Download Nucleic Acid Interaction

Protein-Nucleic Acid
Interactions:
General Principles
Understanding biology through structures
Course work 2006
Roles of Protein Nucleic acid complexes
Role: Structural
Example: Histones & chromosomal proteins
Function: DNA packaged into chromosomes
Role: Regulatory
Example: Transcription factors
Function: Gene Regulation
Role: Enzymatic
Example: Polymerases, Restriction Endonucleases
Function: Replication & Transcription
Understanding biology through structures
Course work 2006
Nucleic Acid Structure
Stabilizing forces
hydrogen bonding
van der Waals attractions
Hydrophobic interactions
Understanding biology through structures
Course work 2006
Base Pair Types
A.T Watson-Crick
G.C Watson-Crick
A.U Watson-Crick
G.U Wobble
A.U Reverse Hoogsteen
A.C Reverse Hoogsteen
Sheared G.A
G.A imino
A.A.N7-amino
G.G.N7-imino
U.U imino-carbonyl
U.C 4-carbonyl-amino
A.U Reverse Watson-Crick
G.C Reverse Watson-Crick
G.U Reverse Wobble
G.C N3-amino,amino-N3
A.U Hoogsteen
A.A N1-amino symmetric
A.C Reverse Wobble
A.A N7-amino symmetric
G.G N1-carbonyl symmetric
G.G N3-amino symmetric
G.G N1-carbonyl,N7-amino
G.A N7-N1 amino-carbonyl
A.G N3-amino,amino-N1
C.C N3-amino symmetric
U.U 4-carbonyl-imino symmetric
U.U 2-carbonyl-imino symmetric
U.C 2-carbonyl-amino
Understanding biology through structures
Course work 2006
Local DNA structure
DNA is not a straight tube
The morphology of DNA is
dependent on the DNA sequence.
Some sequences introduce bends in
DNA for example
These structural features are
recognised by proteins, much like
in the ‘lock and key model’ for
enzymes
Understanding biology through structures
Course work 2006
DNA binding proteins ‘see’ the
edges of the basepairs in the major or
minor groove
Major groove
Minor groove
Understanding biology through structures
Course work 2006
Structure of Glucocorticoid receptor
Understanding biology through structures
Course work 2006
What is it that these proteins interact with:
Hydrogen bond donors
Hydrogen bond acceptors
Hydrophobic residues
The protein ‘sees’ a particular array of
these, which is different for each of the
four base pairs
Note that the edge pattern for G:C is
different than the one for C:G
Understanding biology through structures
Course work 2006
These are the edge patterns a DNA binding protein would ‘see’
Notice that in the major groove, every base pair has a unique pattern,
wherease the minor groove only has two distinct patterns.
The major groove is therefore more informative than the minor groove
Understanding biology through structures
Course work 2006
Protein structure
DNA binding Motif in protein molecules
• Helix-turn-helix
• Zn fingers (steroid receptor type)
• Bzip (leucine zipper)
• Parallel alpha helices
• Anti-parallel beta strands
Conformational
Changes
Unbound conformation
bound conformation
Understanding biology through structures
Course work 2006
Zinc-finger motif
• Present in proteins that bind
nucleic acids
• Zn2+ ion is held between a pair of 
strands and  helix
Understanding biology through structures
Course work 2006
Zn-Finger motif
Understanding biology through structures
Course work 2006
Understanding biology through structures
Course work 2006
Leucine Zipper Motif
1YSA - Gcn4 Complex With Ap-1 Dna from Saccharomyces cerevisiae.
Front
Understanding biology through structures
Side
Top
Course work 2006
Helix Turn Helix Motif
3CRO – 434 Cro Protein Complex With DNA Containing Operator OR1 from
Bacteriophage 434
Top
Front
Understanding biology through structures
Side
Course work 2006
What parts of the protein are involved in DNA recognition
Based on structure comparisons it turned out that many
bacterial DNA binding proteins contain a conserved domain of
two alpha helices: helix-turn-helix motif
Mutations in helix 2 prevent DNA
binding, which can be suppressed by
mutations in the DNA sequence of the
operator
Swapping helix 2 between two different
repressors also swapped the operator to which
the proteins bind
This shows that helix 2 is involved in DNA recognition
Understanding biology through structures
Course work 2006
Helix 2 inserts into the major groove of DNA, whereas helix 1 lies across
the groove
Helix 2 interacts with the base pair edges
Helix 1 contacts the sugar phosphate backbone
Understanding biology through structures
Course work 2006
Specific amino acids, on the side of
the helix facing DNA, interact with
the base pair edges through
hydrogen bonding
Helix turn helix motif of Cro
repressor protein (phage Lambda)
The number of interactions between
helix 2 and the DNA sequence
determines the strenghth of DNA
binding.
Explains why the same protein can bind to
different, yet related sequences with
different affinities. We saw this for the
LysR type proteins!
Interaction between Cro and DNA
Understanding biology through structures
Course work 2006
Many DNA binding proteins are dimers, e.g, the
LysR type proteins and CAP
This means that there are two helix-turn-helix motifs
per dimeric protein
These will interact with two adjacent
major grooves, ie 10 bp apart
helix
helix
GCCACTTCAGATTTCCTGAATGCCTAC
(CbbR binding site,
lecture 5)
The DNA recognition site is therefore frequently an inverted repeat
Understanding biology through structures
Course work 2006
The 434 cro molecule contains 71 amino acid residues that show 48% sequence
identity to the 69 residues that form the N-terminal DNA-binding of 434 repressor.
It is not surprising, therefore, that their three-dimensional structures are very
similar. Like its lambda counterpart, the subunit structure of the DNA-binding
domain of 434 repressor, as well as that of 434 cro, consist of a cluster of four 
helices, with helices 2 and 3 forming the helix-turn-helix motif.
The two HTH motifs are at either end of the dimer and
contribute the main protein-DNA interactions, while proteinprotein interactions at the C-terminal part of the chains hold the
two subunits together in the complexes. Both 434 cro and
repressor fragment are monomers in solution even at high
protein concentrations, whereas they form dimers when they
are bound to DNA.
Understanding biology through structures
Course work 2006
The protein-DNA interactions have been analyzed in detail. Residues of the
recognition  helix project their side chains into the major groove and interact with
the edges of the DNA base pairs on the floor of the groove. Gln(Q)28 forms two
hydrogen bonds to N6 and N7 of Ade1 in the base pair 1(T14’-A1), and Gln29
forms hydrogen bonds both to O6 and N7 of G13’ in base pair 2 (G13’-C2). At
base pair 3 (T12’-A3) no hydrogen bonding to the protein occurs and direct
contacts are all hydrophobic; The methyl groups of the side chains of Thr27 and
Gln29 form a hydrophobic pocket to receive the methyl group of T12’.
Understanding biology through structures
Course work 2006
The first three base pairs in all six operator regions recognized by phage 434
repressor are identical. This means that interactions between these three base pairs
and the two glutamine residues (28 and 29) cannot contribute to the discrimination
between the six binding sites in the DNA; rather, these interactions provide a general
recognition site for operator regions. This simple paattern of hydrogen bonds and
hydrophobic interactions therefore accounts for the specificity of phage 434 cro and
repressor protein for 434 operator regions.
Note that when glutamines 28 and
29 are replaced by any other
amino acid, the mutant phages are
no longer viable.
Understanding biology through structures
Course work 2006
It is apparent from crystal structures of these protein-DNA complexes that the
differential affinities of 434 repressor and cro for the different operator regions are
not determined by sequence-specific interactions between amino acid side chains of
the recognition helix and base pairs in the major groove of DNA. Instead, they seem
to be determined mainly by the ability of the DNA to undergo specific structural
changes so that complementary surfaces are formed between the proteins and the
DNA. Nonspecific interactions between the DNA sugar-phosphate backbone and the
proteins are one important factor in establishing such structural changes.
In all complexes studies the protein subunit is
anchored across the major groove with extensive
contacts along two segment of the sugarphosphate backbone, one to either side of the
groove. Hydrogen bonds between the DNA
phosphate groups and peptide backbone NH
groups are remarkably prevalent in these
contacts.
Understanding biology through structures
Course work 2006
One of these interaction regions involves the loop after the recognition helix,
where three main-chain NH groups form hydrogen bonds with phosphatess 9’ and
10’. All residues in this loop, which are outside the HTH motif, contribute to the
surface complementarity between the protein and the sugar-phosspahte surfaces of
nucleotides 9’ and 10’.
These and other nonspecific interactions, which
stabilize the appropriate DNA conformation,
involve a large number of residues that are
distributed along most of the polypeptide chain.
Thus the « unit » that is responsable for
differential binding to different operator DNA
regions is really an entire binding domain, and
nearly all the protein-DNA contacts contribute
to this specificity.
Understanding biology through structures
Course work 2006
Understanding biology through structures
Course work 2006
Tata-box binding
protein
PDBcode: 1cdw
R = 1.9 Å
R factor = 0.189
The ternary complexes DNA/TBP/TFIIA
and DNA/TBP/TFIIB are now available.
The superposition gives the following
multicomplex structure.
Understanding biology through structures
Course work 2006
Histone octamer
Understanding biology through structures
Course work 2006
Histone tails between DNA gyres
Understanding biology through structures
Course work 2006
Two halves of DNA wrapped around an octamer
Understanding biology through structures
Course work 2006
RNA polymerase II (Δ4/7)
12
Crystal structure at 2.8Å resolution
6
Understanding biology through structures
8
Course work 2006
RNA polymerase II (Δ4/7)
Crystal structure at 2.8Å resolution
Understanding biology through structures
Course work 2006
Four crystal structures of RNA polymerase II
transcribing complexes
1. NTP enters into
the E site
2. NTP rotates into
the A site
4. Post-translocation
3. Pre-translocation
Understanding biology through structures
Course work 2006