* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Reading the Blueprint of Life Chromosome DNA Gene Transcription
Community fingerprinting wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Fatty acid metabolism wikipedia , lookup
Fatty acid synthesis wikipedia , lookup
RNA silencing wikipedia , lookup
Gene regulatory network wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
RNA interference wikipedia , lookup
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Peptide synthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Metalloprotein wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Polyadenylation wikipedia , lookup
Catalytic triad wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Proteolysis wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Protein structure prediction wikipedia , lookup
Gene expression wikipedia , lookup
Biochemistry wikipedia , lookup
Transfer RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Reading the Blueprint of Life Chromosome DNA Gene Transcription mRNA tRNA rRNA Ok……….? Let’s Read A Gene and Transcribe a mRNA 5’TTATGGGCTCGAAGTAGGG 3’AATACCCGAGCTTCATCCC RNA Must Exit Nucleus to Cytoplasm Reading the Blueprint of Life: Translation 1. mRNA must be decoded by the ribosome Message from DNA the Gene! Instructions to ribosome on how to assemble a protein mRNA Code words are called Codons Codons are 3 base pairs long Every message has a start codon Every message has a stop codon Codons identify specific Amino Acids required to make a protein Order of Codons determines the order of Amino Acids Specific sequence of Amino Acids determines the type of protein and your proteins determine traits OK …….? Any Questions? Let’s Decode a Message 5’ ATTATGCCGTGGCTTTATCGTCGGGCCGTTGCCGTTTAATCTAG 3’ TAATACGGCACCGAAATAGCAGCCCGGCAACGGCAAATTAGATC 5’ m RNA AUUAUGCCGUGGCUUUAUCGUCGGGCCGUUGCCGUUUAAUCUAG 1. Locate the start codon then circle the mRNA Codons 2. Decode the mRNA codons the reveal the Amino Acid Sequence 3. Identify the tRNA Anticodons needed to carry the Amino Acids to the mRNA codons? Reading the Blueprint of Life: Translation Who Reads and Translates the Message? 1. The Role of rRNA Combines with special enzymes to make Ribosomes Ribosomes attach to the mRNA message at start the codon Ribosomes move along the mRNA Ribosomes read the Codons Ribosomes link each Amino Acid to form a protein Ribosomes Translate the mRNA Reading the Blueprint of Life: Translation 2. The Role of tRNA Travels around the cytoplasm of the cell Locates Amino Acids Transfers (t) the Amino Acids to the ribosome Each tRNA carries a specific Amino Acid to each Codon of the mRNA The 3 bases of the tRNA are called the Anticodon OK? Write the Anticodons needed to bring Amino acids to this mRNA ? AUG CAC GAG Messenger RNA Codons First Letter Second Letter U C A G Third Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine C leucine serine stop stop A leucine serine stop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine C leucine proline glutamine arginine A leucine proline glutamine arginine G U C A isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isoleucine threonine lysine arginine A Start threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate glycine A valine alanine glutamate glycine G Methionine G Create a Sequence of Labeled Sketches That Illustrate Translation Sketch I: mRNA with start and stop codons and ribosome attachment Sketch II: tRNA locating and bringing AA’s to the ribosome Sketch III: Translocation of the Ribosome and growth of Polypeptide