Download KEY Honors Biology Chapter 10

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Cancer epigenetics wikipedia , lookup

Mutation wikipedia , lookup

Genetic engineering wikipedia , lookup

RNA silencing wikipedia , lookup

Epigenomics wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Molecular cloning wikipedia , lookup

DNA supercoil wikipedia , lookup

Designer baby wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Frameshift mutation wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA vaccination wikipedia , lookup

Genomics wikipedia , lookup

Epigenetics of human development wikipedia , lookup

RNA wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Messenger RNA wikipedia , lookup

NEDD9 wikipedia , lookup

Transfer RNA wikipedia , lookup

Non-coding DNA wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

History of RNA biology wikipedia , lookup

RNA-Seq wikipedia , lookup

Microevolution wikipedia , lookup

Non-coding RNA wikipedia , lookup

Gene wikipedia , lookup

Helitron (biology) wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

History of genetic engineering wikipedia , lookup

Expanded genetic code wikipedia , lookup

Epitranscriptome wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Genetic code wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Point mutation wikipedia , lookup

Primary transcript wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Transcript
Honors Biology Chapter 10
Name ________________________
Date _____________ MOD _______
Test Your Knowledge
Multiple Choice
1. In an important experiment, bacteriophages were allowed to infect bacteria. In the first trial, the
phages contained radioactive DNA, and radioactivity was detected in the bacteria. Next, other phages
containing radioactive protein were allowed to infect bacteria, and no radioactivity was detected in
the bacteria. When the experimenters compared the results of these two trials, they concluded that
a. genes are made of DNA.
b. bacteriophages can infect bacteria.
c. DNA is made of nucleotides.
d. genes carry information for making proteins.
e. genes are on chromosomes.
2. An RNA or DNA molecule is a polymer made of subunits called
a. bases.
b. amino acids.
c. nucleotides.
d. nucleic acids.
e. pyrimidines.
3. The information carried by a DNA molecule is in
a. its amino acid sequence.
b. the sugars and phosphates forming its backbone.
c. the order of the bases in the molecule.
d. the total number of nucleotides it contains.
e. the RNA units that make up the molecule.
4. A gene is
a. the same thing as a chromosome.
b. the information for making a polypeptide.
c. made of RNA.
d. made by a ribosome.
e. made of protein.
5. DNA replication occurs
a. whenever a cell makes protein.
b. to repair gene damage caused by mutation.
c. before a cell divides.
d. whenever a cell needs RNA.
e. in the cytoplasm of a eukaryotic cell.
1
6. The flow of information in a cell proceeds
a. from RNA to DNA to protein
b. from protein to RNA to DNA.
c. from DNA to protein to RNA.
d. from RNA to protein to DNA.
e. from DNA to RNA to protein.
7. Which of the following is not needed for DNA replication?
a. ribosomes
b. DNA
c. nucleotides
d. enzymes
e. All are needed.
8. Which of the following processes occur(s) in the cytoplasm of a eukaryotic cell?
a. DNA replication
b. translation
c. transcription
d. DNA replication and translation
e. translation and transcription
9. Beadle and Tatum showed that each kind of mutant bread mold lacked a specific enzyme. This
experiment demonstrated that
a. genes carry information for making proteins.
b. mutations are changes in genetic information.
c. genes are made of DNA.
d. enzymes are required to repair damaged DNA information.
e. cells need specific enzymes in order to function.
10. During the process of translation (polypeptide synthesis), ______ matches a nucleic acid codon with
the proper amino acid.
a. a ribosome
b. DNA polymerase
c. ATP
d. transfer RNA
e. messenger RNA
11. How does RNA polymerase “know” where to start transcribing a gene into mRNA?
a. It starts at one end of the chromosome.
b. Transfer RNA acts to translate the message to RNA polymerase.
c. It starts at a certain nucleotide sequence called a promoter.
d. The ribosome directs it to the correct portion of the DNA molecule.
e. It looks for the AUG start codon.
12. When RNA is being made, the RNA base _____ always pairs with the base _____ in DNA.
a. U … T
b. T … G
c. U … A
d. A … U
e. T … A
2
13. A mutagen is
a. a gene that has been altered by a mutation.
b. something that causes a mutation.
c. an organism that has been changed by a mutation.
d. the portion of a chromosome altered by a mutation.
e. any change in the nucleotide sequence of DNA.
14. How do retroviruses, such as HIV, differ from other viruses?
a. They are much simpler than other viruses.
b. They contain DNA that is used as a template to make RNA.
c. They can reproduce only inside of living cells.
d. They contain nucleic acids that code for the making of proteins.
e. They contain RNA that is used as a template to make DNA.
15. The primary difference between bacterial sex and sexual reproduction in plants and animals is that
a. bacterial sex involves more than two individuals.
b. bacterial sex does not involve genetic recombination.
c. bacteria exchange RNA, not DNA.
d. bacterial sex does not produce offspring.
e. eggs and sperm are different, but bacterial gametes are all alike.
16. Sometimes a bacteriophage transfers a gene from one bacterium to another. This process is called
a. transduction.
b. conjugation.
c. cloning.
d. DNA splicing.
e. transformation.
17. Which of the following are arranged in the correct order by size, from largest to smallest?
a. chromosome-gene-codon-nucleotide
b. nucleotide-chromosome-gene-codon
c. codon-chromosome-gene-nucleotide
d. gene-chromosome-codon-nucleotide
e. chromosome-gene-nucleotide-codon
18. A geneticist raised a crop of T2 bacteriophages in a medium containing radioactive phosphorus so that
the DNA of the bacteriophages was labeled with radioactivity. The labeled phages were then allowed
to infect nonradioactive bacteria. In a few hours, these bacteria burst open, releasing many
bacteriophages. Some of these phages contained labeled
a. DNA.
b. RNA.
c. protein.
d. all of the above.
e. DNA and protein only.
3
19. A messenger RNA molecule for making a protein is made in the nucleus and sent out to a ribosome.
The ribosome reads the mRNA message and makes a protein containing 120 amino acids. The mRNA
consisted of at least how many codons?
a. 30
b. 40
c. 120
d. 360
e. 480
20. The nucleotide sequence of a DNA codon is ACT. A messenger RNA molecule with a complementary
codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the
mRNA codon. What is the nucleotide sequence of the tRNA anticodone? (Careful-this one is harder
than it appears.)
a. TGA
b. UGA
c. ACT
d. TGU
e. ACU
21. Imagine an error occurring during DNA replication in a cell so that where there is supposed to be a T in
one of the genes there is instead of G. What effect will this probably have on the cell?
a. Each of its kinds of proteins will contain an incorrect amino acid.
b. An amino acid will be missing from each of its kinds of proteins.
c. One of its kinds of proteins might contain an incorrect amino acid.
d. An amino acid will be missing from one of its kinds of proteins.
e. The amino acid sequence of one of its kinds of proteins will be completely changed.
22. A particular ______ carry the information for making a particular polypeptide, but ______ can be used
to make any polypeptide.
a. gene and ribosome … a tRNA and an mRNA
b. gene and mRNA … a ribosome and a tRNA
c. ribosome and mRNA … a gene and a tRNA
d. gene and tRNA … a ribosome and an mRNA
e. tRNA and ribosome … a gene and an mRNA
23. A sequence of pictures of polypeptide synthesis shows a ribosome holding two transfer RNAs. One
tRNA has a polypeptide chain attached to it; the other tRNA has a single amino acid attached to it.
What does the next picture show?
a. The polypeptide chain moves over and bonds to the single amino acid.
b. The tRNA with the amino acid leaves the ribosome.
c. The amino acid moves over and bonds to the polypeptide chain.
d. The tRNA with the polypeptide chain leaves the ribosome.
e. A third tRNA with an amino acid joins the pair on the ribosome.
24. A microbiologist analyzed chemicals obtained from an enveloped RNA virus (similar to a mumps virus)
that infects monkeys. He found that the virus envelope contained a protein characteristic of monkey
cells. Which of the following is the most likely explanation for this?
a. The virus gets its envelope when it leaves its host cell.
b. The virus forced the monkey cell to make proteins for its envelope.
c. The virus has a lysogenic life cycle.
d. The virus gets its envelope when it enters its host cell.
e. The virus fools its host cell by mimicking its proteins.
4
25. At one point as a cell carried out its day-to-day activities, the nucleotides G A T were paired with the
nucleotides C U A. This pairing occurred
a. in a double-stranded DNA molecule.
b. during translation.
c. during transcription.
d. when an RNA codon paired with a tRNA anticodon.
e. It is impossible to say, given this information.
26. Which of the following does not take part in polypeptide synthesis?
a. an exon
b. mRNA
c. an intron
d. tRNA
e. a ribosome
27. A microbiologist analyzed the DNA of E. coli before and after conjugation. She found that
a. both cells lost some genes and gained others.
b. both cells gained genes but lost none of their original genes.
c. one cell lost genes, and the other gained genes.
d. one cell gained genes, and the genes of the other were unchanged.
e. the genes of both cells remained unchanged.
Essay
28. Explain why in DNA T pairs only with A and not with C or G.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
29. Why does it take a group of three DNA nucleotides to specify one amino acid in a protein? Wouldn’t it
be simpler to have a one-to-one code, where one nucleotide specified one amino acid?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
30. What is a mutation? What causes mutations? Why are most mutations harmful? Why aren’t all
mutations harmful?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
5
31. Which type of mutation - a base substitution or a base deletion - is likely to have the greatest effect on
the organism? Why?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
32. Describe step by step, but in simple terms, the roles of mRNA, tRNA, ribosomes, and amino acids in
making a polypeptide.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
33. E. coli bacteria are used in many genetic studies. Type A E. coli can live on a simple nutrient medium
because they have all the genes necessary to produce the chemicals they need. Type V E. coli can live
only on a nutrient medium to which a certain vitamin has been added because they lack a gene that
enables them to make this vitamin for themselves. It has been found that bacteria can absorb genes
from other dead, ground-up bacteria. Describe an experiment using type A and type V E. coli to
demonstrate that genes are made of DNA and not protein.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
34. It is possible to extract DNA from cells and analyze it to determine the relative amounts of the four
DNA bases. The DNA of a goldfish contains more T and less G than human DNA, but in both goldfish
and human DNA the amount of T is equal to the amount of A. Explain why.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
35. Eric said to Renee, “The amino acid sequence of the proteins in your hair determines how curly or
straight your hair will be.” Renee replied, “I don’t think that is right. Your genes determine whether
your hair is curly or straight. That’s why it’s inherited.” Who is right? Explain.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
6
36. The DNA base sequence for a short gene is:
TATGATACCTTGATAGCTATCTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use
the genetic code chart (Figure 10.8A in the text) and your knowledge of transcription and translation to
figure out the message.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
37. A biochemist found that a bacterium produced an mRNA molecule consisting of 852 nucleotides and
translated this mRNA into a polypeptide containing 233 amino acids. How many nucleotides in the
mRNA message would actually be needed to carry the message for the polypeptide, and how many
were “extras”? How would the bacterium know which nucleotides made up the message?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
38. The virus that causes chickenpox can disappear for years and then reappear in a line of painful sores
(“shingles”) where a nerve cell passes through the skin. How can viruses go away and then reappear
like this? Where are the viruses during the intervening period of time?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
39. A gene can be removed from a eukaryotic cell and spliced into the DNA of a prokaryotic cell. The
prokaryotic can transcribe the gene into mRNA and translate this mRNA into a polypeptide, but the
polypeptide has an incorrect amino acid sequence, very different from the polypeptide normally
produced by the eukaryotic cell. Why?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
7
40. A mutant strain of E. coli bacteria will not grow unless they are supplied with the amino acid lysine.
Another strain will not grow without a different amino acid, proline. When E. coli of the two strains are
mixed, a few bacteria appear in the culture that are able to grow without either of the amino acids.
Name and briefly describe three possible mechanisms that might account for this change.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
41. Flu viruses and polio viruses are both RNA viruses. Normally flu viruses attack lung cells and polio
viruses attack nerve cells. In the lab, virologists assemble a hybrid RNA virus that has the membranous
envelope of a flu virus and the RNA of a polio virus. The researchers then try to infect lung cells and
nerve cells with the hybrid. They find that the hybrid can only infect one of the kinds of cells. Which
kind of cell would you expect that to be, a lung cell or a nerve cell? Why? After the viruses replicate
and fill the infected cell, what kind of RNA would you expect them to contain, flu or polio virus RNA?
Why? Which kind of proteins would you expect them to have, flu or polio proteins? Why?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
8
Honors Biology Chapter 10
KEY
Name ________________________
Date _____________ MOD _______
Test Your Knowledge
Multiple Choice
1. In an important experiment, bacteriophages were allowed to infect bacteria. In the first trial, the
phages contained radioactive DNA, and radioactivity was detected in the bacteria. Next, other phages
containing radioactive protein were allowed to infect bacteria, and no radioactivity was detected in
the bacteria. When the experimenters compared the results of these two trials, they concluded that
a. genes are made of DNA.
b. bacteriophages can infect bacteria.
c. DNA is made of nucleotides.
d. genes carry information for making proteins.
e. genes are on chromosomes.
2. An RNA or DNA molecule is a polymer made of subunits called
a. bases.
b. amino acids.
c. nucleotides.
d. nucleic acids.
e. pyrimidines.
3. The information carried by a DNA molecule is in
a. its amino acid sequence.
b. the sugars and phosphates forming its backbone.
c. the order of the bases in the molecule.
d. the total number of nucleotides it contains.
e. the RNA units that make up the molecule.
4. A gene is
a. the same thing as a chromosome.
b. the information for making a polypeptide.
c. made of RNA.
d. made by a ribosome.
e. made of protein.
5. DNA replication occurs
a. whenever a cell makes protein.
b. to repair gene damage caused by mutation.
c. before a cell divides.
d. whenever a cell needs RNA.
e. in the cytoplasm of a eukaryotic cell.
9
6. The flow of information in a cell proceeds
a. from RNA to DNA to protein
b. from protein to RNA to DNA.
c. from DNA to protein to RNA.
d. from RNA to protein to DNA.
e. from DNA to RNA to protein.
7. Which of the following is not needed for DNA replication?
a. ribosomes
b. DNA
c. nucleotides
d. enzymes
e. All are needed.
8. Which of the following processes occur(s) in the cytoplasm of a eukaryotic cell?
a. DNA replication
b. translation
c. transcription
d. DNA replication and translation
e. translation and transcription
9. Beadle and Tatum showed that each kind of mutant bread mold lacked a specific enzyme. This
experiment demonstrated that
a. genes carry information for making proteins.
b. mutations are changes in genetic information.
c. genes are made of DNA.
d. enzymes are required to repair damaged DNA information.
e. cells need specific enzymes in order to function.
10. During the process of translation (polypeptide synthesis), ______ matches a nucleic acid codon with
the proper amino acid.
a. a ribosome
b. DNA polymerase
c. ATP
d. transfer RNA
e. messenger RNA
11. How does RNA polymerase “know” where to start transcribing a gene into mRNA?
a. It starts at one end of the chromosome.
b. Transfer RNA acts to translate the message to RNA polymerase.
c. It starts at a certain nucleotide sequence called a promoter.
d. The ribosome directs it to the correct portion of the DNA molecule.
e. It looks for the AUG start codon.
12. When RNA is being made, the RNA base _____ always pairs with the base _____ in DNA.
a. U … T
b. T … G
c. U … A
d. A … U
e. T … A
10
13. A mutagen is
a. a gene that has been altered by a mutation.
b. something that causes a mutation.
c. an organism that has been changed by a mutation.
d. the portion of a chromosome altered by a mutation.
e. any change in the nucleotide sequence of DNA.
14. How do retroviruses, such as HIV, differ from other viruses?
a. They are much simpler than other viruses.
b. They contain DNA that is used as a template to make RNA.
c. They can reproduce only inside of living cells.
d. They contain nucleic acids that code for the making of proteins.
e. They contain RNA that is used as a template to make DNA.
15. The primary difference between bacterial sex and sexual reproduction in plants and animals is that
a. bacterial sex involves more than two individuals.
b. bacterial sex does not involve genetic recombination.
c. bacteria exchange RNA, not DNA.
d. bacterial sex does not produce offspring.
e. eggs and sperm are different, but bacterial gametes are all alike.
16. Sometimes a bacteriophage transfers a gene from one bacterium to another. This process is called
a. transduction.
b. conjugation.
c. cloning.
d. DNA splicing.
e. transformation.
17. Which of the following are arranged in the correct order by size, from largest to smallest?
a. chromosome-gene-codon-nucleotide
b. nucleotide-chromosome-gene-codon
c. codon-chromosome-gene-nucleotide
d. gene-chromosome-codon-nucleotide
e. chromosome-gene-nucleotide-codon
18. A geneticist raised a crop of T2 bacteriophages in a medium containing radioactive phosphorus so that
the DNA of the bacteriophages was labeled with radioactivity. The labeled phages were then allowed
to infect nonradioactive bacteria. In a few hours, these bacteria burst open, releasing many
bacteriophages. Some of these phages contained labeled
a. DNA.
b. RNA.
c. protein.
d. all of the above.
e. DNA and protein only.
11
19. A messenger RNA molecule for making a protein is made in the nucleus and sent out to a ribosome.
The ribosome reads the mRNA message and makes a protein containing 120 amino acids. The mRNA
consisted of at least how many codons?
a. 30
b. 40
c. 120
d. 360
e. 480
20. The nucleotide sequence of a DNA codon is ACT. A messenger RNA molecule with a complementary
codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the
mRNA codon. What is the nucleotide sequence of the tRNA anticodone? (Careful-this one is harder
than it appears.)
a. TGA
b. UGA
c. ACT
d. TGU
e. ACU
21. Imagine an error occurring during DNA replication in a cell so that where there is supposed to be a T in
one of the genes there is instead of G. What effect will this probably have on the cell?
a. Each of its kinds of proteins will contain an incorrect amino acid.
b. An amino acid will be missing from each of its kinds of proteins.
c. One of its kinds of proteins might contain an incorrect amino acid.
d. An amino acid will be missing from one of its kinds of proteins.
e. The amino acid sequence of one of its kinds of proteins will be completely changed.
22. A particular ______ carry the information for making a particular polypeptide, but ______ can be used
to make any polypeptide.
a. gene and ribosome … a tRNA and an mRNA
b. gene and mRNA … a ribosome and a tRNA
c. ribosome and mRNA … a gene and a tRNA
d. gene and tRNA … a ribosome and an mRNA
e. tRNA and ribosome … a gene and an mRNA
23. A sequence of pictures of polypeptide synthesis shows a ribosome holding two transfer RNAs. One
tRNA has a polypeptide chain attached to it; the other tRNA has a single amino acid attached to it.
What does the next picture show?
a. The polypeptide chain moves over and bonds to the single amino acid.
b. The tRNA with the amino acid leaves the ribosome.
c. The amino acid moves over and bonds to the polypeptide chain.
d. The tRNA with the polypeptide chain leaves the ribosome.
e. A third tRNA with an amino acid joins the pair on the ribosome.
24. A microbiologist analyzed chemicals obtained from an enveloped RNA virus (similar to a mumps virus)
that infects monkeys. He found that the virus envelope contained a protein characteristic of monkey
cells. Which of the following is the most likely explanation for this?
a. The virus gets its envelope when it leaves its host cell.
b. The virus forced the monkey cell to make proteins for its envelope.
c. The virus has a lysogenic life cycle.
d. The virus gets its envelope when it enters its host cell.
e. The virus fools its host cell by mimicking its proteins.
12
25. At one point as a cell carried out its day-to-day activities, the nucleotides G A T were paired with the
nucleotides C U A. This pairing occurred
a. in a double-stranded DNA molecule.
b. during translation.
c. during transcription.
d. when an RNA codon paired with a tRNA anticodon.
e. It is impossible to say, given this information.
26. Which of the following does not take part in polypeptide synthesis?
a. an exon
b. mRNA
c. an intron
d. tRNA
e. a ribosome
27. A microbiologist analyzed the DNA of E. coli before and after conjugation. She found that
a. both cells lost some genes and gained others.
b. both cells gained genes but lost none of their original genes.
c. one cell lost genes, and the other gained genes.
d. one cell gained genes, and the genes of the other were unchanged.
e. the genes of both cells remained unchanged.
Essay
28. Explain why in DNA T pairs only with A and not with C or G.
A single-ringed pyrimidine, such as T, must pair with a double-ringed purine, such as A. Two
pyrimidines - A and C - would not be large enough to reach across the double helix. T specifically pairs
with A and not G because T and A have complementary chemical side groups that form hydrogen
bonds.
29. Why does it take a group of three DNA nucleotides to specify one amino acid in a protein? Wouldn’t it
be simpler to have a one-to-one code, where one nucleotide specified one amino acid?
Twenty amino acids are used in building proteins. There are only four nucleotides in DNA, so a onebase code could specify only 4 amino acids. A two-base code could specify only 42, or 16 amino acids.
In a triplet code, 43, or 64, combinations of bases are possible, more than enough to code for 20 amino
acids.
30. What is a mutation? What causes mutations? Why are most mutations harmful? Why aren’t all
mutations harmful?
A mutation is a change in the nucleotide sequence of DNA. Some mutations are spontaneous, but
many are caused by X-rays, ultra-violet light, and chemicals. Most mutations are harmful because they
alter protein amino acid sequences and impair the function of proteins. Some mutations do not alter
amino acid sequence; others lead to an improved protein or one with new capabilities that enhance an
organism’s success. Mutations create genetic diversity that makes evolution by natural selection
possible.
13
31. Which type of mutation - a base substitution or a base deletion - is likely to have the greatest effect on
the organism? Why?
A base substitution can reslt in no change to a protein or, most often, a change in one amino acid.
Effects on the organism may be minimal. A base deletion shifts the sequence of triplet groupings in a
gene, causing a drastic change in the amino acid sequence downstream from the deletion. This can
have a profound effect on the protein and the organism.
32. Describe step by step, but in simple terms, the roles of mRNA, tRNA, ribosomes, and amino acids in
making a polypeptide.
Messenger RNA (mRNA) is transcribed from a gene and carries the instructions for making a particular
polypeptide. A ribosome is the site of translation, the process of making a polypeptide according to
the mRNA message. Transfer RNAs act as translators, each kind matching a particular amino acid with
a particular codon in the mRNA. The ribosome “reads” the mRNA one codon at a time, and tRNAs
deliver their amino acids, which are added to the polypeptide chain one at a time.
33. E. coli bacteria are used in many genetic studies. Type A E. coli can live on a simple nutrient medium
because they have all the genes necessary to produce the chemicals they need. Type V E. coli can live
only on a nutrient medium to which a certain vitamin has been added because they lack a gene that
enables them to make this vitamin for themselves. It has been found that bacteria can absorb genes
from other dead, ground-up bacteria. Describe an experiment using type A and type V E. coli to
demonstrate that genes are made of DNA and not protein.
Extract DNA from dead type A E. coli and mix it with live type V E. coli. If the type V E. coli absorb the
DNA and genes are made of DNA, the type V bacteria will be able to grow on the simple medium
without the vitamin. For comparison, extract protein from dead type A E. coli and mix it with live type
V E. coli. If the type V E. coli absorb the protein and genes are made of protein, the type V bacteria will
be able to grow on the simple medium without the vitamin. Prediction: DNA will transform the type V
bacteria, but protein will not.
34. It is possible to extract DNA from cells and analyze it to determine the relative amounts of the four
DNA bases. The DNA of a goldfish contains more T and less G than human DNA, but in both goldfish
and human DNA the amount of T is equal to the amount of A. Explain why.
In the DNA double helix, T and A bases pair up; wherever there is a T nucleotide in one strand, there is
a complementary A nucleotide in the other. Thus the amount of T is equal to the amount of A. The
specific nucleotide sequences of goldfish and human DNA are different, so the number of A-T pairs is
different in the two species.
35. Eric said to Renee, “The amino acid sequence of the proteins in your hair determines how curly or
straight your hair will be.” Renee replied, “I don’t think that is right. Your genes determine whether
your hair is curly or straight. That’s why it’s inherited.” Who is right? Explain.
They are both right. Eric is talking about phenotype and Renee about genotype. The nucleotide
sequences of your genes - genotype - determine the amino acid sequences of proteins that cause your
hair to be curly or straight - your phenotype.
14
36. The DNA base sequence for a short gene is:
TATGATACCTTGATAGCTATCTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use
the genetic code chart (Figure 10.8A in the text) and your knowledge of transcription and translation to
figure out the message.
Met-Glu-Leu-Ser-Ile-Asp. First you have to transcribe DNA base sequence into mRNA base sequence,
then translate into amino acid sequence. Remember that translation always starts at the AUG start
codon.
37. A biochemist found that a bacterium produced an mRNA molecule consisting of 852 nucleotides and
translated this mRNA into a polypeptide containing 233 amino acids. How many nucleotides in the
mRNA message would actually be needed to carry the message for the polypeptide, and how many
were “extras”? How would the bacterium know which nucleotides made up the message?
Because a three-base codon specifies each amino acid, the message coding for the polypeptide would
consists of 233 x 3, or 699 nucleotides (actually 702, if the stop codon is included). The rest of the
nucleotides are extras. Translation of protein does not have to start and stop at the ends of the mRNA.
It starts at a start codon (AUG) and stops at a stop codon (UAA, UAG, or UGA). The nucleotides from
the start codon to the stop codon are the only ones that spell out the amino acid sequence of the
polypeptide.
38. The virus that causes chickenpox can disappear for years and then reappear in a line of painful sores
(“shingles”) where a nerve cell passes through the skin. How can viruses go away and then reappear
like this? Where are the viruses during the intervening period of time?
The virus may be able to insert its genes into a nerve cell’s DNA and remain latent within the cell as a
provirus. From time to time the provirus may begin producing complete viruses, causing disease
symptoms.
39. A gene can be removed from a eukaryotic cell and spliced into the DNA of a prokaryotic cell. The
prokaryotic can transcribe the gene into mRNA and translate this mRNA into a polypeptide, but the
polypeptide has an incorrect amino acid sequence, very different from the polypeptide normally
produced by the eukaryotic cell. Why?
In a eukaryotic cell, the RNA transcript is processed before translation. Noncoding introns are removed
and exons are spliced together to produce the mRNA. A prokaryote does not process its RNA before
translation, so the introns from the eukaryotic gene are not removed. When this unedited RNA is
translated, the wrong polypeptide is produced.
40. A mutant strain of E. coli bacteria will not grow unless they are supplied with the amino acid lysine.
Another strain will not grow without a different amino acid, proline. When E. coli of the two strains are
mixed, a few bacteria appear in the culture that are able to grow without either of the amino acids.
Name and briefly describe three possible mechanisms that might account for this change.
Some bacteria are combining their DNA with the DNA from the other strain, producing bacteria with
the characteristics both strains. It could be that some bacteria are dying, and their DNA is being taken
up from the medium by living bacteria-a process called transformation. Bacterial genes could be
transferred from bacterium to bacterium by a bacteriophage - transduction. Or the bacteria could be
undergoing conjugation - bacterial mating - in which DNA is transferred from one bacterium to
another.
15
41. Flu viruses and polio viruses are both RNA viruses. Normally flu viruses attack lung cells and polio
viruses attack nerve cells. In the lab, virologists assemble a hybrid RNA virus that has the membranous
envelope of a flu virus and the RNA of a polio virus. The researchers then try to infect lung cells and
nerve cells with the hybrid. They find that the hybrid can only infect one of the kinds of cells. Which
kind of cell would you expect that to be, a lung cell or a nerve cell? Why? After the viruses replicate
and fill the infected cell, what kind of RNA would you expect them to contain, flu or polio virus RNA?
Why? Which kind of proteins would you expect them to have, flu or polio proteins? Why?
Thy hybrid virus would only be able to attack lung cells because its coat contains structures (like the
glycoprotein spikes of the mumps virus or HIV) that “dock” with lung cells, not nerve cells. Once a cell
is infected, the polio virus RNA replicates and directs the manufacture of polio virus proteins.
Therefore the viruses that fill the infected cell would contain only polio virus RNA and protein, because
only polio RNA instructions got in.
16