* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Molecular Basis of Heredity--ST03 1.2.7
Human genome wikipedia , lookup
Genome evolution wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
Primary transcript wikipedia , lookup
SNP genotyping wikipedia , lookup
Metagenomics wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genetically modified crops wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genomic library wikipedia , lookup
Microsatellite wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenomics wikipedia , lookup
Genetically modified organism containment and escape wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Genome editing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genetically modified food wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
GMOs: Should We Grow Them? Authors: Cathy Anne Ferbrache-Garrand Elise Cooksley Susan Wierenga Tim McFaul Introduction: With the advance in biotechnology, citizens are beginning to address some of the ethical concerns surrounding this technology. One such technology which impacts human life, knowingly or not, is the technology to genetically modify organisms (GMOs) for human consumption. This technology raises many questions and concerns regarding the ethics of all those involved. The question that this unit addresses is whether or not we should grow crops and the question of U.S. policy regarding GMOs. Through the use of introductory activities and labs students will gain an understanding of the definition of a GMO. Students will explore the ethical concerns from a variety of perspectives (stakeholders) in independent research and presentations in the form of either a Senate Hearing and/or a Town Hall meeting. Finally the students will have the opportunity to synthesize, evaluate, and advise, in a thoughtful, personal written position paper. Objectives: To demonstrate understanding of the basic principles behind genetic engineering To evaluate various viewpoints concerning the use of GE crops using an ethical model To communicate a reasoned position concerning the use of GE crops both orally and through a written paper Relevant Courses: Biology, Biotechnology, Environmental Science, Earth Science This curriculum would also work well integrated into a social studies unit concerning policy development/representative government. Grade Level: 7-12 Washington State EALR’s: Systems Approach--ST01, STI02, STI03, & STI04 1. Analyze systems, including inputs and outputs, as well as subsystems. Structure and Organization of Living Systems--ST03 1.2.6 6. Understand that specific genes regulate the functions performed by structures within the cells of multi-cellular organisms. Molecular Basis of Heredity--ST03 1.2.7 7. Describe how genetic information (DNA) in the cell is controlled at the molecular level and provides genetic continuity between generations. Communicating--IN05 2.1.5 5. Research, interpret and defend scientific investigations, conclusions, or arguments; use data, logic, and analytic thinking as investigative tools; express ideas through visual, oral, written, and mathematical expression. Identifying Problems --DE01 3.1.1 1. Study and analyze challenges or problems from local, regional, national, or global contexts in which science and technology can be or has been used to design a solution. Relationship of Science and Technology--DE05 3.2.5 2. Analyze how the scientific enterprise and technological advance influence and are influenced by human activity, for example societal, environmental, economical, political, or ethical considerations. I. Introductory Activities: Day One Materials Needed Computer Lab Foods containing GMOs Part One Introduce the topic of genetically modified organisms (GMOs) by asking students to show how they feel about the value of GMOs to the world food supply. Put signs in each corner or along a wall of the classroom reflecting their possible opinions: Valuable/Necessary Useful but needs to be regulated Dangerous/Harmful Undecided/Don’t Know Students should record their opinion with a short reason in their notebooks. At the end of the unit they will revisit this opinion to see if it has changed. Part Two Prior to class tell students to bring in one food item or the packaging from a product they commonly consume or bring in a variety of foods. Corn chips and foods containing soy, cottonseed oil, or canola would be good representatives of common GMOs found at the market. Place food items around the classroom and ask students to read the ingredient labels to predict/record in their notebooks which foods they think may contain GMOs. Students then conduct an internet search on foods that contain GMOs. In their notebooks they should record how common the GMO versions are found in food (some sites will give percentages) and the website addresses of sites used. II. Background Science: Time allotment dependent on activities Prior Knowledge: DNA structure, Plasmids and Bacterial Transformation This section is designed to give students a background in the scientific principles and techniques used in creating a genetically engineered plant. There are several options that depend on the resources and time available. Web Activity (one period): Using the PBS Harvest of Fear website at http://www.pbs.org/wgbh/harvest/engineer/ students will work through the Transgenic Manipulation activity under the Engineer A Crop section with the worksheet provided. (Worksheet found in worksheet folder) If student computers are not available, the information can be printed by selecting the HTML version of this activity and students can work through the worksheet with photocopies of the procedure. Simulation (one period): Recombinant paper plasmids (Chapter 14) from Recombinant DNA and Biotechnology: A Guide for Teachers by Helen Kreuzer Phd , Adrianne Massey Phd or Simulation of Gene Splicing from Access Excellence http://www.accessexcellence.org/AE/AEPC/WWC/1994/simulation_gene_splicing.html These activities show students how genes are spliced into a vector plasmid using restriction enzymes. (See Lab folder for copy) Lab Experience (two periods): Bacterial Transformation Lab Teacher and student guide for transformation lab from University of Arizona Biotech Project http://biotech.biology.arizona.edu/ is included in this lesson. A similar lab is also available from the FHCRC Science Education Partnership http://www.fhcrc.org/education/sep/info_teach/ . (See Lab folder for copies) Reading May 2002 National Geographic: Food: How Altered? By Jennifer Ackerman III. Community Think Tank Students become familiar with what genetically modified food is and how cells are altered from their participation in interactive activity from the Harvest of Fear website and doing the simulation. After reading the National Geographic article students will be able to conduct a discussion identifying the stakeholders and define the purposes of our inquiry. Purpose of Inquiry (As adapted from Paula Fraser): To search out and examine all the facts and points of view with critical thinking to advance our knowledge and understanding To understand the role of ethics in food production To increase our knowledge base and develop critical thinking skills in order to make a well reasoned decision as citizens in a democratic society To share our findings with the local paper and our representatives. Question to investigate: Should we grow genetically modified food? Perspectives/Stakeholder/Interest/Positions/Values: Students are to read several articles from their assigned/chosen stake holder’s point of view. They are to fill out the Critical Review of Articles form (See Lab folder for copy) for each article and be prepared to submit them for peer review/teacher evaluation. Possible stakeholders: Agribusiness Monsanto, Dupont and other corporations are major players in GM foods for profit. They have a considerable investment in time and money in research and take the greatest financial risks. These corporations expect to gain profits from patents on genetically modified foods as well as control market share. The Norman Borlaug Heritage Foundation www.normanborlaug.org Proposed benefits include: increased yield per acre, reduced water needs, less use of pesticides, herbicides, and fertilizers, plants have increased drought resistance, food has longer shelf life, lower calories, added vitamins, lower saturated fats, higher nutritional value, vaccine delivery. GMOs are marketed as the answer to global hunger. They object to product labeling for fear that this will alarm consumer, that the label might denote that something is wrong with the food, but then argue that the food is safe, marginalizing consumer’s concerns. Environmentalist GMOs may cause harm to soil by increasing the chance for erosion and the loss of beneficial insects, may introduce a new wave of pesticides to control GM crops that lose resistance to a disease, may effect water use, increases vulnerability to disease with monoculture farming. Food and drug Administration As the regulatory body for the agribusinesses are reluctant to restrain the growth of this economy. They believe there are fewer safety concerns and more benefits. For example, in Europe and the developing world where malnutrition is problem, the FDA promotes the export of GM products. In countries where the population is reliant on one crop which doesn’t provide the vitamins needed to support the population, “golden rice” could provide Vitamin A. The loss of 2 million children to death and 500,000 to blindness is a result of Vitamin A deficiency. Vitamins and vaccines can be added to tomatoes and bananas to increase health of individual, reduce costs in manufacture, storage, delivery, and administration the vitamin. Medical community Dr. Mae-Wan-Ho – http://www.i-sis.org.uk No long-term studies have been made to evaluate the outcome of eating GM. It’s incredibly simplistic and wrong headed to believe that altering a gene in a complex interdependent organism wills top there. The transgenic could have latency period for carcinogenic or toxic effects. GMOs could alter immune systems, metabolic balance, uset complex biochemical relationships. Sustainable Farmers and farmers of developing countries. Desire to retain their autonomy and independence in food production. They wish to avoid crop monocultures being created by corporate ownership of seed and retain diversity of crops that currently thrive in different climatic and environmental condition like drought. No way to avoid transgenic contamination since the wind blows pollen to neighboring fields. Because of this GM and non GM crops cannot co-coexist which may bring the demise of any organic farming. Farmers The case of Monsanto’s suit against Percy Schmeiser for an interesting example of a corporation using patent laws to control the use of genetically modified plant pollen which was carried by the wind to a neighboring field. Citizen Most citizens are suspicious of the use of GMOs in food production. The emerging consensus is to have accurate labeling on all food products, in order to give consumers the right to choose. People want the right to choose whether they are ingesting food that has been genetically altered. Not identifying GM foods on a label violates a person’s right to chose and the right of advised consent. A fundamental right of humans is to have control over the food they eat and feed their children. The Campaign to Label Genetically Engineered Foods www.thecampaign.org/ - People with allergies and different susceptibilities to food People with food allergies, for example peanut butter, may be susceptible to genetically altered food. GM foods could alter natural bacteria in our gut. The natural bacteria in our gut could become resistant to antibiotics. Agri-business has shifted focus from petro chemical to genetically altered food History has set a poor precedent for agri-business. The industry has not been forthcoming with information. There has been along history of suppression and misrepresentation of scientific evidence. Transparency of their processes and decision making is needed to gain trust in the safety of GMOs. View video Harvest of Fear and fill out worksheet (Worksheet found in “Feast Or Famine? Are GMO’s the Answer” Lesson Plan) This film and the accompanying worksheet creates some certainty that students have a common base of knowledge and clarifies key concepts and vocabulary. After viewing the film, ask the students if any stake holders have been left out or are under-represented. IV. Presentation (Adapted from Paula Fraser) The instructor may choose to conduct a town hall meeting or senate committee meeting. Students are to take notes on each of the witnesses/participants in order to ask appropriate questions and to write their final position paper. *See Presentation Rubic for evaluating both Town Hall and Senate Hearing Town Hall Meeting (time: 1-2 days depending on identified stakeholders and size of class) Purpose to inquire on growing genetically modified organisms to seek, look at ,and analyze all perspectives with critical thinking skills to increase knowledge and promote understanding to understand the role of ELSI – Ethical, Legal, and Social implications of Scientific research To learn to make informed decisions as citizens To share research finding with community members To make an informative decision regarding growing genetically modified organisms. Inquiry Question Should we grow genetically modified organisms? Perspectives/Interests/Stakeholders/Positions Except for the Town Hall mediator all other stakeholders will have been generated by students. All stakeholders to be assigned by a teacher designed method. (Students should not necessarily choose the position to which they are personally aligned. Students will be given 2 days to research their stakeholder position including the mediator Format Introduction by Mediator (2 min) Testimonies (2 min ea.(not including questions)) Introduction Name Affiliation Position 3 Statements in support of Position Brief Concluding Statement Questions from mediator and town residents Discussion between town hall participants and town hall residents and mediator. Mock Senate Hearing ( could be integrated in a government/social studies class) Purpose to inquiry on growing genetically modified organisms to seek, look at ,and analyze all perspectives with critical thinking skills to increase knowledge and promote understanding to understand the role of ELSI – Ethical, Legal, and Social implications of Scientific research To learn to make informed decisions as citizens To share research finding with community members To write a policy statement that addresses the inquiry question Inquiry Question What should be the U.S. policy toward genetically modified organisms? Perspectives/Interests/Stakeholders/Positions Except for the Senate board members all other stakeholders will have been generated by students. All stakeholders to be assigned by a teacher designed method. (Students should not necessarily choose the position to which they are personally aligned. Students will be given 2 days to research their stakeholder position including being a representative from a particular state. (Note: This could be altered to be a state subcommittee; teachers may also assign a different set of states for the subcommittee.) Senators: Chairperson Washington Kansas New York California Texas Format Introduction by Chairperson (2 min) Testimonies (2 min ea.(not including questions)) Introduction Name Affiliation Position 3 Statements in support of Position Brief Concluding Statement Questions from committee Discussion between committee members, audience, and witnesses Final written policy recommendation by committee to be submitted to the National advisory board on bioethics. Based upon the Hastings Decision model. V. Assessment Overview The unit has been following the general steps of the six-step ethical decision-making model developed by the Hastings Center (see generic model). In considering the ethical question “Should we grow genetically modified crops?” the students have gathered information and identified stakeholders and their values. The final steps include considering different possible decisions, evaluating them, deciding which option they think is best and taking action. The main assessment piece will be a written position paper justifying their choice. Assignment After the mock congressional hearing/town hall meeting, assign the position paper (see sample assignment description). If students have no background in ethics, this would be an appropriate time to go over important ethical principles (justice, respect for autonomy, beneficence, non-malfeasance, and care) and ethical theories (outcome-based/utilitarian or duty/rule-based), and how to use them to support an ethical decision (showing that the pros outweigh the cons for an outcome-based approach, or showing how the decision promotes ethical principles or virtues for a duty/rule-based approach). If students have already been introduced to ethics, a review would be appropriate. As a class, go over details of the assignment, and work through examples of decisions a student could select, and how that decision could be supported using ethical principles or theories. Remind students that they are now stepping out of their “stakeholder” character and are writing their papers as themselves. Papers may be assigned as homework, or as an in-class assignment. Two possible grading rubrics are included. VI. Closing Activities Revisit the introductory activity. Have the students look back in their lab notebooks and see what position they chose and their reasons for their choice. Ask them what their position is now. If they changed, what influenced them? If they did not change, ask them to explain why. Have them write their reflections in their lab notebooks. The last step of the Hastings model is to take action on your decision. One possible action would be to have students rework their position papers into letters, and send them to elected officials or government agencies that make decisions. Alternatively, copies of the class essays could be collected into a booklet that could be sent to the same places. Selected letters could be sent to publications (as letters to the editor) or included in district or school newsletters. Attachments -generic Hastings Model handout -assignment sheet for paper -two possible rubrics for grading paper Web Activity: Engineer a Crop Read the introduction by Rick Groleau and use the Selective Breeding and Transgenic Manipulation activities to answer the following questions. 1. How would you produce a crop with a specific trait using selective breeding? 2. How effective and efficient is selective breeding? Explain your answer. 3. How do you make a plant transgenic? 4. Explain the steps you used in making the tomato crop insect resistant? 5. How effective and efficient is transgenic manipulation? Explain your answer. 6. Name two advantages and two disadvantages to transgenic manipulation. Simulation of Gene Splicing Judith Averbeck, SND 1994 Woodrow Wilson Collection Introduction This exercise may be used as a prelude to a "wet" lab or as a substitute for such a lab. It correlates well with colony transformation labs. It is recommended for students who have difficulty with the abstractions that genetic engineering involves. Students need to have some knowledge of bacterial morphology, DNA structure, restriction enzymes, etc. before doing this exercise. The teacher may want to ask the students to do the background reading and its accompanying questions before the lab period. Materials Paper of two colors onto which the DNA sequences have been copied Scissors Transparent tape STUDENT MATERIALS Human Growth Hormone Background Terry's biology class had been studying human inheritance and were now discussing genetic defects. When Terry heard about dwarfs and midgets, he began to think about his sister, Julie, who had always been shorter than normal for her age. He remembered the concern of his parents when Julie was younger, especially before some sort of "treatment" that accelerated her growth had begun. When the teacher assigned oral reports to be given on various human defects, Terry resolved to do one on "whatever Julie has." The teacher accepted this, but cautioned that Julie's condition might not be genetic. That night, Terry talked to his parents. They confirmed that Julie's growth problems were indeed inherited and suggested that Terry go with his mother on her next visit with Julie to the doctor. He knew that Julie went every week to get shots and that these seemed to be helping because now the difference in height between her and her peers was not nearly so great now as it had been when she was a little kid. In fact, Julie seemed pretty normal for a 10-year-old, Terry thought. Sure, she was a girl and sometimes a pest. But, overall, they got along and even shared some interests like soccer and music. The next Monday, while Julie was getting weighed and measured, Terry and his Mom sat down with Dr. Brown who was an endocrinologist specializing in children's problems. Terry explained about his need for information for his report and the doctor seemed willing to spend a little time helping him out. She began by saying that a person's height depends on many factors. Among these are genes, hormones and nutrition. "Julie's difficulties," she continued, "were diagnosed as being mainly the result of growth hormone deficiency. This hormone is normally produced by the pituitary gland in the brain, but in Julie's case there didn't seem to be enough of it. As a result, when her pediatrician noticed on Julie's growth chart that she was lagging behind the average growth rate, he did some special tests and concluded that insufficient quantity of hormone was the culprit. Fortunately, we were able to treat Julie by injections of the hormone that have produced close-to-normal growth." After leaving the doctor's, Terry decided to go the library and search for further information. There he read that human growth hormone is really a protein consisting of 191 amino acids. Some people who lack the normal amount of this hormone inherit the deficiency from their parents in a recessive manner. Terry felt very intelligent at this point because he knew that meant that he had had a one in four chance of inheriting the condition from his carrier parents. Terry also learned some new facts. For many years, there was no treatment for those lacking sufficient hormone. In the l950's, it was found that hormone from the pituitaries of dead people could be used as a treatment. However, not enough people donated their glands to supply hormone for all those who needed it. Even more sadly, some of the pituitaries used for this purpose contained a deadly virus. Unknowingly, doctors had injected the virus into some children along with the hormone and they had died. Then came genetic engineering. In the l980's, scientists figured out a way to cause a bacterium to produce human growth hormone. This was an important breakthrough because the technique provided large quantities of safe hormone at a reasonable cost. Terry thought this new way to produce a human molecule sounded pretty neat. He was grateful that such a discovery allowed Julie access to a safe, reliable source of what her body could not itself produce and assured her fairly normal growth for the rest of her years. Questions: 1. Where does the growth hormone in your body originate? 2. How many nucleotides of DNA code for the production of human growth hormone? 3. What is the mode of inheritance of human growth hormone deficiency? 4. Name some advantages to using genetically engineered growth hormone over other sources of it. 5. How does one know if one has growth hormone deficiency? Setting the Stage Before we can understand how, through genetic engineering, bacteria can provide human growth hormone, we need to recall some things we know about bacteria and their DNA. E. Coli bacterium \ Enlarged Plasmid (with gene for Ampicillin resistance enclosed in brackets) NOTE WELL: throughout this exercise, the number of nucleotides used to represent genes, plasmids, etc. is far, far fewer than the actual number. This is done for the sake of convenience. In the drawing above is an E. coli bacterium and the plasmids it contains. One of these is the plasmid we will use to carry the human growth hormone gene into a new bacterium. It is shown enlarged. Note that it carries the gene for ampicillin resistance. 1. In the picture of the E. coli, label the plasmids and the large "loop" near the middle. 2. What are plasmids? 3. What bonds in the DNA of the enlarged plasmid are not shown? 4. Note that the enlarged plasmid contains a gene for ampicillin resistance. Normally, the antibiotic ampicillin will kill E. coli bacteria. If this gene for resistance is present, however, it will permit the bacterium containing it to "resist" the power of the ampicillin and continue to live in its presence. (Actually the gene enables the bacterium to synthesize a protein enzyme that inactivates ampicillin before it has a chance to kill the bacterium.) If the E. coli shown above were grown on agar containing ampicillin, what would happen to the bacteria? Would they be able to grow and reproduce or not? What about E. coli from which the plasmid shown had been removed? Explain. Splicing the Growth Hormone Gene into a Plasmid 1. The plasmid shown above in "flat" form is represented on a separate sheet of paper you have been given. Cut out the strip of DNA and tape its two ends together. You now have the same plasmid as shown above except in 3-D form. This is the bacterial DNA into which you will insert the human DNA (gene) that codes for growth hormone. 2. A section of human DNA is shown below. This section contains the gene for human growth hormone. CCCTGTATAAGCTTATGGCTACAGGCTCCCGGAC GAAGCTTA GGGACATATTCGAATACCGATGTCCGAGGGCCT GCTTCGAAT The m-RNA involved in the synthesis of human growth hormone was isolated and found to be: GAAUACCGAUGUCCGAGGGCCUGC Study the human DNA and locate the portion that is the gene for growth hormone. Underline or highlight this section. 3. Now that the plasmid DNA and the human gene DNA have been determined, the next step is to cut each one as a prelude to combining them. The growth hormone gene must be cut out of the human DNA and the plasmid (bacterial DNA) must be cut open before the human gene can be inserted. The scissors for doing the cuts are restriction enzymes. Below is a short list of a few of the enzymes available. Study the list carefully and select the enzyme that would be appropriate for cutting out the growth hormone gene from the human DNA and for cutting the plasmid open. If some "unwanted" bases are included in the human piece of DNA, no harm done. 4. Once you have selected your enzyme, you have identified the sites at which the two DNA's will be cut. Using your 3-D paper plasmid and the human DNA found on the separate sheet, mark IN PENCIL the sites at which the enzyme will cut. When you are sure the marks are in the correct positions, cut the ends with scissors. This will produce uneven ends which have unpaired bases. Study these ends and decide how the human DNA can be joined to that of the bacterial plasmid. Tape the pieces together. You now have "recombinant DNA." Discussion Questions: 1. Which enzyme is the correct one to use in this exercise? Explain why in detail. 2. In a real gene splicing, what kind of "tape" would be used? 3. What sticky ends have you made on the human DNA containing the growth hormone gene? What sticky ends have you made on the bacterial DNA (plasmid)? Compare the two. What do you observe? 4. Once the recombinant DNA you just constructed was in existence, the next step would be to insert it into a new bacterium. It would be very important to know whether any given bacterium had really taken in the recombinant plasmid and so acquired the ability to make growth hormone. What characteristic, in addition to the ability to synthesize human growth hormone, should any bacterium that took up the recombinant plasmid possess? (Hint: look back at the "flat" representation of the bacterial plasmid)? Explain why. 5. How could you test to see if the bacterium had indeed taken in the plasmid? 6. What exactly is recombinant DNA? Teacher Materials Answers to Background Questions: 1. 2. 3. 4. In the pituitary gland 573 (3 x 191) Autosomal recessive No danger of viral infection; larger quantities available; cheaper; virtually unlimited supply. 5. Growth is stunted. Becomes apparent in childhood if height is compared to average height of peers. Answers to Setting the Stage Questions: 1. The large loop near the center of the bacterium is its circular chromosome. The smaller circles are plasmids. 2. Plasmids are small loops of DNA found in the cytoplasm of bacteria. 3. Hydrogen bonds between bases are not shown. 4. If the E. coli shown were grown on ampicillin-containing agar, it would grow and reproduce because it contains a plasmid carrying the gene for ampicillin resistance. If the plasmid were removed, the bacterium would be killed by the ampicillin. Answers to Discussion Questions: The gene for human growth hormone that should be highlighted is: CTTATGGCTACAGGCTCCCGGACG 1. HindIII is the correct enzyme to use because it has cutting sites on both sides of the growth hormone gene and thus will cut it out intact. In addition, it has a cutting site on the plasmid and will thus "open" it for human gene insertion. 2. In real gene splicing, ligases are used to reattach the cut ends of DNA. 3. The sticky ends produced (A G C T T and T T C G A) are complementary to one another and should bind together. 4. The bacterium should possess ampicillin resistance since the plasmid we are using contains that gene. 5. You could attempt to grow the bacterium on agar containing ampicillin. If it had taken in the recombinant plasmid, it would grow successfully and reproduce. If not, it would not survive. 6. Recombinant DNA is DNA from two or more sources that has been "spliced" together. (This exercise is based on a lesson from: BSCS. Advances in Genetic Technology. l989. Heath.) TO BE COPIED FOR EACH STUDENT ON PAPER Human DNA (Containing Gene for Growth Hormone) C C C T G T A T A A G C T T A T G G C T A C A G G C T C C CG G A C G A A G C T T A G G G A C A T A T T C G A A T A C C G A T GT C C G A G G GC C T G C T T C G A A T TO BE COPIED FOR EACH STUDENT ON PAPER OF A DIFFERENT COLOR Plasmid DNA (Bacterial DNA) GGATCCTGACACCGGAACGTCAAGCTTCCC CCTAGGACTGTGGCCTTGCAGTTCGAAGGG TEACHER GUIDE: Bacterial Transformation with Mystery DNA This teacher guide is provided to give sample answers to questions. Most of the questions are open-ended, so students may have correct answers that aren't included in this guide. Finally, although the experiment is set up to yield one correct answer, there are variations in data between students. As long as students examine their data carefully and can justify their answers based on their data, that's science! Data are always right and there isn't necessarily a 'right answer'. Some questions to get you thinking about today’s lab: What can we use DNA for? We can use DNA to code for proteins, to identify individuals (like when solving a crime), or to do genetic engineering by inserting foreign DNA into an organism. How can DNA be put into bacteria? There are three strategies for getting DNA into bacteria, which you may or may not want to talk about with students. Bacteria can insert DNA into each other by CONJUGATION; viruses can insert DNA into bacteria by TRANSDUCTION; or we can insert DNA into bacteria using chemicals or electricity, which is called TRANSFORMATION. During this lab, we will 'poke holes' in the bacteria using chemicals, allowing the DNA to flow into the bacteria- this is called BACTERIAL TRANSFORMATION. Why would we want to put DNA into bacteria? We can use bacteria as little 'factories' to make more DNA, as they replicate, or to make protein, by transforming them with genes for proteins we want to make (like insulin). How can we tell DNA is in the bacteria once we put it there? The DNA we insert is shaped in a little circle, called a plasmid. We can put one, two, or more genes in a single plasmid. One of the genes in the plasmid codes for the ampicillin resistance protein, and thus will allow bacteria with the plasmid DNA to grow in the presence of ampicillin. What is a plasmid? What is ampicillin? A plasmid is a small circle of DNA. Ampicillin is an antibiotic; antibiotics prevent bacteria from growing. Ampicillin specifically prevents bacteria from making cell walls. Thus, ampicillin will not kill bacteria (that already have a cell wall), but will prevent bacteria from reproducing (because they can't make new cell walls). Materials for each group (students should work in groups of 4): Tube of mystery plasmid DNA (tubes numbered 1 or 2) One tube of E. coli bacteria (on ice) 1 LB agar plate 1 LB agar plate with ampicillin for DNA (3 black stripes) Q-tips or innoculation loops 1 tube of LB broth micropipette micropipette tips small transfer pipet large transfer pipet Materials to share: Water bath at 42°C ice trash containers/biohazard waste bag UV lights Protocol: 1. Pipette the DNA solution from your numbered DNA tube into your E. coli bacteria tube and label the tube 1 or 2 Be sure the students number the top of the tube with which DNA they added to the bacteria. 2. Put tubes on ice for 5 minutes. Why do you think we put the tubes on ice? To get the DNA into the bacteria, we have to poke holes in them with the chemical calcium chloride (CaCl2). CaCl2 will dissociate into Ca2+ and 2 Cl-, and the positive charge of the Ca2+ cancels the negative charge of the DNA, allowing it to cross the cell wall and cell membrane. The holes poked to allow the DNA in leaves the bacteria leaky. If we don't keep them on ice, they'll 'bleed' to death. 3. In the meantime, each group should get one LB agar plate and one LB agar + ampicillin plate. Write your initials and your section number on your plates. You will be plating bacteria with DNA on an LB agar plate and on an LB agar +ampicillin plate. Mark these two plates with the DNA number on your tube. Where is the best place to label your plates? What is the control you are conducting? Always label plates on the bottom. The lids can get mixed up accidentally, so if the bottoms are labeled, the label will stay with the bacteria (which are growing in the bottom). The LB agar plate will look for the existance of viable bacteria cells. If nothing grows on the LB agar plate then your bacteria are dead and you cannot expect transformation or growth on the LB agar + ampicillin 4. Put tubes directly from ice into 42°C water bath for 50 seconds. What do you think heating the tubes does? Heating the bacteria helps the holes seal shut. It's like giving the bacteria a fever, so they start to heal themselves. It's called heat shock. 5. Put DNA tubes directly from water bath onto ice for 2 minutes. 6. With a large transfer pipet, add 0.25 ml LB broth into your DNA tube ( bring solution to the first mark on the pipet.) Incubate at room temperature for 10 minutes. What is the LB broth for? The LB (Luria-Bertani) broth is both food and water for the bacteria. It will help make the bacteria healthy after poking holes in them, shoving DNA into them, and giving them a 'fever' to help them heal. 7. With the small transfer pipet, pipet 0.15 ml (about half) from your DNA tube onto your LB agar plate and 0.15 ml onto your LB agar + ampicillin plate. 8. Spread the solutions on the plates using a sterile Q-tip. Be careful not to stab the agar. The same Q-tip can be used for both plates as long as it is kept sterile (don't touch it to anything!). 9. Put your plates in a 37°C incubator for 24 hours. Why 37°C? These bacteria are E. coli, which grow in human intestine. Because they grow in humans, they will grow best at human body temperature (37°C). You could ask students to calculate what 37°C is in Fahrenheit, or what 98.6°F is in Celsius. Challenge for Day 2: What is ampicillin and why do you think we used it in some of the plates? Ampicillin is an antibiotic (described above). We use it in some of the plates to see if the plasmid DNA is there (bacteria will only grow on ampicillin if they have the ampicillin resistance gene). We leave it out of some of the plates to make sure the bacteria can grow if there is no ampicillin present (control). What do you expect to grow on each of the plates? LB agar bacteria + DNA LB agar + ampicillin (3 black stripes) Would expect see Would expect to see colonies, could bacterial lawns count the number of colonies Do you expect to see any difference in bacterial growth on the two plates? Yes What do you think would have grown on these plates if no DNA had been added to these bacteria? bacteria (without DNA) LB agar LB agar + ampicillin (3 black stripes) Do you expect to see any difference in bacterial growth on the two plates? Would see bacterial lawns Would see nothing. Yes Day 2: What do you see on your plates? Students should look at their plates to see what they look like. They may see any of three things: - little white dots, called colonies (each colony starts as a single bacterium because they reproduce asexually, so each colony is like a house with a family of related bacteria) - a big smear, called a 'bacterial lawn' (this is like a city of bacterial houses, where there are so many colonies that we can't tell them apart any more) - nothing, where no bacteria are growing (ampicillin may kill all of the bacteria or the students may not have spread their bacteria around the plate correctly, e.g. they may have put it on the lid-don't laugh! it happens!) Now look at your plates with UV light. What do you see? Fill in the table with your data and the class datawhat does each group (#1 and 2) see on each type of plate? Mystery DNA (number) LB agar LB agar + ampicillin (3 black stripes) Based on the phenotype, what is the DNA? #1 students should see colonies, they should count students should see the number of bacterial lawns colonies they see and record this number in their data table the bacterial phenotype is GROWING and GLOWING, so the DNA must be both the ampicillin resistance gene and the luciferase gene #2 students should see colonies, the bacterial they should count phenotype is the number of students should see GROWING, so the colonies they see bacterial lawns DNA must be the and record this ampicillin number in their resistance gene data table What does each DNA type (1 and 2) allow the bacteria to do? #1 allows the bacteria to GROW and GLOW #2 allows the bacteria to GROW What would the bacteria do on each type of plate (LB agar and LB agar + ampicillin) if you added no DNA? The bacteria would form a lawn on the LB agar plate. On the plate with ampicillin, the bacteria wouldn't grow or glow (you would see nothing) because they wouldn't have either the ampicillin resistance gene or the Green Fluorescent Protein (GFP) gene. After the students fill in their data tables, I usually talk about the results with them in this order. I ask the question and help them brainstorm the answers. After this discussion, students should be able to tell what each DNA type allows the bacteria to do. 1. Where do the bacteria grow best? On the LB agar plates, because it provides them with food, water, and shelter. Also, the plates were stored at 37°C, which is their favorite temperature. 2. If the bacteria can grow on LB agar so well, why didn't they grow on LB agar with ampicillin? This is an opportunity to talk about what ampicillin is. The bacteria aren't growing on LB agar with ampicillin because ampicillin is an antibiotic. 3. If ampicillin is an antibiotic, why doesn't it completely stop the bacteria from growing? Because of the DNA we added, the bacteria are now resistant. In fact, the DNA we added is called the 'ampicillin resistance gene'. 4. Do both DNA types have the ampicillin resistance gene? They both should grow, thus they both have the ampicillin resistance gene. 5. What would happen if no DNA is added? The bacteria could not grow in the presence of ampicillin if they do not contain the ampicillin resistance gene. 6. #1 DNA contains a gene that codes for Green Fluorescent Protein (GFP) , which is why #1 bacteria GLOW. What are #1 bacteria able to do? GLOW AND GROW. What are #2 bacteria able to do? GROW. 7. Why do you want to do this kind of GENETIC ENGINEERING experiment? Say you know someone who is diabetic. They have to take the protein insulin to be healthy. We can put the insulin gene into a plasmid and then insert that plasmid into bacteria. These bacteria will make insulin for diabetics to use. Before genetic engineering was invented, we used to have to kill pigs to get their insulin. Now we can use bacteria to make human insulin (instead of using pig insulin, especially important if someone is allergic to pigs) and we don't have to kill any animals to do it From University of Arizona BIOTECH Project http://biotech.biology.arizona.edu/labs/transformation(TG).html STUDENT GUIDE: Bacterial Transformation with Mystery DNA Some questions to get you thinking about today’s lab: What can we use DNA for? How can DNA be put into bacteria? Why would we want to put DNA into bacteria? How can we tell DNA is in the bacteria once we put it there? What is a plasmid? What is ampicillin? Materials for each group (students should work in groups of 4): Tube of mystery plasmid DNA (tubes numbered 1 or 2) One tube of E. coli bacteria (on ice) 1 LB agar plate 1 LB agar plate with ampicillin for DNA (3 black stripes) Q-tips or innoculation loops 1 tube of LB broth micropipette micropipette tips small transfer pipet large transfer pipet Materials to share: Water bath at 42°C ice trash containers/biohazard waste bag UV lights Protocol: 1. Pipette the DNA solution from your numbered DNA tube into your E. coli bacteria tube and label the tube 1 or 2 2. Put tubes on ice for 5 minutes. Why do you think we put the tubes on ice? 3. In the meantime, each group should get one LB agar plate and one LB agar + ampicillin plate. Write your initials and your section number on your plates. You will be plating bacteria with DNA on an LB agar plate and on an LB agar +ampicillin plate. Mark these two plates with the DNA number on your tube. Where is the best place to label your plates? What is the control you are conducting? 4. Put tubes directly from ice into 42°C water bath for 50 seconds. What do you think heating the tubes does? 5. Put DNA tubes directly from water bath onto ice for 2 minutes. 6. With a large transfer pipet, add 0.25 ml LB broth into your DNA tube ( bring solution to the first mark on the pipet.) Incubate at room temperature for 10 minutes. What is the LB broth for? 7. With the small transfer pipet, pipet 0.15 ml (about half) from your DNA tube onto your LB agar plate and 0.15 ml onto your LB agar + ampicillin plate. 8. Spread the solutions on the plates using a sterile Q-tip. Be careful not to stab the agar. 9. Put your plates in a 37°C incubator for 24 hours. Why 37°C? Challenge for Day 2: What is ampicillin and why do you think we used it in some of the plates? What do you expect to grow on each of the plates? LB agar LB agar + ampicillin (3 black stripes) Do you expect to see any difference in bacterial growth on the two plates? bacteria + DNA What do you think would have grown on these plates if no DNA had been added to these bacteria? LB agar LB agar + ampicillin (3 black stripes) Do you expect to see any difference in bacterial growth on the two plates? bacteria (without DNA) Day 2: What do you see on your plates? Now look at your plates with UV light. What do you see? Fill in the table with your data and the class datawhat does each group (#1 and 2) see on each type of plate? Mystery DNA (number) #1 LB agar LB agar + ampicillin (3 black stripes) Based on the phenotype, what is the DNA? #2 What does each DNA type (1 and 2) allow the bacteria to do? From University of Arizona BIOTECH Project http://biotech.biology.arizona.edu/labs/transformation.html Critical Review and Analysis of Articles Student:_______________________________ Article Title: Website Address: Date:_____________ Questions: Questions Perspective Assumptions Information Concepts Inferences Implications Town Hall Meeting Prompt Introduction: Now that we have learned about the definition of a GMO and have identified the prominent stakeholder’s roles in the GMO debate, you will now be asked to present this information in the setting of a Town Hall meeting Assignment: You will be assigned a stakeholder role or as a mediator of the Town Hall Meeting. You will have two days to research your stakeholder position, not your own position, with the idea that you will be a speaker at the Town Hall Meeting After all stakeholders have testified, their will be a discussion with the townspeople. Assessment: You will be assessed using the provided rubric. Senate Hearing Prompt Introduction: Now that we have learned about the definition of a GMO and have identified the prominent stakeholder’s roles in the GMO debate, you will now be asked to present this information in a mock Senate Committee Hearing. Assignment: You will be assigned a stakeholder role or as a member of the Senate Committee representing a state. You will have two days to research your stakeholder position, not your own position, with the idea that you will be a witness in a Senate Hearing on GMOs. If you are a senator, you will have to research your state’s major constituents’ position on GMOs. You will have to accurately represent those constituents during the hearing. After all stakeholders have testified, their will be a discussion with the end result being a written suggested policy that the U.S. should take regarding GMOs. Assessment: You will be assessed using the provided rubric. Presentation Rubric for Senate Hearing or Town Hall meeting 5 - Excellent 4 - Strong 3 - Proficient 2 - Developing 1 - Incomplete Content 5 4 3 2 1 Position clearly made 3 arguments show thought and support to position Evidence is substantial in relating/supporting arguments Answers to questions complete and accurate (as possible) Audience 5 4 3 2 1 Language, organization, and attitude appropriate for hearing Appropriately responds to questions Organization 5 4 3 2 Position and stakeholder identified in beginning of testimony 3 supporting arguments follow a logical progression Supporting details clearly support the arguments Speech Mechanics 5 4 3 2 1 1 Voice is clear Wording is concise and accurate Eye contact maintained with audience and/or subcommittee members Shows enthusiasm for position Representation of Stakeholder 5 4 3 2 1 Position accurately represents stakeholder position Position and supporting details indicates understanding of stakeholder position No evidence of personal bias or personal opinion Answers to questions aligned with stakeholder position. Ethical Decision-Making Model (based on the Hastings Center Model) I. What is the ethical question? II a. What relevant information do I already know about this issue? II b. What other information do I need to find out? III. Who has a stake in this decision, and why? IV a. What are my possible options? IVb. Evaluation of the options (pros and cons, ethical principles supported by each) V. What is my decision, and how do I justify it? VI. How should I act on my decision? Assignment—Position Paper Now that you have had a chance to learn about genetically modified crops and to hear many viewpoints about their potential uses, dangers, and values, it is time for you to answer the ethical question, “Should we grow genetically modified crops?” Answer this question in a thoughtful essay. The essay should include a clear statement of your personal position on this issue and a justification of your decision. When you go through the reasons that support your decision, you should anchor them in the ethical principles and theories we have discussed. You should also discuss other possible positions you considered, and explain why you think those positions are not a good as the one you chose. Grammar, spelling, and presentation (neatness) will be a part of your grade. Look at the rubric for more specific information on how your essay will be evaluated. This assignment is due at the beginning of class on ____________________________. Scoring Rubric—Position Paper Quality of Writing (10 points possible) Writing conventions (grammar, punctuation, spelling, etc) Clarity of thought (organization and reasoning) Eloquence (style and voice) 0 1 2 3 0 1 2 3 4 5 0 1 2 Required Elements (15 points possible) Statement of position (thesis statement) At least three supporting arguments Supporting arguments tied to ethical theories Alternate choice(s) discussed Reasons for not selecting alternates explained Reasons for not selecting alternates tied to ethical theories 0 0 0 0 0 0 1 1 1 1 1 1 2 2 2 2 2 3 3 3 3 Position Paper Rubric (Elise will send in writing rubric used at her school) Internet Resources for Teachers (Compiled July 2003) GMOs: The significance of gene flow through pollen transfer http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www .pdf Genetically Modified Foods: Harmful or Helpful? http://www.csa.com/hottopics/gmfood/overview.html Controversies Surrounding the Risks and Benefits of Genetically Modified Food http://scope.educ.washington.edu/gmfood/ New Scientist: Latest Articles GM Foods http://www.newscientist.com/hottopics/gm/ European GMO Campaign http://www.foeeurope.org/GMOs/Index.htm How stuff works: What are genetically modified (GM) foods? http://www.howstuffworks.com/question148.htm Human Genome Project Information: Genetically Modified Foods and Organisms http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html GMO Food News http://www.connectotel.com/gmfood Transgenic Crops: An Introduction and Resource Guide http://www.colostate.edu/programs/lifesciences/TransgenicCrops/ Pew Initiative on Food and Biotechnology http://pewagbiotech.org/ Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs) http://www.esi-topics.com/gmc/papers/a1.html American Society of Plant Biologists: Publications (Articles from the publication “Genetically Modified Crops: What Do the Scientists Say?”) http://www.aspb.org/publications/plantphys/gmcpub.cfm Internet Resources for Teachers (Compiled July 2003) GMOs: The significance of gene flow through pollen transfer http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www .pdf Genetically Modified Foods: Harmful or Helpful? http://www.csa.com/hottopics/gmfood/overview.html Controversies Surrounding the Risks and Benefits of Genetically Modified Food http://scope.educ.washington.edu/gmfood/ New Scientist: Latest Articles GM Foods http://www.newscientist.com/hottopics/gm/ European GMO Campaign http://www.foeeurope.org/GMOs/Index.htm How stuff works: What are genetically modified (GM) foods? http://www.howstuffworks.com/question148.htm Human Genome Project Information: Genetically Modified Foods and Organisms http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html GMO Food News http://www.connectotel.com/gmfood Transgenic Crops: An Introduction and Resource Guide http://www.colostate.edu/programs/lifesciences/TransgenicCrops/ Pew Initiative on Food and Biotechnology http://pewagbiotech.org/ Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs) http://www.esi-topics.com/gmc/papers/a1.html American Society of Plant Biologists: Publications (Articles from the publication “Genetically Modified Crops: What Do the Scientists Say?”) http://www.aspb.org/publications/plantphys/gmcpub.cfm Internet Resources for Teachers (Compiled July 2003) GMOs: The significance of gene flow through pollen transfer http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www .pdf Genetically Modified Foods: Harmful or Helpful? http://www.csa.com/hottopics/gmfood/overview.html Controversies Surrounding the Risks and Benefits of Genetically Modified Food http://scope.educ.washington.edu/gmfood/ New Scientist: Latest Articles GM Foods http://www.newscientist.com/hottopics/gm/ European GMO Campaign http://www.foeeurope.org/GMOs/Index.htm How stuff works: What are genetically modified (GM) foods? http://www.howstuffworks.com/question148.htm Human Genome Project Information: Genetically Modified Foods and Organisms http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html GMO Food News http://www.connectotel.com/gmfood Transgenic Crops: An Introduction and Resource Guide http://www.colostate.edu/programs/lifesciences/TransgenicCrops/ Pew Initiative on Food and Biotechnology http://pewagbiotech.org/ Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs) http://www.esi-topics.com/gmc/papers/a1.html American Society of Plant Biologists: Publications (Articles from the publication “Genetically Modified Crops: What Do the Scientists Say?”) http://www.aspb.org/publications/plantphys/gmcpub.cfm From University of Arizona BIOTECH Project http://biotech.biology.arizona.edu/labs/bt_cottonSG.html Ecological and Evolutionary implication of Bt cotton. Measurement of a single gene difference in two cotton plants by PCR BIG IDEA Genetic Engineering has allowed agriculture to move into a new dimension of artificial selection of desirable traits for crops. Since the beginning of agriculture, humans have selected for desirable traits in their crops, these traits tend to not be good for the survival of the plants, hence artificial and not natural selection. The new ability to add and remove genes from plants, agriculture now does not need to wait for the plant to evolve the gene during random mutagenesis of its own genome. Plants might not be able to evolve some traits due to limitation of its DNA sequences. For example, we may be able to grow a tail because it is in our genetics, with a simple mutation we may grow a tail, but we do not have the genetics or the ability to evolve suction cups on the bottom of our feet, such as insects have. Never the less, Spiderman is still an amusing fantasy. This activity will allow you to investigate the single gene difference of a genetically modified organism, Bt cotton. You will discuss the ecological and evolutionary implications of having cotton produce Bt toxin. Bt toxin is a chemical made by a gene found in a bacteria that lives in the soil, Bacillus thuriniensis. The chemical is toxic to some insects that happen to devour agricultural crops. Insertion of Bt gene into these crops has resulted in a dramatic decrease in the amount of pesticides used to grow these crops. Let us look at two cotton plants,do they look different from each other? If so how and what implications can you make from these observations? You will analyze the DNA of these two plants and determine which one has the gene for Bt cotton. Keeping in mind what a cell does when it replicates DNA, make a list of steps that you think would be necessary for the replication of a single gene by Polymerase Chain Reaction. Do you think that cotton could evolve the ability to produce the Bt toxin on its own? Why or why not? DNA extraction from cotton leaf Materials/Equipment Needed For the class - Heating Block - Pipetman - Pipet tips - Sigma XNAP Extract N Amp for Plants Kit - Bt and nonBt cotton - 1.5 ml tubes - 70% Ethanol - Hole punch - Forceps - Vortex 1. Rinse the paper punch and forceps in 70% ethanol prior to use and between handling different samples. 2. Punch a 0.5 to 0.7 cm disk of leaf tissue into a 1.5 ml tube using a hole paper punch. If frozen plant tissue is used, keep the leaves on ice while punching disks. 3. Add 100 µl of Extraction Solution to the collection tube. Close the tube and vortex briefly. Make sure the disk is covered by the Extraction Solution. 4. Incubate at 95 °C for 10 minutes. Note that leaf tissues usually do not appear to be degraded after this treatment. 5. Add 100 µl of Dilution Solution and vortex to mix. 6. Store the diluted leaf extract in the refrigerator. It is not necessary to remove the leaf disk before storage. PCR amplification Materials/Equipment Needed For the class - Thermocycler - Micropipet and tips - 0.2 ml PCR microcentrifuge tube - Forward and reverse Bt primers - Extract-N-Amp PCR ReadyMix For each reaction add the following reagents to a thin-walled 0.2 ml PCR microcentrifuge tube: Water, PCR reagent 3µl Forward primer 1 µl Reverse primer 1 µl (these 5 µl of primer mixture are already added to the 0.2 ml PCR tube) Leaf disk extract 5µl Extract-N-Amp PCR ReadyMix 10 µl Total volume 20 µl Mix gently by pipetting Place tubes into thermocycler and select the BT1 program which has the following parameters: - Initial Denaturation 94 °C 5 minutes - Denaturation 94 °C 30 seconds - Annealing 44°C 1minutes - Extension 72 °C 1minutes - Final Extension 72 °C 5 minutes - Hold 4 °C 24 hours The amplified DNA is ready for analysis by gel electrophoresis. Electrophoresis of your PCR reactions Materials/Equipment Needed - Electrophoresis apparatuses, electrodes, and power supplies - Micropipet - Micropipet tips - Loading dye - 0.8% agarose gel - Molecular weight markers o Water bath at 55°C or hot plate -Thermometer for water bath - TAE buffer - 0.025% Methylene Blue - Staining tray - light box Procedure Pouring an agarose gel 1. Get your electrophoresis apparatus and seal both ends of the gel tray with stoppers. 2. Make sure one comb is in place at the negative electrode (black end of the gel). 3. Pour melted agarose into the gel space until the gel is about 5 mm deep. Let the agarose harden, which should take 5-10 minutes. Don’t touch/move your gel until it’s hard. In the meantime, prepare your PCR reactions for electrophoresis. Electrophoresis of your PCR reactions 1. Using the micropipet with a clean tip, pipet 4 µl gel loading solution into your PCR reaction tube. You will load both your PCR reactions and standard DNA markers sample into the gel. A standard DNA marker has a bunch of different sized pieces of DNA so you can compare it to the DNA from your PCR reaction to figure out what size piece it is. 2. Draw a pictureof your gel and label in which wells you will load which samples (PCR reaction(s), DNA marker). 3. When your gel has hardened, remove the stoppers. 4. Load 20 ml of your PCR sample into a well - be sure you keep track of which samples you're loading in which wells. Load 10 ml of DNA marker into a well. 5. Pour TAE buffer carefully so it fills the electrophoresis apparatus and just covers the gel. 6. Run that gel! Plug the electrodes into your electrophoresis apparatus (red to red, black to black), being careful not to bump your gel too much. 7. Plug the power source into an outlet and set the voltage to about 100 V (max = 120 V). 8. Let the gel run until the dye migrates about 1/2 through the gel (about 20-25 minutes). 9. Turn off the power supply, disconnect the electrodes, and remove the top of the electrophoresis apparatus. 10. Carefully remove the gel. The gel can be wrapped in plastic wrap and stored in the refrigerator or placed it in the staining tray for DNA staining. Staining gels to examine PCR reactions 1. Place gel in staining tray 2. Add Methylene Blue 3. Stain for about 20 minutes. 4. Carefully place the gel on the mini light view your gel. 5.Draw a picture of your gel. Analysis What do you see on your gel? Is the DNA the same in the two plants? What do you think the sequence of this DNA would be if you were to sequence it? Because a genetic change in an organism is a relatively permanent change, how do you think this would affect the development of insect resistance compared the more conventional method of spraying against insects? As with all technology in our society, there are good and bad points, as an individual in this world you need to be able to weigh the good versus the bad. Make a list of the good and bad parts of Genetically Engineered crops, and weigh the dangers versus the benefits (feel free to include food stuff in this section). Based on what you know about random mutation of genes, speculate what will happen to a large group of insects trying to survive in the presence of plants producing Bt toxin.