2× that of transitions, and 5× that of transitions. These trees retained all the major groupings shown in the representative tree. Radiation hybrid mapping For development of a Peromyscus radiation hybrid map a set of approximately 108 whole genome radiation hybrids were produced and characterized as will be described in detail later (Thames et al., unpublished results) using the protocol described by Womack et al. (1997). Primary fibroblasts were harvested from mid-gestation PO embryos and expanded in culture. The cells were irradiated with 5000 rad and were fused with a thymidine kinase-deficient Chinese hamster cell line, A23, provided by WJ Murphy (NCI). Cell fusion was induced by polyethylene glycol and subsequent selection was in HAT medium. Colonies appearing after 2 weeks were picked and subcloned in larger flasks. One aliquot of each was frozen for future expansion and another aliquot subjected to DNA extraction for further characterization. DNA from a small portion of the radiation hybrid panel was subjected to a preliminary PCR characterization with five randomly cloned Peromyscus microsatellites (PO-9, -16, -21, -25, and -35; Prince 2001) as well as primers that selectively amplify Peromyscus pPl1, pPl1-v and pPl2. The overall retention frequency of these seven markers in 14–24 hybrids was 44%. Results A PL gene is imprinted in Peromyscus We used multiple sets of RT-PCR primers to amplify RNAs from late gestation placentae of the two Peromyscus parental strains and reciprocal crosses (PO×BW)F1 and (BW×PO)F1 (Schmidt et al. 2000). We observed two bands that were selectively amplified in both BW and (PO×BW)F1 RNAs, suggesting that the primer(s) uncovered a polymorphism between the two species, and consistent with the detection of a paternally expressed RNA (Fig. 1a). We amplified, cloned and sequenced these bands, which revealed high sequence similarity to rodent PL genes. Sequence comparisons with all the rodent PL genes showed that the Peromyscus transcript most close- 525 their relative expression during placental development by using RT-PCR primers that amplified both genes, and exploiting a restriction fragment length polymorphism between them. We observed that the imprinted transcript was only detected after E12, similar to the rat rPl1-v gene (Fig. 3). For this reason we have designated the imprinted transcript as pPl1-v. The other Peromyscus Pl1 gene was expressed during mid-gestation, but its transcript was greatly reduced by E18, and it was thereby named pPl1. Of the three Pl2-like genes identified in the cDNA screen, one was more highly expressed than the others throughout placental development, and we called this gene pPl2A (data not shown). The other two transcripts were named pPl2B and pPl2C. Northern and RT-PCR analysis showed that both Peromyscus Pl1-like genes and Pl2A are expressed at very low levels in the embryo proper, but very highly in the placenta (data not shown). Phylogenetic analysis of Peromyscus PLs Fig. 1a, b Imprinting of the placental lactogen-1-variant (pPl1-v) gene in Peromyscus. a Differential display gel showing the presence of an RT-PCR product in placental RNAs from Peromyscus maniculatus (BW) and (PO×BW)F1 offspring, but not in P. polionotus (PO) and the reciprocal cross (BW×PO)F1. b Direct sequencing of pPl1-v -specific RT-PCR products amplified from placental RNAs of the two parental strains and reciprocal F1 hybrids. The polymorphic base is underlined ly resembled the rodent Pl1 family of hormones (pPl1-v in Fig. 2). We verified that the Peromyscus transcript was imprinted by using a single strand conformation polymorphism assay that exploits the polymorphism between the PO and BW alleles identified in the allelic display screen (data not shown). This finding was confirmed by direct sequencing of RT-PCR products from the reciprocal F1 hybrids, which showed that only the paternal allele of the gene was expressed (Fig. 1b). The sequences of five PL genes that we identified in the cDNA screen were compared with other rodent PL genes using a variety of parameters. Several features stand out in all trees examined; a representative tree with relative support for each node is shown in Fig. 2c. First, pPl1 and pPl1-v group together very strongly. If these genes had direct orthologs in other species, this would not be expected; rather one of them would have another rodent Pl1-like gene as its nearest relative. Instead, the grouping of the two Peromyscus Pl1-like genes suggests one of two things: either there has been a separate gene duplication in both Peromyscus and rat or there has been concerted evolution. Given that mouse appears to have only one Pl1-like gene, we favor the former possibility. All three Peromyscus Pl2-like genes also form a strongly supported group to the exclusion of Pl2 in other species. Given that no other rodent has been shown to have more than one Pl2-like gene, this again suggests independent Peromyscus duplications, and raises the possibility that the entire cluster has been duplicated after Peromyscus diverged from other rodents. Identification of multiple PL genes in Peromyscus To characterize the PL gene family in Peromyscus and to determine whether other members were imprinted, we screened a mid-to-late gestation Peromyscus placental cDNA library. Sequencing of clones identified two Pl1-like genes, one of which was identical to the imprinted transcript, and three Pl2-like genes (Fig. 2). In rats, which also contain two Pl1 genes, the genes are differentially expressed (Deb et al. 1991). rPl1 is most highly expressed in mid-gestation placentae and is repressed thereafter, while expression of rPl1-v increases during late gestation. To find whether the Peromyscus genes display temporal specificity as well, we examined Imprinting status of the PL genes in Peromyscus and mouse We tested the imprinting status of the other highly expressed Pl genes, pPl1 and pPl2A, in Peromyscus placenta. In contrast to pPl1-v, both genes were expressed biallelically in reciprocal crosses between PO and BW (Fig. 4a, b). Thus the only PL gene that displays imprinting in Peromyscus is the late gestation-specific pPl1-v gene. The PL-encoding genes in mouse and rat are tightly linked to one another, reflecting the relatively recent tandem duplication that generated them (Jackson-Grusby 526 Fig. 2a, b 527 Fig. 2c Fig. 2a–c Sequence comparisons of rodent placental lactogens (PLs). a The amino acid sequences of the two Peromyscus PL-I proteins are compared to those of mouse (mPL-1) and rat (rPL-1 and rPL-1v). b The amino acid sequences of the three Peromyscus PL-II proteins are compared to those of mouse (mPL-II) and rat (rPL-II). Identical residues are highlighted in shaded boxes. c Shortest tree found by PAUP from nucleotide alignments that weighted all changes equally (utilizing an initial gap change cost of 10:1). Trees were rooted between the Pl1 and Pl2 groups. Lower case prefix before each sequence indicates species: p Peromyscus, r rat, h hamster (Mesocricetus), m mouse. Tree length is 859 steps, with a Consistency Index of 0.788, and a Retention Index of 0.853. Branch Support values (Bremer 1994) are shown to the left of each node. These values reflect the number of extra steps required to break up the indicated grouping. Gaps are not included as characters in this particular tree. When they are included, the grouping of the two Peromyscus Pl1-like genes is significantly strengthened, as is the group containing the two rat Pl1-like genes and mouse Pl1. Relatively weak branches, as indicated by the Branch Support values and variation among trees constructed using different parameters are: the placement of the three Peromyscus Pl2-like genes relative to one another, and the placement of hamster Pl2 relative to the other Pl2 sequences Fig. 3 Expression of pPl1-v and pPl1 in the Peromyscus placenta. Placenta RNAs prepared from embryos at the stages indicated were amplified by RT-PCR using primers that amplify both pPl1 genes. The products were digested with AluI, which differentially cuts the two gene products. Arrows indicate the specific bands for each gene. For E18 placentae parentals and both F1 hybrids were analyzed. Amplification of genomic DNA (DNA) with the same primers is shown (BW Peromyscus maniculatus, PO P. polionotus) et al. 1988; Shah et al. 1998). To discover whether the Peromyscus genes are also linked, we screened a radiation hybrid panel in which Peromyscus chromosome fragments are distributed randomly in hamster cell lines. Using primers that distinguish the hamster and Peromyscus Pl1 genes, we detected complete co-segregation of pPl1,pPl1-v, and pPL2A genes (0.005> P <0.001). Among 24 hybrids, 9 hybrids retained all three genes and the rest retained none. In contrast, the concordance between the PL genes and five randomly chosen microsatellites ranged between 42% and 64%. We also detected co-segregation of a proliferin-like cDNA that is part of the family of prolactin-like genes in mice (Linzer and Nathans 1985) in 21 of 22 cell lines tested (data not shown). Thus we conclude that the family of prolactinrelated genes are also linked in Peromyscus. We then asked whether mPl1 is imprinted. We used RT-PCR to amplify mPl1 from placental RNAs of C57BL/6 and M. castaneus (CAST/Ei) at day E12.5 and identified a single base difference in the 3′ UTR. Using crosses between the two strains, we demonstrated that the mPl1 gene is not imprinted in Mouse (Fig. 4c). The temporal mis-expression of pPl1 during late gestation in Peromyscus hybrids We had previously demonstrated that a majority of paternally expressed imprinted genes showed inappropriate biallelic expression in (PO×BW)F1 hybrid fetuses, and that the failure to silence these genes contributes to dramatic placental overgrowth and dysplasia in these hybrids (Vrana et al. 1998, 2000). The one exception was insulin-like growth factor 2 (Igf2), which maintained its normal imprinted expression. As shown in Fig. 1, pPl1-v is a second example of such a gene. We were surprised, therefore, to note using a pan-Pl1 probe on northern blots that the levels of pPl1 in the oversized (PO×BW)F1 hybrids was greater than expected, while the undersized (BW×PO)F1 late-stage placentae showed lower expres- 528 Fig. 4a–c Allelic expression of pPl1, pPl2A and mPl1 genes. a RT-PCR of pPl1 mRNA from E12.5 placentae of PO (P. polionotus), BW (Peromyscus maniculatus) and F1 reciprocal hybrids. The products were cleaved with Cac8I to detect a polymorphism between the species. 1:1 and 2:1 lanes contain RT-PCR products of artificial mixtures of PO:BW RNAs. b RT-PCR of pPl2A mRNA from E12.5 placentae of BW, PO and F1 reciprocal hybrids. The products were cleaved with BsaJI to detect a polymorphism between the species. c RT-PCR of Mouse Pl1 mRNA from E12.5 placentae of C57BL/6 (B), Cast/Ei (C) and F1 reciprocal hybrids. The products were cleaved with EarI to detect a polymorphism between the two strains. M pBR322 DNA digested with MspI. The arrows at the right indicate the products for each species sion than the parentals (data not shown). Using primers that amplify both pPl1-v and pPl1, we detected pPl1 expression in late-gestation (PO×BW)F1 placentae, but not in those of the reciprocal cross nor in either parental strain (Fig. 3). Thus the increase in the total pPl1 mRNA is not due to loss of pPl1-v imprinting, but to the persistent expression of the biallelic pPl1 gene in late-stage placentae. Prior studies had shown that a subset of PO× (BW×PO)F1 backcross animals were severely over-sized (Vrana et al. 2000). Furthermore a number of imprinted genes, including H19, Pw1/Peg3, Snrpn and Mest/Peg1 were biallelically expressed, as in the large (PO×BW)F1 hybrids. To find whether the persistent expression of pPl1 plays a role in the placental dysplasia, we examined its expression in a PO× (BW×PO)F1 backcross in which placentae varied from normal to over-sized. Although the mis-regulation of pPl1 was observed exclusively in the largest placentae, some large placentae had repressed pPl1 appropriately by E18 (Fig. 5a). Furthermore the genotype of pPl1 in these animals did not correlate with the size of the placenta or pPl1 mis-expression. Thus the dysplasia cannot be directly linked to the inappropriate Fig. 5a, b pPl1 mis-expression in Peromyscus crosses. a pPl1 and pPl1-v mRNAs were amplified by RT-PCR in progeny of a PO× (BW×PO)F1 backcross. The lanes are ordered in decreasing placental size, from 0.55 to 0.24 g (left to right). The last two on the right are within the normal size range. The genotype of each fetus at pPl1 is indicated. b pPl1 and pPl1-v mRNAs were amplified by RT-PCR in progeny of the crosses indicated 529 Fig. 6 Spatial expression of pPl1 and H19 in Peromyscus placentae. Paraffin embedded sections of placentae from PO (P. polionotus) and reciprocal F1 hybrids between PO and BW (Peromyscus maniculatus) were hybridized to digoxygenin-labelled anti-sense H19 probe(left) and a pan-pPl1 probe (right). S Spongiotrophoblast layer, L labyrinthine layer. All sections were photographed at ×2 magnification expression of pPl1 late in gestation. On the other hand, the mis-regulation of pPl1 was confined to animals generated in crosses in which imprinting disruptions were also seen (G3×BW and G4; Fig. 5b), and not in crosses in which imprinting disruptions have not been observed (F2 and (BW×PO)F1×BW; Fig. 5b). Thus although pPl1 is not imprinted itself, its expression may be regulated in part by the same epigenetic mechanisms that regulate imprinted genes. Whether this reflects some aspect of the tight linkage between the biallelic pPl1 and the imprinted pPl1-v genes is not clear. Alterations in the structure of the placenta in Peromyscus hybrids The decreased expression of the pPl1 transcripts in the under-sized (BW×PO)F1 offspring could not be attributed to temporal misregulation of either gene during gestation (data not shown). To further explore the explanation 530 for the decrease, we used RNA in situ hybridization to investigate the spatial expression of these genes within the placenta. pPl1-v staining revealed that the gene is expressed in the spongiotrophoblast layer in both PO and BW placentae (Fig. 6 and data not shown). However in (BW×PO)F1 placentae the spongiotrophoblast layer is reduced, possibly explaining the reduced relative expression of the pPl1 transcripts (Fig. 6). Conversely the spongiotrophoblast layer is expanded in (PO×BW)F1 placentae, and the architecture was generally disorganized. pPl1-v staining appeared only slightly proportionately expanded. H19 is a gene that is maternally expressed primarily in the labyrinthine layer and a subset of glycogen cells. Its expression was expanded in (PO×BW)F1 placentae, suggesting an overabundance of glycogen cells and invasion of labyrinthine cells into the spongiotrophoblast layer (Fig. 6). In contrast, H19 expression in the undersized (BW×PO)F1 placenta was similar to that seen in the parental strains. These studies reveal that the changes in placental growth in the reciprocal hybrids affect different cell layers. Discussion In this study we demonstrate that the expression of one of the PL genes in Peromyscus, pPl1-v, is imprinted in the placenta. The PLs are placental-specific hormones involved in regulating the availability of nutrients to the fetus, possibly by directly stimulating the release of the growth factors insulin-like growth factor-I (IGF-I), IGF-II and insulin (Hill and Hogg 1989; Anthony et al. 1995). There is also evidence that PLs can signal through the prolactin receptor, thereby affecting endometrial epithelial remodeling and differentiation during pregnancy in support of conceptus growth and development (Cohick et al. 1996; Sakal et al. 1996). Thus pPl1-v joins a growing list of imprinted genes that are involved in the regulation of fetal growth through the IGF/insulin pathways. The list includes the paternally expressed growthpromoting genes Igf2, Insulin-2 and Dlk1 as well as maternally expressed genes that repress growth, such as Igf2r and Grb10 (Barlow et al. 1991; DeChiara et al. 1991; Giddings et al. 1994; Miyoshi et al. 1998; Schmidt et al. 2000). Igf2r encodes the IGF-II /mannose-6-phosphate receptor that targets IGF-II for degradation and Grb10 encodes an adaptor protein that inhibits signaling through the insulin and/or IGF-1 receptors (Morrione et al. 1997; Morrione 2000). This complex network of imprinted genes provides strong support for imprinting as a growth regulatory mechanism. The notion that imprinting evolved to regulate fetal growth can be explained as a form of kinship theory known as parent offspring conflict, first proposed by Haig and colleagues (Moore and Haig 1991; Haig 1992, 1997). They argued that competing interests between parents will be played out between maternally and paternally derived genes within the embryos of polyandrous species. The mother will attempt to optimize the survival of her offspring by distributing maternal resources equally among all current and future offspring, while the father will try to garner as many maternal resources as possible, even at the expense of the mother and her future offspring. This selection pressure will be heightened by a greater likelihood that future offspring will not be sired by the current male. Our demonstration that pPl1-v is paternally expressed is consistent with this model. The dramatic parent-of-origin-specific somatic overgrowth and placental dysplasia that occur in Peromyscus hybrids have been shown to have both genetic and epigenetic causes (Vrana et al. 2000). The genetic component has been mapped to two regions of the mouse genome that interact with one another genetically: a maternally expressed region on the X chromosome and a paternally expressed region that corresponds to proximal mouse chromosome 7. The epigenetic effect is a loss-of-silencing of a substantial number of genes that are normally silenced upon maternal inheritance. Given the role of PLs in regulating fetal growth, it was conceivable that the overgrowth could have been due in part to the persistent expression of pPl1 in late gestation. Our genetic analysis, however, rules out a major role for pPl1 expression in the hybrid phenotype. In addition to their well-established roles in growth, PLs are also expressed within the maternal hypothalamus and the choroid plexus (Bridges et al. 1985; Bridges 1994). Infusion of either purified prolactin or PL-I into non-pregnant female mice results in the induction of a number of maternal-specific behaviors (Bridges and Freemark 1995). Thus PLs expressed from the paternal genome in the embryo may also influence postnatal maternal care. A role for genomic imprinting in maternal behavior was first suggested from the outcome of lossof-function mutations in two paternally expressed genes, Mest and Pw1/Peg3. Both mutations reduced the rate of fetal growth in offspring, but in addition, the maternal behavior of daughters was compromised (Lefebvre et al. 1998; Li et al. 1999). In both instances, the behavioral defect was correlated with a reduction in the number of oxytocin-producing neurons in the hypothalamus. However neither mutation affected the behavior of wild-type mothers of mutant embryos, which parental competition should favor more strongly. In contrast, circulating PLs could well perform such a function. Of the imprinted genes that have been examined in multiple species, the majority show conservation of imprinting (Morison and Reeve 1998). There are several exceptions such as Mash2, a gene that encodes a transcription factor required for the development of spongiotrophoblasts in the placenta (Guillemot et al. 1994). This gene is maternally expressed in mice but it is biallelic in Peromyscus (Guillemot et al. 1995; Vrana et al. 1998). The IGF2R gene, whose imprinting in humans is a polymorphic trait, is consistently imprinted in mouse, Peromyscus and didelphid marsupials (Barlow et al. 1991; Xu et al. 1993; Smrzka et al. 1995; Vrana et al. 1998; Killian et al. 2000). Thus different species have either evolved 531 different sets of imprinted genes following speciation, or have differentially lost imprinting. Based on the sequence comparisons in Fig. 2, which argue that the duplication of the Pl1 genes occurred after the radiation of rodents, pPl1-v represents a clear case where imprinting of a gene appears to have been gained. Given the large and diverse number of prolactin-related genes in different mammalian species, including Peromyscus (Lin et al. 2000 and data not shown), it is worth considering whether different family members might be imprinted in different groups. The fact that the linked pPl1 gene in Peromyscus is not imprinted raises the interesting mechanistic question of how the local control of pPl1-v imprinting is achieved, given that many well-studied imprinted genes exist in large multi-gene clusters that are regulated by single imprinting control regions (Reik and Maher 1997; Tilghman 1999). However, even within these clusters are imprinted genes that are flanked by biallelic genes, such as the imprinted Mash2 gene in mouse whose immediate neighbors are not imprinted (Caspary et al. 1998; Paulsen et al. 1998). A simple model that could account for local silencing of a single gene in an otherwise biallelic cluster posits that the promoter of the silenced gene has evolved to be more heavily methylated and therefore transcriptionally silent upon inheritance through one germline versus the other. This is thought to be the basis for the imprinting of genes such as the RNA-coding H19 gene and the Igf2r-linked anti-sense Air transcript (Li et al. 1993; Wutz et al. 1997). Interestingly, however, the methylation status of the sequences surrounding these genes also affects other genes at a distance, Igf2 and Igf2r, respectively (Wutz et al. 1997; Thorvaldson et al. 1998). Although pPl1 is not imprinted itself, it becomes inappropriately expressed in the same Peromyscus crosses that show imprinting disruptions. This suggests that the imprinting of the neighboring pPl1-v gene may have some influence over the expression of pPl1 without leading to its imprinting. Given its recent acquisition in evolution, the examination of the imprinting mechanism at pPl1-v may lead to key insights into the genesis of the process. Acknowledgements This work was supported by a grant from the National Institute of General Medical Sciences (GM51460) to S.M.T. and grants from the NIH (RR14279) and NSF (DBI 9816613) to M.J.D. S.M.T. is an Investigator of the Howard Hughes Medical Institute and J.V.S. was supported by a Jane Coffin Childs Postdoctoral Fellowship. References Anthony RV, Pratt SL, Liang R, Holland MD (1995) Placentalfetal hormonal interactions: impact on fetal growth. J Anim Sci 73:1861–1871 Auffray C, Rougeon F (1980) Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 107:303–314 Barlow DP, Stoger R, Herrmann BG, Saito K, Schweifer N (1991) The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus. Nature 349:84–87 Bartolomei MS, Tilghman SM (1997) Genomic imprinting in mammals. Annu Rev Genet 31:493–525 Bremer K (1994) Branch support and tree stability. Cladistics 10:295–304 Bridges RS (1994) The role of lactogenic hormones in maternal behavior in female rats. Acta Paediatr Suppl 397:33–39 Bridges RS, Freemark MS (1995) Human placental lactogen infusions into the medial preoptic area stimulate maternal behavior in steroid-primed, nulliparous female rats. Horm Behav 29: 216–226 Bridges RS, DiBiase R, Loundes DD, Doherty PC (1985) Prolactin stimulation of maternal behavior in female rats. Science 227:782–784 Caspary T, Cleary MA, Baker CC, Guan X-J, Tilghman SM (1998) Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol Cell Biol 18:3466– 3474 Chen EY, Liao YC, Smith DH, Barrera-Saldana HA, Gelinas RE, Seeburg PH (1989) The human growth hormone locus: nucleotide sequence, biology, and evolution. Genomics 4:479– 497 Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995 Cohick CB, Dai G, Xu L, Deb S, Kamei T, Levan G, Szpirer C, Szpirer J, Kwok SC, Soares MJ (1996) Placental lactogen-I variant utilizes the prolactin receptor signaling pathway. Mol Cell Endocrinol 116:49–58 Deb S, Faria TN, Roby KF, Larsen D, Kwok SC, Talamantes F, Soares MJ (1991) Identification and characterization of a new member of the prolactin family, placental lactogen-I variant. J Biol Chem 266:1605–1610 DeChiara TM, Robertson EJ, Efstratiadis A (1991) Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64:849–859 Dietz AB, Georges M, Threadgill DW, Womack JE, Schuler LA (1992) Somatic cell mapping, polymorphism, and linkage analysis of bovine prolactin-related proteins and placental lactogen. Genomics 14:137–143 Giddings SJ, King CD, Harman KW, Flood JF, Carnaghi LR (1994) Allele specific inactivation of insulin 1 and 2, in the mouse yolk sac, indicates imprinting. Nat Genet 6:310–313 Goffin V, Shiverick KT, Kelly PA, Martial JA (1996) Sequencefunction relationships within the expanding family of prolactin, growth hormone, placental lactogen, and related proteins in mammals. Endocr Rev 17:385–410 Guillemot F, Nagy A, Auerbach A, Rossant J, Joyner AL (1994) Essential role of Mash-2 in extraembryonic development. Nature 371:333–336 Guillemot F, Caspary T, Tilghman SM, Copeland NG, Gilbert DJ, Jenkins NA, Anderson DJ, Joyner AL, Rossant J, Nagy A (1995) Genomic imprinting of Mash-2, a mouse gene required for trophoblast development. Nat Genet 9:235–241 Hagiwara Y, Hirai M, NIshiyama K, Kanazawa I, Ueda T, Sakaki Y, Ito T (1997) Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18. Proc Natl Acad Sci USA 94:9249–9254 Haig D (1992) Genomic imprinting and the theory of parent-offspring conflict. Semin Dev Biol 3:153–160 Haig D (1993) Genetic conflicts in human pregnancy. Q Rev Biol 68:495–532 Haig D (1997) Parental antagonism, relatedness asymmetries, and genomic imprinting. Proc R Soc Lond Ser B 264:1657–1662 Hill DJ, Hogg J (1989) Growth factors and the regulation of preand postnatal growth. Baillieres Clin Endocrinol Metab 3: 579–625 Hurst LD (1997) Evolutionary theories of genomic imprinting. In: Reik W, Surani A (eds) Genomic imprinting. IRL Press, Oxford, pp 211–237 Jackson-Grusby LL, Pravtcheva D, Ruddle FH, Linzer DI (1988) Chromosomal mapping of the prolactin/growth hormone gene family in the mouse. Endocrinology 122:2462–2466 532 Killian JK, Byrd JC, Jirtle JV, Munday BL, Stoskopf MK, MacDonald RG, Jirtle RL (2000) M6P/IGF2R imprinting evolution in mammals. Mol Cell 5:707–716 Lefebvre L, Viville S, Barton SC, Ishino F, Keverne EB, Surani MA (1998) Abnormal maternal behaviour and growth retardation associated with loss of the imprinted gene Mest. Nat Genet 20:163–169 Li E, Beard C, Jaenisch R (1993) The role of DNA methylation in genomic imprinting. Nature 366:362–365 Li L, Keverne EB, Aparicio SA, Ishino F, Barton SC, Surani MA (1999) Regulation of maternal behavior and offspring growth by paternally expressed Peg3. Science 284:330–333 Lin J, Toft DJ, Bengtson NW, Linzer DI (2000) Placental prolactins and the physiology of pregnancy. Recent Prog Horm Res 55:37–51 Linzer DI, Nathans D (1985) A new member of the prolactingrowth hormone gene family expressed in mouse placenta. EMBO J 4:1419–1423 Miyoshi N, Kuroiwa Y, Kohda T, Shitara H, Yonekawa H, Kawabe T, Hasegawa H, Barton SC, Surani MA, KanekoIshino T, Ishino F (1998) Identification of the Meg1/Grb10 imprinted gene on mouse proximal chromosome 11, a candidate for the Silver-Russell syndrome gene. Proc Natl Acad Sci USA 95:1102–1007 Moore T, Haig D (1991) Genomic imprinting in mammalian development: a parental tug-of-war. Trends Genet 7:45–89 Morison IM, Reeve AE (1998) A catalogue of imprinted genes and parent-of-origin effects in humans and animals. Hum Mol Genet 7:1599–1609 Morrione A (2000) Grb10 proteins in insulin-like growth factor and insulin receptor signaling. Int J Mol Med 5:151–154 Morrione A, Valentinis B, Resnicoff M, Xu S, Baserga R (1997) The role of mGrb10alpha in insulin-like growth factor I-mediated growth. J Biol Chem 272:26382–26387 Morrison DA, Ellis JT (1997) Effects of nucleotide sequence alignment on phylogeny estimation: a case study of 18S rDNAs of apicomplexa. Mol Biol Evol 14:428–441 Owerbach D, Rutter WJ, Martial JA, Baxter JD, Shows TB (1980) Genes for growth hormone, chorionic somatommammotropin, and growth hormones-like gene on chromosome 17 in humans. Science 209:289–292 Paulsen M, Davies KR, Bowden LM, Villar AJ, Franck O, Fuermann M, Dean WL, Moore TF, Rodrigues N, Davies KE, Hu RJ, Feinberg AP, Maher ER, Reik W, Walter J (1998) Syntenic organization of the mouse distal chromosome 7 imprinting cluster and the Beckwith-Wiedemann syndrome region in chromosome 11p15.5. Hum Mol Genet 7:1149–1159 Phillips A, Janies D, Wheeler W (2000) Multiple sequence alignment in phylogenetic analysis. Mol Phylogenet Evol 16:317– 330 Prince K (2001) Development of molecular markers for the Peromyscus genome project. M.Sc. thesis, University of South Carolina, Columbia Reik W, Maher ER (1997) Imprinting in clusters: lessons from Beckwith-Wiedemann syndrome. Trends Genet 13:330–334 Sakal E, Robertson MC, Chapnik-Cohen N, Tchelet A, Gertler A (1996) Interaction of recombinant rat placental lactogen-I with extracellular domains of prolactin receptors from three species. Recept Signal Transduct 6:35–42 Schmidt JV, Matteson PG, Jones BK, Guan XJ, Tilghman SM (2000) The Dlk1 and Gtl2 genes are linked and reciprocally imprinted. Genes Dev 14:1997–2002 Shah P, Sun Y, Szpirer C, Duckworth ML (1998) Rat placental lactogen II gene: characterization of gene structure and placental-specific expression. Endocrinology 139:967–973 Smrzka OW, Fae I, Stoger R, Kurzbauer R, Fischer GF, Henn T, Weith A, Barlow DP (1995) Conservation of a maternal-specific methylation signal at the human IGF2R locus. Hum Mol Genet 4:1945–1952 Soares MJ, Farria TN, Roby KF, Deb S (1991) Pregnancy and the prolactin family of hormones: coordination of anterior pituitary, uterine and placental expression. Endocr Rev 12:402– 423 Thorvaldson JL, Duran KL, Bartolomei MS (1998) Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev 12:3693– 3702 Tilghman SM (1999) The sins of the fathers and mothers: genomic imprinting in mammalian development. Cell 96:185–193 Vrana PB, Guan X-J, Ingram RS, Tilghman SM (1998) Genomic imprinting is disrupted in interspecific Peromuscus hybrids. Nat Genet 20:362–365 Vrana PB, Fossella JA, Matteson P, Rio T del, O’Neill MJ, Tilghman SM (2000) Genetic and epigenetic incompatibilties underlie hybrid dysgenesis in Peromyscus. Nat Genet 25:120– 124 Wilkinson DG, Nieto MA (1993) Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol 225:361–373 Womack J, Johnson J, Owens E, Rexroad C, Schlapfer J, Yang Y (1997) A whole-genome radiation hybrid panel for bovine gene mapping. Mamm Genome 8:854–856 Wutz A, Smrzka OW, Schweifer N, Schellander K, Wagner EF, Barlow DP (1997) Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature 389:745–749 Xu Y, Goodyer CG, Deal C, Polychronakos C (1993) Functional polymorphism in the parental imprinting of the human IGF2R gene. Biochem Biophys Res Commun 197:747–754