Download Mendelian Genetics - Marion County Public Schools

Name_____________________________Date ________________________________
Marion County High School – Mr. Babak
Biology
Unit 4 Note Packet
Student Name_________________________
Date Packet Began__________________ Date Packet Finished_________________
Lab #
Title
Homework assigned
Turned in?
Quizzes Scheduled
Tests Scheduled
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Other Assignments
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
140
Name_____________________________Date ________________________________
February 2008
Sun
Mon
Tue
Wed
Thu
Fri
Sat
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
March 2008
Sun
Mon
Tue
Wed
Thu
Fri
Sat
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
141
Name_____________________________Date ________________________________
Mendelian Genetics
Kentucky Department of Education Biology Core Curriculum Indicators: 2.1 e, 4.1 c
Upon completion of this unit the student will:























recognize that Mendel developed his laws of heredity without any prior
knowledge concerning genes or chromosomes.
list at least five reasons for Mendel's success working with pea plants.
recognize that every organism has coded instructions for specifying its traits and
that DNA provides a reliable way for transferring hereditary information from one
generation to the next.
Recognize that each gene carries a separate piece of information.
Recognize that the inherited trait of an individual can be determined by one or by
many genes, and that one gene can influence more than one cell.
Recognize that each human cell contains thousands of genes.
Correctly define the following terms; gene, allele, chromosome, locus, and
homologous chromosomes.
Recognize that alleles are located on the same position on homologous
chromosomes.
Recognize that in asexually reproducing organisms, all the genes come from a
single parent and are identical to those of the parent.
Recognize that sexually reproducing organisms receive half their genetic
information from their Mother's egg and half from their Father's sperm.
Recognize that sexually reproduced offspring usually resemble, but are not
identical to their parents.
define the following terms and correctly use them in reference to genetic crosses;
homozygous, heterozygous (hybrid), parental generation, first filial generation,
and second filial generation.
Define the terms progeny and sibling.
define the following terms and correctly use them in reference to genetic crosses;
phenotype and genotype.
State Mendel's three Laws of Heredity and correctly explain each.
List two examples of intermediate inheritance.
List two examples of codominance.
Correctly complete genetic crosses/Punnett squares involving the Law of
Dominance, incomplete dominance, or codominance.
Define the term gene linkage and list an example of this in humans.
define the term crossing over and explain how it leads to genetic variability in
sexually produced offspring.
Explain what is meant by a karyotype and list some examples of its usefulness.
Explain how sex is determined in the genetic makeup of humans.
Explain why the male determines the sex of a human baby.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
142
Name_____________________________Date ________________________________











Define the term mutation.
Explain why only mutations in gametes may be passed on to the offspring.
Explain the difference between a chromosomal alteration and a gene mutation.
define the following terms correctly; disjunction, nondisjunction, polyploidy,
and mutagenic agent.
List some examples of mutagenic agents.
Recognize that the adaptive value of a gene mutation is dependent upon the nature
of the mutation and the type of environment in which the organism interacts.
List three examples of the interaction of the environment with genes in the
expression of inherited traits.
Explain the difference between the following types of selective breeding; artificial
selection, inbreeding, hybridization, vegetative propagation, and recombinant
DNA technology.
explain the difference between the following changes in chromosome structure;
translocation, addition, deletion, and inversion.
Recognize that the mapping of the genetic instructions in cells makes it possible
to detect, and perhaps correct, defective genes that lead to poor health.
Recognize that substances from genetically engineered organisms may reduce the
costs and side effects of replacing costly body chemicals.
I. Basic Genetics -- Mendel (1866)
** Mendel developed some basic principles of heredity
Used pea plants and other vegetables to study the
probability of traits (inherited factors) and established a set
of “laws” that governed the possibility of those traits.
1. Law of Dominance
2. Law of Independent Assortment
3. Law of Segregation and Recombination
(looked at pea shape, flower color, height, flower
location on the peas growing in the monastery garden
Image from: http://www.jic.bbsrc.ac.uk/germplas/pisum/zgs4f1.gif
Came up with a modern, organized way to look at genetic
traits and called it the Punnett Square.
To do them, you MUST identify: parents, genotype,
phenotype(s) and the probability behind it.
It DOES NOT predict what the next child will look like, but
rather, predicts the PROBABILITY that certain traits will be
expressed.
Reginald Punnett
Image from: http://www.naturalselectionreptiles.com/Genetics.html
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
143
Name_____________________________Date ________________________________
** As a result of analyzing specific mathematical ratios associated with certain
characteristics in the offspring, Mendel proposed that characteristics were inherited
as the result of the transmission of hereditary factors.
A. Why was Mendel successful with the pea?
1. Peas were easy to find as pure breeding strains.
2. Peas can self-fertilize.
3. Peas can be easily grown in a greenhouse.
4. Peas produce LOTS of offspring in a short amount of time.
5. Peas “stick to” the probability ratios quite nicely.
Image from: http://eebweb.arizona.edu/courses/ecol320/Mendel'sPeaSoupSmall.jpg
B. Mendel had no knowledge of genes or chromosomes
8. Genes: location the chromosome (DNA strand) that is responsible for passing on
traits. Mendel knew NOTHING about this – he was 100 years prior to DNA
discovery
•Every organism requires a set of coded instructions for specifying its traits. For
offspring to resemble their parents, their must be a reliable way to transfer hereditary
information from one generation to the next.
•Each gene carries a separate piece of information. An inherited trait of an individual can
be determined by one or by many genes, and a single gene can influence
more than one cell.
•Each human cell contains thousands of different genes.
9. Alleles: pairs of genes that carry the same traits and are located at the same place on
pairs of chromosomes.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
144
Name_____________________________Date ________________________________
Image from: http://www.naturalselectionreptiles.com/Genetics/allele.jpg
3. Chromosomes: super-coiled strand of DNA that carries the genetic
code on locations (locus) that are distinctly the same on homologous
chromosomes
4. Locus: specific spot on a chromosome where a particular trait can be
found
(a.) homologous chromosomes: chromosomes that are similar among a
species (chromosome #1 in a male and chromosome #1 in a female
will join and exchange information, creating a new organism)
Image from: http://www.biology.iupui.edu/biocourses/N100H/ch10genetics.html
** Alleles are located in the same position or locus on homologous chromosomes.
A. Sexually reproducing organisms normally receive half their genetic
information from the Mother's egg and half their genetic information from
their Father's sperm.
E. The significance of Mendel's work was not immediately recognized.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
145
Name_____________________________Date ________________________________
F. Mendel's hereditary factors, now called genes, exist at definite loci in a
linear fashion on chromosomes. Two genes associated with a specific
characteristic are known as alleles and are located on homologous chromosomes.
The gene-chromosome theory provides the mechanism to account for the
hereditary patterns which Mendel observed.
A. homozygous (pure) - a zygote with two of the same kind of genes for a
particular trait; see also “pure” Example TT or tt or SS or ss (as it can be
homozygous dominant or homozygous recessive
B. heterozygous: (hybrid) - a zygote/organism with two different traits for a
particular trait; see also “hybrid” Example: Tt or Ss
3. Parental generation - generation that creates a new life (often called the
P1 generation)
4. First filial generation - generation created by the “P” generation; you
are an “F1” of your parents and an “F2” of your grandparents
A. second filial generation - you are an “F2” of your grandparents
II. Some Major Genetic Concepts
This area encompasses all of Mendel’s Laws – CRUCIAL INFORMATION!!!!
Image from:
A. Law of Dominance (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
146
Name_____________________________Date ________________________________
1. If one takes pure breeding tall plants and breeds them with pure
breeding short plants, the DOMINANT TRAIT will be expressed all the
time, but heterozygotes will occur (F1). Breed an F1 with an F1 and you
will get F2’s that are all heterozygous
2. Trait shown most often is the dominant trait, the one that occurs much
less is the recessive trait
Ex. red flowering X white flowering-->red flowering peas
3. Dominant trait - trait that always appears when it is present; requires
only one allele to express the trait (as it masks the recessive)
4. Recessive trait - trait that is hidden by the dominant trait; must have
two recessives to express the feature
5. Progeny - your offspring (must be genetically 50%, so to speak, of you)
6. Siblings - your biological brothers and sisters, although they do NOT
have to share the same biological parents.
7. Punnett square – prediction method that determines the possible phenoand geno-types of the offspring of a breeding
8. Genotype - the genetic makeup of the characteristics that are
represented in the Punnett Square; Example: Tt, TT, tt
9. Phenotype - the physical features that are expressed due to the influence of
genes (blue eyes, brown hair, PTC taster)
B. Law of Segregation and Recombination (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
147
Name_____________________________Date ________________________________
1. During sexual reproduction, traits will segregate when gametes are made and
randomly recombine at fertilization, thus giving new traits that were not present
before.
2. As a result of fertilization, recombination occurs. As a consequence,
new allelic gene combinations are likely to be produced.
** Segregation and recombination is illustrated by the cross between two
individuals heterozygous for a trait.
C. Law of Independent Assortment (Mendel)
Image from: Image from: http://biology.about.com/library/weekly/aa100903a.htm
1. If the genes for two different traits are located on different
chromosomes (non-homologous chromosomes), they segregate randomly
during meiosis and, therefore, may be inherited independently of each
other.
2. The cross of two organisms heterozygous for a trait is known as a
hybrid cross.
** Assuming large numbers of such crosses, the phenotypic ratio of dominant
offspring to recessive offspring is 3:1 and the genotypic ratio of homozygous dominant
offspring to heterozygous dominant offspring to homozygous recessive offspring is 1:2:1
D. Intermediate Inheritance
•2 examples -- incomplete dominance and co-dominance
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
148
Name_____________________________Date ________________________________
a. Incomplete Dominance - A case of contrasting alleles in which
one allele is only partially dominant over the other --the dominant
allele is only partially expressed when the recessive
allele is present. Sometimes called blending inheritance
examples: red snapdragon X white snapdragon ----> pink snapdragons
Image from: http://www.naturalselectionreptiles.com/Genetics/exIncompleteDominance.jpg
b. Codominance: two alleles, both dominant for a trait, exist and
are both expressed.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
149
Name_____________________________Date ________________________________
Image from: http://www.naturalselectionreptiles.com/Genetics/exCodominance.jpg
Ex. cross between red and white horses gives roan horse
Ex. cross between black and white Andulusian fowl gives blue (gray) fowl
** Examples of codominance in humans are the blood groups and the
sickle cell trait. (Sickle cell anemia)
A Discussion of Blood Types in Humans……
Blood Type
A (homozygous)
A (heterozygous)
B (homozygous)
B (heterozygous)
Phenotype
Type A blood
Type A blood
Type B blood
Type B blood
Genotype
IAIA
IAi
IBIB
IBi
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
150
Name_____________________________Date ________________________________
AB (A&B heterozygous)
O (homozygous)
Type AB blood
Type O blood
IAIB
ii
Gene linkage – alleles that are located on the same chromosome that are often inherited
together
Linked genes are usually inherited together.
Crossing over: during meiosis and fertilization mother’s genes (chromosomes) and
father’s genes (on chromosomes) literally wrap around each other and exchange
information.
** Crossing over results in the rearrangement of linked genes and increases the
variability of offspring.
Note in the picture above the four chromosomes make up a tetrad in synapsis. The second
stage shows crossing over, and the last stage shows the genetic variability produced in the
new gene combinations.
Karyotype: a photograph of the chromosomes from one single cell (which is identical to
all other cells) taken at prophase. Nucleus is “squashed” and the chromosomes leak out
and under high magnification are photographed and then cut out and matched to their
homolog.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
151
Name_____________________________Date ________________________________
Image from: http://oak.cats.ohiou.edu/~schutte/kary.jpg
•Above is a karyotype of a normal human male.
•Human diploid cells contain ____46___ chromosomes.
•autosomes: body chromosomes (pairs 1 through 22 in a human)
•Homo sapiens has one pair of sex chromosomes - that which make us either male
or female.
** In the male each sex chromosome is unlike and is designated XY. In the female each
sex chromosome is alike and is designated XX.
** The sex of a human is genetically determined at fertilization when a sperm cell
containing either an X or a Y chromosome unites with an egg cell containing an
X chromosome.
III. Mutations:
General statements about mutation….
Mutations are “changes” in the genetic code that alter it from what you were originally
born with. They are generally recessive and disadvantageous. HOWEVER, mutation
changes the DNA enough from generation to generation to be the driving force behind
evolution.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
152
Name_____________________________Date ________________________________
** While an altered gene (mutation) may be passed on to every cell that develops from
the mutated cell, only mutations in sex cells may be passed on to the offspring.
** A mutation occurring only in body cells may be perpetuated in the individual but will
not be passed on to the offspring by sexual reproduction.
• Somatic mutations are not passed on and are usually survivable.
• Sperm and egg mutations will often be passed on and are manifested in the offspring,
should they survive the pregnancy.
B. Types of Chromosomal Alterations
3. Nondisjunction – homologous chromosomes fail to separate during
meiosis. Result is missing or extra chromosomes attached where they
should not be. One example is Down’s syndrome (nondisjunction of
chromosome #21)
4. Disjunction - separation of the chromosomes, although not always
accurately, which can also lead to genetic defects.
** If disjunction fails to occur (nondisjunction), gametes with an addition or a missing
chromosome will be produced.
3. Polyploidy – more than the 2n number of chromosomes; not
necessarily a “mutation” as it is used quite often in agriculture for increased food
production.
-- Strawberries are often 4n, meaning that each cell essentially has double the number of
chromosomes that it would have in the normal condition. This produces MASSIVE
strawberries.
-- Wheat/corn/soybeans/oat are often polyploids. More seeds per stalk makes for higher
production, thus more “saleable” product from each plant.
IV. Mutation: a random change in the chemical nature of the genetic material (DNA)
• Most often is recessive and disadvantageous
• Somatic mutations cannot be passed to offspring; germinal (sperm and egg) mutations
can be passed on
A. Mutagenic Agents -- increase the random incidence of mutations
1. Radiation – TV, X-ray, microwaves, sun, tanning beds, nuclear leakage
2. Chemicals – nicotine, tar, formaldehyde, benzene, (check your
cigarettes)
** The adaptive value of a gene mutation is dependent upon the nature of the mutation
and the type of environment with which the organism interacts.
** The environment interacts with genes in the development and expression of inherited
traits.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
153
Name_____________________________Date ________________________________
1. Examples: tanning, green plants/yellow plants, identical twins
• Many green plants contain chlorophyll for food making, but if these leaves are
screened from the light they stop making chlorophyll.
• Identical twins raised in different environments may be vastly different in
intelligence.
• If some white fur is shaved from a Himalayan rabbit and the area is kept cold
with an ice pack, black fur will grow back in its place. (The gene for black fur is
active only at very low temperatures.)
Image from: http://www.ekcsk12.org/science/regbio/rabbit.gif
** The principles of genetics appear to hold true for all organisms including humans.
The acquisition of knowledge of human genetics has been limited because humans are
not suitable subjects for experimentation. An increased knowledge of human genetics has
resulted from the expansion of the field of genetic counseling.
V. Types of Selective Breeding
A. Artificial Selection - choosing the best (most favorable) features and breeding
them INTO the species, regardless of dominance/recessiveness
-- used extensively in agriculture and especially in dog breeding
PROBLEM: genetic disease show up more often (hip dysplasia, deafness in cats)
Inbreeding - breeding good genes to good genes, even if we have to breed
brother/sister, mother/son, and father/daughter
(See below)
C. Hybridization - breeding homo (BB) dom to hom recc (bb) and getting
heterozygous (Bb). Breed hetero to hetero (Bb X Bb) and “throw away” the
recessive and dominant, but keep hetero
Ex. English shorthorn cattle X Brahman cattle --->Santa Gertrudis cattle
(Good beef X heat resistant -> good beef that is heat resistant)
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
154
Name_____________________________Date ________________________________
D. Mutations may be preserved by vegetative propagation. (Ex. seedless oranges)
--Stem of a seedless orange (scion) is grafted into a strong root plant (stock) and produces
a strong plant with seedless oranges.
E. Recombinant DNA (genetic engineering) ---modifying the actual DNA sequence to “make” slight mutations that make the organism
more successful for man’s needs. Example: transfer bacterial DNA into mouse cells to
make them produce human insulin
VI. Changes in Chromosome Structure
A. Translocation: moving a gene/DNA chunk from one place on a chromosome
to another place; causes mutations that can be fatal. (take slice of bread from
middle of loaf and move to the end)
B. Addition: adding a gene to the sequence of a chromosome. Can be fatal, but
is often used in medicine and agriculture. (add a slice of wheat bread to the
middle of a white bread loaf)
C. Deletion: removing a defective or unwanted gene from the sequence of a
DNA strand or chromosome; often used in medicine, but very difficult to do
as it modifies the entire chromosome (take a slice of bread out of the middle
of the loaf)
D. Inversion: flipping a part of a chromosome so that the sequence is slightly
different, but still preserved. (split loaf at the midpoint, turn it around so the
crust is now in the middle)
Knowledge of genetics is making possible new fields of health care. Mapping of genetic
instructions in cells makes it possible to detect, and perhaps correct, defective genes that
may lead to poor health.
Substances from genetically engineered organisms may reduce the cost and side effects
of replacing missing body chemicals.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
155
Name_____________________________Date ________________________________
Modern Genetics
Kentucky Department of Education Biology Core Curriculum Indicators: 2.1 a-l
Upon completion of this unit the student will:
 recognize that DNA (deoxyribonucleic acid) controls cellular activity by influencing
the production of enzymes.
 Describe the structure of a nucleotide.
 Describe the structure of the DNA molecule.
 Explain what is meant by complementary base pairing.
 Explain how DNA is able to replicate itself during mitosis and meiosis.
correctly define the term template.
 Explain the usefulness of the Watson - Crick Model of DNA.
 Define the term polymer and explain why DNA and RNA are polymers.
 Describe the structure of RNA and list three ways it differs in structure from DNA.
 Explain how proteins are synthesized from a DNA template.
 Define the terms transcription and translation.
 Explain the role of mRNA, rRNA, and tRNA in the process of protein synthesis.
correctly define the terms triplet, codon, and anticodon.
 in a paragraph or two, explain how DNA, RNA, and proteins are able to determine
the individuality of an organism.
 Recognize that the work of a cell is carried out by the many different kinds of molecules
it assembles (especially its proteins).
 Recognize that proteins are long, folded molecules composed of up to 20 different kinds
of amino acids which interact to produce specific protein shapes.
 Recognize that enzymes and hormones are protein in nature.
 Recognize that the specific shape of a protein usually determines its function.
 Realize that offspring resemble their parents because they inherit similar genes that code
for the production of proteins that form similar structures and perform similar functions.
 Explain in a paragraph how cell functions are regulated.
 Explain why the body cells of an organism can be very different from each other, even
though they have the same genetic makeup.
 Explain what is meant by cloning and list some uses of this.
 Describe the process of genetic engineering and list five uses for this procedure.
 Explain what restriction enzymes are and how they are used.
 recognize that inserting, deleting, or altering DNA segments can alter genes and that
this alteration may be passed on to every cell that develops from the altered cell.
 Explain what the genetic mapping is.
 Explain what the human genome project is and some potential advantages/ disadvantages
of this work.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
156
Name_____________________________Date ________________________________
Image from: http://www.csiro.au/helix/dna/
.
Image from: http://www.msu.edu/course/isb/202/ebertmay/notes/snotes/02_15_07_genes_evo2.html
Chromosomes found in the nucleus carry the hereditary material -- DNA
What is DNA?
DeoxyriboNucleic Acid
- Double spiral of four nitrogenous bases, a phosphate, and a deoxyribose sugar
that code for EVERY feature in EVERY known life form.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
157
Name_____________________________Date ________________________________
Structure of DNA Molecules
Image from: http://www.accessexcellence.com/RC/VL/GG/dna2.html
--DNA
is a double helix of nitrogenous bases composed of repeating subunits
called nucleotides
--Nucleotide Unit is composed of
A phosphate (backbone), a deoxyribose sugar, and a nitrogenous base
--The Nitrogenous Bases are:
A - Adenine
T - Thymine
C - Cytosine
G - Guanine
What is a purine? …a pyrimidine?
Adenine and Guanine are purines; Thymine and Cytosine are pyrimidines
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
158
Name_____________________________Date ________________________________
THIS IS FOR DNA REPLICATION, NOT PROTEIN SYNTHESIS!!!!
Therefore, show the resulting base pairings below!
ATGCGCCCTACGTTAAAGCTTACGGGGTACCTAAGCCCTATTGCAAT
TACGCGGGATGCAATTT…..
A Better Look at the Structural Sub-Units
Image from: http://www.accessexcellence.com/RC/VL/GG/basePair2.html
History of the Molecule
--long sought after, finally “discovered” in 1953; Dr. Rosalind Franklin takes x-ray
crystallography of the molecule, her work is “borrowed” without her knowledge by
James Watson and Francis Crick, the “discoverers” of DNA
-- Years of successive research lead us to the point where we are today, which will be
drastically different a year from now.
** Consists of two chains of nucleotide units in a twisted ladder-like structure.
(Resembles a spiral staircase)
--Watson and Crick’s findings are published on April 25, 1953 in Nature
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
159
Name_____________________________Date ________________________________
-- A short time later, several scientists discover that DNA is the pattern that
allows for the creation of RNA, which allows for protein synthesis.
-- Central Dogma of DNA: DNARNAAmino Acids sequences that give us Proteins
-- Only 2 combinations of base pairs can form the rungs of the DNA molecule.
Adenine - Thymine (A-T) AND Guanine – Cytosine (G-C)
--This specific matching up of the nitrogenous bases is called complementary base
pairing.
DNA is able to __REPLICATE___ itself.
How does DNA form duplicates of itself during mitosis and meiosis?
1. DNA “unzips” along the hydrogen bonds due to the action of DNA
helicase (“helix” = spiral; “-ase” = enzyme) as the cell starts to go through mitosis
(nuclear division).
2. Free nucleotides (which naturally exist floating around in the nucleus)
bond to the strands that are separated and create two new strands.
A view of DNA replication
Image from: http://www.accessexcellence.com/RC/VL/GG/dna_replicating.html
Usefulness of the Watson-Crick Model
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
160
Name_____________________________Date ________________________________
A. Establishes the most crucial part of the “Central Dogma” of DNA.
(DNA  RNA Protein)
B. Allows for the mechanism of DNA replication to be “seamless” and explains
the need/ability/process of DNA replication.
C. Shows how and why DNA is considered the “blueprint for life”.
Rosalind Franklin
James Watson
and
Francis Crick
Image from: http://physicsweb.org/articles/world/16/3/2/1/pwcrit1_03-03
Image from: http://www.achievement.org/achievers/wat0/large/wat0-001.jpg
RNA____RiboNucleic Acid__________
-single stranded form of nucleic acid that serves as an intermediate
blueprint for protein production
How does RNA differ in structure from DNA?
1. DNA is double stranded, RNA is single stranded
2. Adenine is replaced by Uracil; Deoxyribose sugar in DNA, but Ribose sugar in RNA
3. Only one type of DNA, but three types of RNA
Types of RNA
1. mRNA (messenger RNA)
Created during transcription
2. tRNA (transfer RNA)
Creates the code/sequence for amino acids
3. rRNA (ribosomal RNA)
Codes for the proteins that are created
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
161
Name_____________________________Date ________________________________
Image from: http://www.accessexcellence.com/RC/VL/GG/rna2.html
How are proteins synthesized from a DNA template?
1. DNA serves as a template for the synthesis of mRNA from RNA
nucleotides in the nucleus.
Transcription: actual creation of RNA from the DNA code
2. mRNA molecules carrying a specific code determined by the base
sequence of the DNA template move from the nucleus to the cytoplasm.
2. Strands of mRNA carrying codons transcribed from DNA, move to the
ribosomes in the cytoplasm.
3.
Codon: start or stop sequence that begins protein synthesis; 3
nucleotides in a row (SEE UNIVERSAL GENETIC CODE CHART)
Triplet: three nitrogenous bases that code for an amino acid
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
162
Name_____________________________Date ________________________________
4. mRNA strands become associated with rRNA on the ribosomes. (rRNA
5. Different triplets of nitrogenous bases in tRNA molecules pick up
specific amino acids in the cytoplasm and carry them to
mRNA at the ribosomes. (tRNA -- I want aa.)
6. Amino acids are put into position on the ribosome with instructions
from the triplet codes of tRNA and mRNA.
7. With the aid of enzymes and ATP (energy), the
amino acids are bonded to form a polypeptide chain (protein) on the
ribosome.
Image from:
http://dwb.unl.edu/Teacher/NSF/C08/C08Links/gened.emc.maricopa.edu/Bio/BIO181/BIOBK/protein_synthesis.gif
8. This protein formation is what directs metabolic activity in any cell.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
163
Name_____________________________Date ________________________________
** One gene codes for one polypeptide chain.
Gene = genetic “chunk” of information that codes for a certain protein,
which in turn influences creation of chemicals and structures.
** Since the sequence of nucleotides in DNA determines the sequence of
nucleotides in messenger RNA, DNA ultimately determines the sequence of
amino acids in specific proteins. The specificity of enzymes is dependent on their
protein makeup, and, since the individuality of a cell is largely a function of the
enzymes it possesses, it is evident that DNA determines the individuality and
function of an organism.
The work of a cell is carried out by the many different kinds of molecules it assembles,
mostly proteins. Proteins are long, folded molecules made up of up to 20
different kinds of amino acids which interact to produce specific protein shapes.
The specific shape of the protein (ex. enzymes and hormones) determines the specific
function of that protein.
Offspring resemble their parents because they inherit similar genes that code for the
production of proteins that form similar structures and perform similar functions.
How are cell functions regulated?
1. Each cell DIFFERENTIATES upon formation and will have functions specific to their
genetic composition. (Cellular differentiation)
2. Genes are “turned on” or “turned off” by a variety of environmental factors.
** All this gene regulation allows cells and organisms to respond to their environment
and control their growth and division.
Body cells of an individual can be very different from each other, even though they have
descended from a single cell (zygote) and have essentially the same genetic
instructions. This is because different parts of these instructions are used in different
types of cells, influenced by the cells environment and developmental history.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
164
Name_____________________________Date ________________________________
Genetic Research
** This technique shows great promise in agriculture. Plants with desirable qualities can
be rapidly produced from the cells of a single plant. What are the drawbacks???
Drawbacks/disadvantages?
Image from: http://www.iss.k12.nc.us/schools/scavenger/tggenetics.html
Or, probably more importantly a new way to feed the world?????
Tissue Culture
Image from: http://megcooperation.gov.in/model-baproj/model%20scheme3/bt/ptc.ht2.gif
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
165
Name_____________________________Date ________________________________
Genetic engineering: (reminiscent of “Franken-foods”)
-- using “non-human” organisms to create human chemicals and hormones
-- Best example is the creation of insulin by bacterial plasmid transfer
** A cell can synthesize a new chemical coded for by its new gene(s)
-- Examples include interferon, insulin, and growth hormone.
Genetic engineering can make new “medicines” that can cure, create hormones,
can repair damaged or dying tissues, but it can also be abused, change the
evolution/mutation rates or microorganisms, make us ill, illicit an immune
response occasionally.
Restriction enzymes – enzyme that acts like a pair of scissors, cutting
small DNA fragments/genes out of our genome and allows for transplant
into other species
Characteristics produced by the segments of DNA may be expressed when
these segments are inserted into new organisms such as bacteria.
Inserting, deleting, or altering DNA segments can alter genes. An altered
gene may be passed on to every cell that develops from it.
Human genome project – COMPLETE listing on the DNA sequence of a human being
(to determine the location of genes, not every individual on the planet)
A down side to this is that health insurance agencies and other organizations may
use this genetic information against individuals.
Substances from genetically engineered organisms may reduce the cost and side
effects of replacing body chemicals. Human insulin produced in bacteria is
already an example of this.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
166
Name_____________________________Date ________________________________
Secret of Photo 51 Video Worksheet
Biology: Babak
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
167
Name_____________________________Date ________________________________
Directions: Answer the following questions as you view the Nova video entitled “Secret
of Photo 51”. Ask your instructor to pause the program if you get terribly behind, but not
after each question you might miss. You may also complete the photo quiz of this
program at your instructor’s discretion.
10. Who were the two leading DNA scientists in this field? [introduction of the video]
11. What was Rosalind Franklin trying to do at the same time as Watson and Crick?
12. What year did Watson and Crick receive the Nobel Prize?
13. What is the title of James Watson’s book?
14. Why wasn’t Franklin able to defend herself as portrayed in Watson’s book?
15. What year and where was Rosalind Franklin born?
16. What was the Franklin family “doing” as the Nazi party came to power?
17. What school (college) did Rosalind Franklin attend?
18. What is x-ray crystallography?
19. What were Rosalind’s first experiments concerned with and how did they contribute
to the war effort?
20. Where did Rosalind work when she later moved to Paris and what did she perfect
when she worked there?
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
168
Name_____________________________Date ________________________________
21. What often forced Rosalind to suspend her work for weeks at a time?
22. Where in England was Rosalind offered a position?
23. What was her main assignment when Rosalind started there in 1951?
24. Who was in charge of Rosalind in the lab?
25. (BONUS): Where did the assistant (Mrs. Heller) graduate from in the letter Aaron
Klug speaks of?
26. Who “enters the game” while setting up the lab at Kings?
27. Where does Watson end up getting a position?
28. Who was Watson’s office mate?
29. What nickname was Rosalind given that Watson later “popularizes”?
30. How many forms of DNA does Rosalind initially photograph?
31. How do Watson and Crick propose to demonstrate DNA structure?
32. Who do Watson and Crick “acquire” Franklin’s unpublished data?
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
169
Name_____________________________Date ________________________________
33. What does Franklin finally name her best “B form” picture?
34. What new nickname does she acquire after this?
35. How many angstroms per “turn” is the DNA molecule?
36. What is the name of the pub that Watson and Crick declare that they have found the
“secret of life” in?
37. What was the general theme of her work after leaving King’s?
38. What is she later diagnosed with and what is the probable cause?
39. Social question: What is significant about Franklin’s upbringing and religion when
she “started” her science career versus when she completed her science career?
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
170
Name_____________________________Date ________________________________
Comparison of a “Modern” View and Photo 51
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
171
Name_____________________________Date ________________________________
Video Guide: “Secret of Photo 51”
Biology: Babak
Directions: Watch for these faces as you view the Nova video entitled “Secret of Photo
51”. Make certain to pay attention to the video AND answer the questions. Ask your
instructor to stop the video and review certain portions of the program so that you can
fully understand the history behind the discovery of the DNA molecule.
“Secret of Photo 51”
Who am I?
What role do I play in this documentary?
www.physics.ucla.edu/~cwp/dev/photopage1.1.html
Who am I?
What role do I play in this documentary?
www.davidgalbraith.org/archives/cat_science.html
Who am I?
What role do I play in this documentary?
http://osulibrary.orst.edu/specialcollections/coll/pauling/dna/pictures/portrait-crick.jpg/
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
172
Name_____________________________Date ________________________________
Who am I?
What role do I play in this documentary?
http://nobelprize.org/medicine/laureates/1962/watson-bio.html
Who am I?
What role do I play in this documentary?
http://www.nobel.se/chemistry/laureates/1982/klug-autobio.html
Who am I?
What role do I play in this documentary?
http://nobelprize.org/medicine/laureates/1962/wilkins-bio.html
Using the list below, your lecture notes (also available from my website), and your
workbook, make CERTAIN that you can do each of the following. You should have a
general knowledge base that would allow you to answer questions on the following
statements. Check off each statement/objective as you feel comfortable with it!
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
173
Name_____________________________Date ________________________________
Three Things I NEED to find out about during this review
1
2
3
OK?














Objective
Mendelian Genetics
recognize that Mendel developed his laws of heredity without any
prior knowledge concerning genes or chromosomes.
list at least five reasons for Mendel's success working with pea
plants.
recognize that every organism has coded instructions for specifying
its traits and that DNA provides a reliable way for transferring
hereditary information from one generation to the next.
recognize that each gene carries a separate piece of information.
recognize that the inherited trait of an individual can be determined
by one or by many genes, and that one gene can influence more
than one cell.
recognize that each human cell contains thousands of genes.
correctly define the following terms; gene, allele, chromosome,
locus, and homologous chromosomes.
recognize that alleles are located on the same position on
homologous chromosomes.
recognize that in asexually reproducing organisms, all the genes
come from a single parent and are identical to those of the parent.
recognize that sexually reproducing organisms receive half their
genetic information from their Mother's egg and half from their
Father's sperm.
recognize that sexually reproduced offspring usually resemble, but
are not identical to their parents.
define the following terms and correctly use them in reference to
genetic crosses; homozygous, heterozygous (hybrid), parental
generation, first filial generation, and second filial generation.
define the terms progeny and sibling.
define the following terms and correctly use them in reference to
genetic crosses; phenotype and genotype.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
174
Name_____________________________Date ________________________________




















state Mendel's three Laws of Heredity and correctly explain each.
list two examples of intermediate inheritance.
list two examples of codominance.
correctly complete genetic crosses/Punnett squares involving the
Law of Dominance, incomplete dominance, or codominance.
define the term gene linkage and list an example of this in humans.
define the term crossing over and explain how it leads to genetic
variability in sexually produced offspring.
explain what is meant by a karyotype and list some examples of its
usefulness.
explain how sex is determined in the genetic makeup of humans.
explain why the male determines the sex of a human baby.
define the term mutation.
explain why only mutations in gametes may be passed on to the
offspring.
explain the difference between a chromosomal alteration and a gene
mutation.
define the following terms correctly; disjunction, nondisjunction,
polyploidy, and mutagenic agent
list some examples of mutagenic agents.
recognize that the adaptive value of a gene mutation is dependent
upon the nature of the mutation and the type of environment in
which the organism interacts.
list three examples of the interaction of the environment with genes
in the expression of inherited traits.
explain the difference between the following types of selective
breeding; artificial selection, inbreeding, hybridization, vegetative
propagation, and recombinant DNA technology.
explain the difference between the following changes in
chromosome structure; translocation, addition, deletion, and
inversion.
recognize that the mapping of the genetic instructions in cells
makes it possible to detect, and perhaps correct, defective genes
that lead to poor health.
recognize that substances from genetically engineered organisms
may reduce the costs and side effects of replacing costly body
chemicals.
Modern Genetics






recognize that DNA (deoxyribonucleic acid) controls cellular activity by
influencing the production of enzymes.
describe the structure of a nucleotide.
describe the structure of the DNA molecule.
explain what is meant by complementary base pairing.
explain how DNA is able to replicate itself during mitosis and meiosis.
correctly define the term template.
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
175
Name_____________________________Date ________________________________





















explain the usefulness of the Watson-Crick model of DNA.
define the term polymer and explain why DNA and RNA are polymers.
describe the structure of RNA and list three ways it differs in structure
from DNA.
explain how proteins are synthesized from a DNA template.
define the terms transcription and translation.
explain the role of mRNA, rRNA, and tRNA in the process of protein
synthesis.
correctly define the terms triplet, codon, and anticodon.
in a paragraph or two, explain how DNA, RNA, and proteins are able to
determine the individuality of an organism
recognize that the work of a cell is carried out by the many different kinds
of molecules it assembles (especially its proteins).
recognize that proteins are long, folded molecules composed of up to 20
different kinds of amino acids which interact to produce specific protein
shapes.
recognize that enzymes and hormones are protein in nature.
recognize that the specific shape of a protein usually determines its
function.
realize that offspring resemble their parents because they inherit similar
genes that code for the production of proteins that form similar structures
and perform similar functions.
explain in a paragraph how cell functions are regulated.
explain why the body cells of an organism can be very different from
each other, even though they have the same genetic makeup.
explain what is meant by cloning and list some uses of this.
describe the process of genetic engineering and list five uses for this
procedure.
explain what restriction enzymes are and how they are used.
recognize that inserting, deleting, or altering DNA segments can alter
genes and that this alteration may be passed on to every cell that develops
from the altered cell
explain what the genetic mapping is.
explain what the human genome project is and some potential advantages/
disadvantages of this work.
Three things I learned during this review
©Mr. Babak’s Biology Lecture Outlines, 2009-2010, Marion County High School, Lebanon, KY 40033. Permission is granted
for not-for-profit educational use by certified teachers.
176