Download Molecular Basis of Heredity--ST03 1.2.7

GMOs: Should We Grow Them?
Authors:
Cathy Anne Ferbrache-Garrand
Elise Cooksley
Susan Wierenga
Tim McFaul
Introduction:
With the advance in biotechnology, citizens are beginning to address some of the
ethical concerns surrounding this technology. One such technology which
impacts human life, knowingly or not, is the technology to genetically modify
organisms (GMOs) for human consumption. This technology raises many
questions and concerns regarding the ethics of all those involved. The question
that this unit addresses is whether or not we should grow crops and the question
of U.S. policy regarding GMOs. Through the use of introductory activities and
labs students will gain an understanding of the definition of a GMO. Students
will explore the ethical concerns from a variety of perspectives (stakeholders) in
independent research and presentations in the form of either a Senate Hearing
and/or a Town Hall meeting. Finally the students will have the opportunity to
synthesize, evaluate, and advise, in a thoughtful, personal written position paper.
Objectives:
To demonstrate understanding of the basic principles behind genetic engineering
To evaluate various viewpoints concerning the use of GE crops using an ethical
model
To communicate a reasoned position concerning the use of GE crops both orally
and through a written paper
Relevant Courses:
Biology, Biotechnology, Environmental Science, Earth Science
This curriculum would also work well integrated into a social studies unit concerning
policy development/representative government.
Grade Level: 7-12
Washington State EALR’s:
Systems Approach--ST01, STI02, STI03, & STI04
1. Analyze systems, including inputs and outputs, as well as subsystems.
Structure and Organization of Living Systems--ST03 1.2.6
6. Understand that specific genes regulate the functions performed by structures within
the cells of multi-cellular organisms.
Molecular Basis of Heredity--ST03 1.2.7
7. Describe how genetic information (DNA) in the cell is controlled at the molecular
level and provides genetic continuity between generations.
Communicating--IN05 2.1.5
5. Research, interpret and defend scientific investigations, conclusions, or arguments;
use data, logic, and analytic thinking as investigative tools; express ideas through
visual, oral, written, and mathematical expression.
Identifying Problems --DE01 3.1.1
1. Study and analyze challenges or problems from local, regional, national, or global
contexts in which science and technology can be or has been used to design a
solution.
Relationship of Science and Technology--DE05 3.2.5
2. Analyze how the scientific enterprise and technological advance influence and are
influenced by human activity, for example societal, environmental, economical,
political, or ethical considerations.
I. Introductory Activities: Day One
Materials Needed
Computer Lab
Foods containing GMOs
Part One
Introduce the topic of genetically modified organisms (GMOs) by asking students to
show how they feel about the value of GMOs to the world food supply.
Put signs in each corner or along a wall of the classroom reflecting their possible
opinions:
Valuable/Necessary
Useful but needs to be regulated
Dangerous/Harmful
Undecided/Don’t Know
Students should record their opinion with a short reason in their notebooks. At the end of
the unit they will revisit this opinion to see if it has changed.
Part Two
Prior to class tell students to bring in one food item or the packaging from a
product they commonly consume or bring in a variety of foods. Corn chips and foods
containing soy, cottonseed oil, or canola would be good representatives of common
GMOs found at the market.
Place food items around the classroom and ask students to read the ingredient
labels to predict/record in their notebooks which foods they think may contain GMOs.
Students then conduct an internet search on foods that contain GMOs. In their notebooks
they should record how common the GMO versions are found in food (some sites will
give percentages) and the website addresses of sites used.
II. Background Science: Time allotment dependent on activities
Prior Knowledge: DNA structure, Plasmids and Bacterial Transformation
This section is designed to give students a background in the scientific principles and
techniques used in creating a genetically engineered plant. There are several options that
depend on the resources and time available.
Web Activity (one period): Using the PBS Harvest of Fear website at
http://www.pbs.org/wgbh/harvest/engineer/ students will work through the Transgenic
Manipulation activity under the Engineer A Crop section with the worksheet provided.
(Worksheet found in worksheet folder)
If student computers are not available, the information can be printed by selecting the
HTML version of this activity and students can work through the worksheet with
photocopies of the procedure.
Simulation (one period): Recombinant paper plasmids (Chapter 14) from Recombinant
DNA and Biotechnology: A Guide for Teachers by Helen Kreuzer Phd , Adrianne
Massey Phd or Simulation of Gene Splicing from Access Excellence
http://www.accessexcellence.org/AE/AEPC/WWC/1994/simulation_gene_splicing.html
These activities show students how genes are spliced into a vector plasmid using
restriction enzymes. (See Lab folder for copy)
Lab Experience (two periods): Bacterial Transformation Lab
Teacher and student guide for transformation lab from University of Arizona Biotech
Project http://biotech.biology.arizona.edu/ is included in this lesson. A similar lab is also
available from the FHCRC Science Education Partnership
http://www.fhcrc.org/education/sep/info_teach/ .
(See Lab folder for copies)
Reading
May 2002 National Geographic: Food: How Altered? By Jennifer Ackerman
III. Community Think Tank
Students become familiar with what genetically modified food is and how cells are
altered from their participation in interactive activity from the Harvest of Fear website
and doing the simulation. After reading the National Geographic article students will be
able to conduct a discussion identifying the stakeholders and define the purposes of our
inquiry.
Purpose of Inquiry (As adapted from Paula Fraser):
To search out and examine all the facts and points of view with critical thinking to
advance our knowledge and understanding
To understand the role of ethics in food production
To increase our knowledge base and develop critical thinking skills in order to make a
well reasoned decision as citizens in a democratic society
To share our findings with the local paper and our representatives.
Question to investigate: Should we grow genetically modified food?
Perspectives/Stakeholder/Interest/Positions/Values:
Students are to read several articles from their assigned/chosen stake holder’s point of
view. They are to fill out the Critical Review of Articles form (See Lab folder for copy)
for each article and be prepared to submit them for peer review/teacher evaluation.
Possible stakeholders:
Agribusiness
Monsanto, Dupont and other corporations are major players in GM foods for profit. They
have a considerable investment in time and money in research and take the greatest
financial risks. These corporations expect to gain profits from patents on genetically
modified foods as well as control market share.
The Norman Borlaug Heritage Foundation
www.normanborlaug.org
Proposed benefits include: increased yield per acre, reduced water needs, less use of
pesticides, herbicides, and fertilizers, plants have increased drought resistance, food has
longer shelf life, lower calories, added vitamins, lower saturated fats, higher nutritional
value, vaccine delivery.
GMOs are marketed as the answer to global hunger.
They object to product labeling for fear that this will alarm consumer, that the label might
denote that something is wrong with the food, but then argue that the food is safe,
marginalizing consumer’s concerns.
Environmentalist
GMOs may cause harm to soil by increasing the chance for erosion and the loss of
beneficial insects, may introduce a new wave of pesticides to control GM crops that lose
resistance to a disease, may effect water use, increases vulnerability to disease with
monoculture farming.
Food and drug Administration
As the regulatory body for the agribusinesses are reluctant to restrain the growth of this
economy. They believe there are fewer safety concerns and more benefits. For example,
in Europe and the developing world where malnutrition is problem, the FDA promotes
the export of GM products. In countries where the population is reliant on one crop which
doesn’t provide the vitamins needed to support the population, “golden rice” could
provide Vitamin A. The loss of 2 million children to death and 500,000 to blindness is a
result of Vitamin A deficiency.
Vitamins and vaccines can be added to tomatoes and bananas to increase health of
individual, reduce costs in manufacture, storage, delivery, and administration the vitamin.
Medical community
Dr. Mae-Wan-Ho – http://www.i-sis.org.uk
No long-term studies have been made to evaluate the outcome of eating GM. It’s
incredibly simplistic and wrong headed to believe that altering a gene in a complex
interdependent organism wills top there. The transgenic could have latency period for
carcinogenic or toxic effects. GMOs could alter immune systems, metabolic balance, uset
complex biochemical relationships.
Sustainable Farmers and farmers of developing countries.
Desire to retain their autonomy and independence in food production. They wish to avoid
crop monocultures being created by corporate ownership of seed and retain diversity of
crops that currently thrive in different climatic and environmental condition like drought.
No way to avoid transgenic contamination since the wind blows pollen to neighboring
fields. Because of this GM and non GM crops cannot co-coexist which may bring the
demise of any organic farming.
Farmers
The case of Monsanto’s suit against Percy Schmeiser for an interesting example of a
corporation using patent laws to control the use of genetically modified plant pollen
which was carried by the wind to a neighboring field.
Citizen
Most citizens are suspicious of the use of GMOs in food production. The emerging
consensus is to have accurate labeling on all food products, in order to give consumers
the right to choose.
People want the right to choose whether they are ingesting food that has been genetically
altered. Not identifying GM foods on a label violates a person’s right to chose and the
right of advised consent. A fundamental right of humans is to have control over the food
they eat and feed their children. The Campaign to Label Genetically Engineered Foods
www.thecampaign.org/ -
People with allergies and different susceptibilities to food
People with food allergies, for example peanut butter, may be susceptible to genetically
altered food. GM foods could alter natural bacteria in our gut. The natural bacteria in our
gut could become resistant to antibiotics.
Agri-business has shifted focus from petro chemical to genetically altered food
History has set a poor precedent for agri-business. The industry has not been forthcoming
with information. There has been along history of suppression and misrepresentation of
scientific evidence. Transparency of their processes and decision making is needed to
gain trust in the safety of GMOs.
View video Harvest of Fear and fill out worksheet
(Worksheet found in “Feast Or Famine? Are GMO’s the Answer” Lesson Plan)
This film and the accompanying worksheet creates some certainty that students have a
common base of knowledge and clarifies key concepts and vocabulary. After viewing the
film, ask the students if any stake holders have been left out or are under-represented.
IV. Presentation (Adapted from Paula Fraser)
The instructor may choose to conduct a town hall meeting or senate committee meeting.
Students are to take notes on each of the witnesses/participants in order to ask appropriate
questions and to write their final position paper.
*See Presentation Rubic for evaluating both Town Hall and Senate Hearing
Town Hall Meeting (time: 1-2 days depending on identified stakeholders and size of
class)
Purpose to inquire on growing genetically modified organisms to seek, look at ,and
analyze all perspectives with critical thinking skills to increase knowledge and promote
understanding to understand the role of ELSI – Ethical, Legal, and Social implications of
Scientific research
To learn to make informed decisions as citizens
To share research finding with community members
To make an informative decision regarding growing genetically modified organisms.
Inquiry Question
Should we grow genetically modified organisms?
Perspectives/Interests/Stakeholders/Positions
Except for the Town Hall mediator all other stakeholders will have been generated by
students. All stakeholders to be assigned by a teacher designed method. (Students should
not necessarily choose the position to which they are personally aligned. Students will be
given 2 days to research their stakeholder position including the mediator
Format
Introduction by Mediator (2 min)
Testimonies (2 min ea.(not including questions))
Introduction
Name
Affiliation
Position
3 Statements in support of Position
Brief Concluding Statement
Questions from mediator and town residents
Discussion between town hall participants and town hall residents and mediator.
Mock Senate Hearing ( could be integrated in a government/social studies class)
Purpose to inquiry on growing genetically modified organisms to seek, look at ,and
analyze all perspectives with critical thinking skills to increase knowledge and promote
understanding to understand the role of ELSI – Ethical, Legal, and Social implications of
Scientific research
To learn to make informed decisions as citizens
To share research finding with community members
To write a policy statement that addresses the inquiry question
Inquiry Question
What should be the U.S. policy toward genetically modified organisms?
Perspectives/Interests/Stakeholders/Positions
Except for the Senate board members all other stakeholders will have been generated by
students. All stakeholders to be assigned by a teacher designed method. (Students should
not necessarily choose the position to which they are personally aligned. Students will be
given 2 days to research their stakeholder position including being a representative from
a particular state. (Note: This could be altered to be a state subcommittee; teachers may
also assign a different set of states for the subcommittee.)
Senators:
Chairperson
Washington
Kansas
New York
California
Texas
Format
Introduction by Chairperson (2 min)
Testimonies (2 min ea.(not including questions))
Introduction
Name
Affiliation
Position
3 Statements in support of Position
Brief Concluding Statement
Questions from committee
Discussion between committee members, audience, and witnesses
Final written policy recommendation by committee to be submitted to the National
advisory board on bioethics. Based upon the Hastings Decision model.
V. Assessment
Overview
The unit has been following the general steps of the six-step ethical decision-making
model developed by the Hastings Center (see generic model). In considering the ethical
question “Should we grow genetically modified crops?” the students have gathered
information and identified stakeholders and their values. The final steps include
considering different possible decisions, evaluating them, deciding which option they
think is best and taking action. The main assessment piece will be a written position
paper justifying their choice.
Assignment
After the mock congressional hearing/town hall meeting, assign the position paper (see
sample assignment description). If students have no background in ethics, this would be
an appropriate time to go over important ethical principles (justice, respect for autonomy,
beneficence, non-malfeasance, and care) and ethical theories (outcome-based/utilitarian
or duty/rule-based), and how to use them to support an ethical decision (showing that the
pros outweigh the cons for an outcome-based approach, or showing how the decision
promotes ethical principles or virtues for a duty/rule-based approach). If students have
already been introduced to ethics, a review would be appropriate.
As a class, go over details of the assignment, and work through examples of decisions a
student could select, and how that decision could be supported using ethical principles or
theories. Remind students that they are now stepping out of their “stakeholder” character
and are writing their papers as themselves. Papers may be assigned as homework, or as
an in-class assignment. Two possible grading rubrics are included.
VI. Closing Activities
Revisit the introductory activity. Have the students look back in their lab notebooks and
see what position they chose and their reasons for their choice. Ask them what their
position is now. If they changed, what influenced them? If they did not change, ask
them to explain why. Have them write their reflections in their lab notebooks.
The last step of the Hastings model is to take action on your decision. One possible
action would be to have students rework their position papers into letters, and send them
to elected officials or government agencies that make decisions. Alternatively, copies of
the class essays could be collected into a booklet that could be sent to the same places.
Selected letters could be sent to publications (as letters to the editor) or included in
district or school newsletters.
Attachments
-generic Hastings Model handout
-assignment sheet for paper
-two possible rubrics for grading paper
Web Activity: Engineer a Crop
Read the introduction by Rick Groleau and use the Selective Breeding and Transgenic
Manipulation activities to answer the following questions.
1. How would you produce a crop with a specific trait using selective breeding?
2. How effective and efficient is selective breeding? Explain your answer.
3. How do you make a plant transgenic?
4. Explain the steps you used in making the tomato crop insect resistant?
5. How effective and efficient is transgenic manipulation? Explain your answer.
6. Name two advantages and two disadvantages to transgenic manipulation.
Simulation of Gene Splicing
Judith Averbeck, SND
1994 Woodrow Wilson Collection
Introduction
This exercise may be used as a prelude to a "wet" lab or as a substitute for such a lab. It
correlates well with colony transformation labs. It is recommended for students who have
difficulty with the abstractions that genetic engineering involves. Students need to have
some knowledge of bacterial morphology, DNA structure, restriction enzymes, etc.
before doing this exercise. The teacher may want to ask the students to do the background
reading and its accompanying questions before the lab period.
Materials



Paper of two colors onto which the DNA sequences have been copied
Scissors
Transparent tape
STUDENT MATERIALS
Human Growth Hormone
Background
Terry's biology class had been studying human inheritance and were now discussing
genetic defects. When Terry heard about dwarfs and midgets, he began to think about his
sister, Julie, who had always been shorter than normal for her age. He remembered the
concern of his parents when Julie was younger, especially before some sort of
"treatment" that accelerated her growth had begun. When the teacher assigned oral
reports to be given on various human defects, Terry resolved to do one on "whatever
Julie has." The teacher accepted this, but cautioned that Julie's condition might not be
genetic.
That night, Terry talked to his parents. They confirmed that Julie's growth problems were
indeed inherited and suggested that Terry go with his mother on her next visit with Julie
to the doctor. He knew that Julie went every week to get shots and that these seemed to
be helping because now the difference in height between her and her peers was not nearly
so great now as it had been when she was a little kid. In fact, Julie seemed pretty normal
for a 10-year-old, Terry thought. Sure, she was a girl and sometimes a pest. But, overall,
they got along and even shared some interests like soccer and music.
The next Monday, while Julie was getting weighed and measured, Terry and his Mom sat
down with Dr. Brown who was an endocrinologist specializing in children's problems.
Terry explained about his need for information for his report and the doctor seemed
willing to spend a little time helping him out. She began by saying that a person's height
depends on many factors. Among these are genes, hormones and nutrition. "Julie's
difficulties," she continued, "were diagnosed as being mainly the result of growth
hormone deficiency. This hormone is normally produced by the pituitary gland in the
brain, but in Julie's case there didn't seem to be enough of it. As a result, when her
pediatrician noticed on Julie's growth chart that she was lagging behind the average
growth rate, he did some special tests and concluded that insufficient quantity of hormone
was the culprit. Fortunately, we were able to treat Julie by injections of the hormone that
have produced close-to-normal growth."
After leaving the doctor's, Terry decided to go the library and search for further
information. There he read that human growth hormone is really a protein consisting of
191 amino acids. Some people who lack the normal amount of this hormone inherit the
deficiency from their parents in a recessive manner. Terry felt very intelligent at this
point because he knew that meant that he had had a one in four chance of inheriting the
condition from his carrier parents.
Terry also learned some new facts. For many years, there was no treatment for those
lacking sufficient hormone. In the l950's, it was found that hormone from the pituitaries
of dead people could be used as a treatment. However, not enough people donated their
glands to supply hormone for all those who needed it. Even more sadly, some of the
pituitaries used for this purpose contained a deadly virus. Unknowingly, doctors had
injected the virus into some children along with the hormone and they had died.
Then came genetic engineering. In the l980's, scientists figured out a way to cause a
bacterium to produce human growth hormone. This was an important breakthrough
because the technique provided large quantities of safe hormone at a reasonable cost.
Terry thought this new way to produce a human molecule sounded pretty neat. He was
grateful that such a discovery allowed Julie access to a safe, reliable source of what her
body could not itself produce and assured her fairly normal growth for the rest of her
years.
Questions:
1. Where does the growth hormone in your body originate?
2. How many nucleotides of DNA code for the production of human growth
hormone?
3. What is the mode of inheritance of human growth hormone deficiency?
4. Name some advantages to using genetically engineered growth hormone over
other sources of it.
5. How does one know if one has growth hormone deficiency?
Setting the Stage
Before we can understand how, through genetic engineering, bacteria can provide human
growth hormone, we need to recall some things we know about bacteria and their DNA.
E. Coli bacterium
\
Enlarged Plasmid (with gene for Ampicillin resistance enclosed in brackets)
NOTE WELL: throughout this exercise, the number of nucleotides used to represent
genes, plasmids, etc. is far, far fewer than the actual number. This is done for the sake of
convenience. In the drawing above is an E. coli bacterium and the plasmids it contains.
One of these is the plasmid we will use to carry the human growth hormone gene into a
new bacterium. It is shown enlarged. Note that it carries the gene for ampicillin
resistance.
1. In the picture of the E. coli, label the plasmids and the large "loop" near the
middle.
2. What are plasmids?
3. What bonds in the DNA of the enlarged plasmid are not shown?
4. Note that the enlarged plasmid contains a gene for ampicillin resistance.
Normally, the antibiotic ampicillin will kill E. coli bacteria. If this gene for
resistance is present, however, it will permit the bacterium containing it to "resist"
the power of the ampicillin and continue to live in its presence. (Actually the gene
enables the bacterium to synthesize a protein enzyme that inactivates ampicillin
before it has a chance to kill the bacterium.)
If the E. coli shown above were grown on agar containing ampicillin, what would happen
to the bacteria? Would they be able to grow and reproduce or not? What about E. coli
from which the plasmid shown had been removed? Explain.
Splicing the Growth Hormone Gene into a Plasmid
1. The plasmid shown above in "flat" form is represented on a separate sheet of
paper you have been given. Cut out the strip of DNA and tape its two ends
together. You now have the same plasmid as shown above except in 3-D form.
This is the bacterial DNA into which you will insert the human DNA (gene) that
codes for growth hormone.
2. A section of human DNA is shown below. This section contains the gene for
human growth hormone.
CCCTGTATAAGCTTATGGCTACAGGCTCCCGGAC
GAAGCTTA
GGGACATATTCGAATACCGATGTCCGAGGGCCT
GCTTCGAAT
The m-RNA involved in the synthesis of human growth hormone was isolated and
found to be:
GAAUACCGAUGUCCGAGGGCCUGC
Study the human DNA and locate the portion that is the gene for growth hormone.
Underline or highlight this section.
3. Now that the plasmid DNA and the human gene DNA have been determined, the
next step is to cut each one as a prelude to combining them. The growth hormone
gene must be cut out of the human DNA and the plasmid (bacterial DNA) must be
cut open before the human gene can be inserted. The scissors for doing the cuts
are restriction enzymes. Below is a short list of a few of the enzymes available.
Study the list carefully and select the enzyme that would be appropriate for
cutting out the growth hormone gene from the human DNA and for cutting the
plasmid open. If some "unwanted" bases are included in the human piece of
DNA, no harm done.
4. Once you have selected your enzyme, you have identified the sites at which the
two DNA's will be cut. Using your 3-D paper plasmid and the human DNA found
on the separate sheet, mark IN PENCIL the sites at which the enzyme will cut.
When you are sure the marks are in the correct positions, cut the ends with
scissors. This will produce uneven ends which have unpaired bases. Study these
ends and decide how the human DNA can be joined to that of the bacterial
plasmid. Tape the pieces together. You now have "recombinant DNA."
Discussion Questions:
1. Which enzyme is the correct one to use in this exercise? Explain why in detail.
2. In a real gene splicing, what kind of "tape" would be used?
3. What sticky ends have you made on the human DNA containing the growth
hormone gene? What sticky ends have you made on the bacterial DNA (plasmid)?
Compare the two. What do you observe?
4. Once the recombinant DNA you just constructed was in existence, the next step
would be to insert it into a new bacterium. It would be very important to know
whether any given bacterium had really taken in the recombinant plasmid and so
acquired the ability to make growth hormone. What characteristic, in addition to
the ability to synthesize human growth hormone, should any bacterium that took
up the recombinant plasmid possess? (Hint: look back at the "flat" representation
of the bacterial plasmid)? Explain why.
5. How could you test to see if the bacterium had indeed taken in the plasmid?
6. What exactly is recombinant DNA?
Teacher Materials
Answers to Background Questions:
1.
2.
3.
4.
In the pituitary gland
573 (3 x 191)
Autosomal recessive
No danger of viral infection; larger quantities available; cheaper; virtually
unlimited supply.
5. Growth is stunted. Becomes apparent in childhood if height is compared to
average height of peers.
Answers to Setting the Stage Questions:
1. The large loop near the center of the bacterium is its circular chromosome. The
smaller circles are plasmids.
2. Plasmids are small loops of DNA found in the cytoplasm of bacteria.
3. Hydrogen bonds between bases are not shown.
4. If the E. coli shown were grown on ampicillin-containing agar, it would grow and
reproduce because it contains a plasmid carrying the gene for ampicillin
resistance. If the plasmid were removed, the bacterium would be killed by the
ampicillin.
Answers to Discussion Questions:
The gene for human growth hormone that should be highlighted is:
CTTATGGCTACAGGCTCCCGGACG
1. HindIII is the correct enzyme to use because it has cutting sites on both sides of
the growth hormone gene and thus will cut it out intact. In addition, it has a
cutting site on the plasmid and will thus "open" it for human gene insertion.
2. In real gene splicing, ligases are used to reattach the cut ends of DNA.
3. The sticky ends produced (A G C T T and T T C G A) are complementary to one
another and should bind together.
4. The bacterium should possess ampicillin resistance since the plasmid we are using
contains that gene.
5. You could attempt to grow the bacterium on agar containing ampicillin. If it had
taken in the recombinant plasmid, it would grow successfully and reproduce. If
not, it would not survive.
6. Recombinant DNA is DNA from two or more sources that has been "spliced"
together.
(This exercise is based on a lesson from: BSCS. Advances in Genetic Technology. l989.
Heath.)
TO BE COPIED FOR EACH STUDENT ON PAPER
Human DNA (Containing Gene for Growth Hormone)
C C C T G T A T A A G C T T A T G G C T A C A G G C T C C CG G A C G A A G C T T A
G G G A C A T A T T C G A A T A C C G A T GT C C G A G G GC C T G C T T C G A A T
TO BE COPIED FOR EACH STUDENT ON PAPER OF A DIFFERENT COLOR
Plasmid DNA (Bacterial DNA)
GGATCCTGACACCGGAACGTCAAGCTTCCC
CCTAGGACTGTGGCCTTGCAGTTCGAAGGG
TEACHER GUIDE: Bacterial Transformation with Mystery DNA
This teacher guide is provided to give sample answers to questions. Most of the
questions are open-ended, so students may have correct answers that aren't
included in this guide. Finally, although the experiment is set up to yield one correct
answer, there are variations in data between students. As long as students examine
their data carefully and can justify their answers based on their data, that's science!
Data are always right and there isn't necessarily a 'right answer'.
Some questions to get you thinking about today’s lab:
What can we use DNA for?
We can use DNA to code for proteins, to identify individuals (like when solving a
crime), or to do genetic engineering by inserting foreign DNA into an organism.
How can DNA be put into bacteria?
There are three strategies for getting DNA into bacteria, which you may or may not
want to talk about with students. Bacteria can insert DNA into each other by
CONJUGATION; viruses can insert DNA into bacteria by TRANSDUCTION; or
we can insert DNA into bacteria using chemicals or electricity, which is called
TRANSFORMATION. During this lab, we will 'poke holes' in the bacteria using
chemicals, allowing the DNA to flow into the bacteria- this is called BACTERIAL
TRANSFORMATION.
Why would we want to put DNA into bacteria?
We can use bacteria as little 'factories' to make more DNA, as they replicate, or to
make protein, by transforming them with genes for proteins we want to make (like
insulin).
How can we tell DNA is in the bacteria once we put it there?
The DNA we insert is shaped in a little circle, called a plasmid. We can put one, two,
or more genes in a single plasmid. One of the genes in the plasmid codes for the
ampicillin resistance protein, and thus will allow bacteria with the plasmid DNA to
grow in the presence of ampicillin.
What is a plasmid? What is ampicillin?
A plasmid is a small circle of DNA. Ampicillin is an antibiotic; antibiotics prevent
bacteria from growing. Ampicillin specifically prevents bacteria from making cell
walls. Thus, ampicillin will not kill bacteria (that already have a cell wall), but will
prevent bacteria from reproducing (because they can't make new cell walls).
Materials for each group (students should work in groups of 4):
Tube of mystery plasmid DNA (tubes
numbered 1 or 2)
One tube of E. coli bacteria (on ice)
1 LB agar plate
1 LB agar plate with ampicillin for DNA (3
black stripes)
Q-tips or innoculation loops
1 tube of LB broth
micropipette
micropipette tips
small transfer pipet
large transfer pipet
Materials to share:
Water bath at 42°C
ice
trash containers/biohazard waste bag
UV lights
Protocol:
1. Pipette the DNA solution from your numbered DNA tube into your E. coli bacteria
tube and label the tube 1 or 2
Be sure the students number the top of the tube with which DNA they added to the
bacteria.
2. Put tubes on ice for 5 minutes. Why do you think we put the tubes on ice?
To get the DNA into the bacteria, we have to poke holes in them with the chemical
calcium chloride (CaCl2). CaCl2 will dissociate into Ca2+ and 2 Cl-, and the positive
charge of the Ca2+ cancels the negative charge of the DNA, allowing it to cross the
cell wall and cell membrane. The holes poked to allow the DNA in leaves the
bacteria leaky. If we don't keep them on ice, they'll 'bleed' to death.
3. In the meantime, each group should get one LB agar plate and one LB agar +
ampicillin plate. Write your initials and your section number on your plates. You will be
plating bacteria with DNA on an LB agar plate and on an LB agar +ampicillin plate.
Mark these two plates with the DNA number on your tube. Where is the best place to
label your plates? What is the control you are conducting?
Always label plates on the bottom. The lids can get mixed up accidentally, so if the
bottoms are labeled, the label will stay with the bacteria (which are growing in the
bottom). The LB agar plate will look for the existance of viable bacteria cells. If
nothing grows on the LB agar plate then your bacteria are dead and you cannot
expect transformation or growth on the LB agar + ampicillin
4. Put tubes directly from ice into 42°C water bath for 50 seconds. What do you think
heating the tubes does?
Heating the bacteria helps the holes seal shut. It's like giving the bacteria a fever, so
they start to heal themselves. It's called heat shock.
5. Put DNA tubes directly from water bath onto ice for 2 minutes.
6. With a large transfer pipet, add 0.25 ml LB broth into your DNA tube ( bring solution
to the first mark on the pipet.) Incubate at room temperature for 10 minutes. What is the
LB broth for?
The LB (Luria-Bertani) broth is both food and water for the bacteria. It will help
make the bacteria healthy after poking holes in them, shoving DNA into them, and
giving them a 'fever' to help them heal.
7. With the small transfer pipet, pipet 0.15 ml (about half) from your DNA tube onto your
LB agar plate and 0.15 ml onto your LB agar + ampicillin plate.
8. Spread the solutions on the plates using a sterile Q-tip. Be careful not to stab the agar.
The same Q-tip can be used for both plates as long as it is kept sterile (don't touch it
to anything!).
9. Put your plates in a 37°C incubator for 24 hours. Why 37°C?
These bacteria are E. coli, which grow in human intestine. Because they grow in
humans, they will grow best at human body temperature (37°C). You could ask
students to calculate what 37°C is in Fahrenheit, or what 98.6°F is in Celsius.
Challenge for Day 2: What is ampicillin and why do you think we used it in some of the
plates?
Ampicillin is an antibiotic (described above). We use it in some of the plates to see if
the plasmid DNA is there (bacteria will only grow on ampicillin if they have the
ampicillin resistance gene). We leave it out of some of the plates to make sure the
bacteria can grow if there is no ampicillin present (control).
What do you expect to grow on each of the plates?
LB agar
bacteria +
DNA
LB agar +
ampicillin
(3 black stripes)
Would expect see
Would expect to see
colonies, could
bacterial lawns
count the number
of colonies
Do you expect to
see any difference
in bacterial growth
on the two plates?
Yes
What do you think would have grown on these plates if no DNA had been added to these
bacteria?
bacteria
(without
DNA)
LB agar
LB agar +
ampicillin
(3 black stripes)
Do you expect to
see any difference
in bacterial growth
on the two plates?
Would see
bacterial lawns
Would see nothing.
Yes
Day 2:
What do you see on your plates?
Students should look at their plates to see what they look like. They may see any of
three things:
- little white dots, called colonies (each colony starts as a single bacterium because
they reproduce
asexually, so each colony is like a house with a family of related bacteria)
- a big smear, called a 'bacterial lawn' (this is like a city of bacterial houses, where
there are so many
colonies that we can't tell them apart any more)
- nothing, where no bacteria are growing (ampicillin may kill all of the bacteria or
the students may not
have spread their bacteria around the plate correctly, e.g. they may have put it on
the lid-don't laugh! it happens!)
Now look at your plates with UV light. What do you see?
Fill in the table with your data and the class datawhat does each group (#1 and 2) see on each type of plate?
Mystery
DNA
(number)
LB agar
LB agar +
ampicillin
(3 black stripes)
Based on the
phenotype,
what is the DNA?
#1
students should see
colonies,
they should count
students should see
the number of
bacterial lawns
colonies they see
and record this
number in their
data table
the bacterial
phenotype is
GROWING and
GLOWING, so the
DNA must be both
the ampicillin
resistance gene and
the luciferase gene
#2
students should see
colonies,
the bacterial
they should count
phenotype is
the number of
students should see
GROWING, so the
colonies they see
bacterial lawns
DNA must be the
and record this
ampicillin
number in their
resistance gene
data table
What does each DNA type (1 and 2) allow the bacteria to do?
#1 allows the bacteria to GROW and GLOW
#2 allows the bacteria to GROW
What would the bacteria do on each type of plate (LB agar and LB agar + ampicillin) if
you added no DNA?
The bacteria would form a lawn on the LB agar plate. On the plate with ampicillin,
the bacteria wouldn't grow or glow (you would see nothing) because they wouldn't
have either the ampicillin resistance gene or the Green Fluorescent Protein (GFP)
gene.
After the students fill in their data tables, I usually talk about the results with them in this
order.
I ask the question and help them brainstorm the answers.
After this discussion, students should be able to tell what each DNA type allows the
bacteria to do.
1. Where do the bacteria grow best? On the LB agar plates, because it provides them
with food, water, and shelter. Also, the plates were stored at 37°C, which is their favorite
temperature.
2. If the bacteria can grow on LB agar so well, why didn't they grow on LB agar
with ampicillin? This is an opportunity to talk about what ampicillin is. The bacteria
aren't growing on LB agar with ampicillin because ampicillin is an antibiotic.
3. If ampicillin is an antibiotic, why doesn't it completely stop the bacteria from
growing? Because of the DNA we added, the bacteria are now resistant. In fact, the DNA
we added is called the 'ampicillin resistance gene'.
4. Do both DNA types have the ampicillin resistance gene? They both should grow,
thus they both have the ampicillin resistance gene.
5. What would happen if no DNA is added? The bacteria could not grow in the
presence of ampicillin if they do not contain the ampicillin resistance gene.
6. #1 DNA contains a gene that codes for Green Fluorescent Protein (GFP) , which is
why #1 bacteria GLOW. What are #1 bacteria able to do? GLOW AND GROW.
What are #2 bacteria able to do? GROW.
7. Why do you want to do this kind of GENETIC ENGINEERING experiment? Say
you know someone who is diabetic. They have to take the protein insulin to be healthy.
We can put the insulin gene into a plasmid and then insert that plasmid into bacteria.
These bacteria will make insulin for diabetics to use. Before genetic engineering was
invented, we used to have to kill pigs to get their insulin. Now we can use bacteria to
make human insulin (instead of using pig insulin, especially important if someone is
allergic to pigs) and we don't have to kill any animals to do it
From University of Arizona BIOTECH Project
http://biotech.biology.arizona.edu/labs/transformation(TG).html
STUDENT GUIDE: Bacterial Transformation with Mystery DNA
Some questions to get you thinking about today’s lab:
What can we use DNA for?
How can DNA be put into bacteria?
Why would we want to put DNA into bacteria?
How can we tell DNA is in the bacteria once we put it there?
What is a plasmid? What is ampicillin?
Materials for each group (students should work in groups of 4):
Tube of mystery plasmid DNA (tubes
numbered 1 or 2)
One tube of E. coli bacteria (on ice)
1 LB agar plate
1 LB agar plate with ampicillin for DNA (3
black stripes)
Q-tips or innoculation loops
1 tube of LB broth
micropipette
micropipette tips
small transfer pipet
large transfer pipet
Materials to share:
Water bath at 42°C
ice
trash containers/biohazard waste bag
UV lights
Protocol:
1. Pipette the DNA solution from your numbered DNA tube into your E. coli bacteria
tube and label the tube 1 or 2
2. Put tubes on ice for 5 minutes. Why do you think we put the tubes on ice?
3. In the meantime, each group should get one LB agar plate and one LB agar +
ampicillin plate. Write your initials and your section number on your plates. You will be
plating bacteria with DNA on an LB agar plate and on an LB agar +ampicillin plate.
Mark these two plates with the DNA number on your tube. Where is the best place to
label your plates? What is the control you are conducting?
4. Put tubes directly from ice into 42°C water bath for 50 seconds. What do you think
heating the tubes does?
5. Put DNA tubes directly from water bath onto ice for 2 minutes.
6. With a large transfer pipet, add 0.25 ml LB broth into your DNA tube ( bring solution
to the first mark on the pipet.) Incubate at room temperature for 10 minutes. What is the
LB broth for?
7. With the small transfer pipet, pipet 0.15 ml (about half) from your DNA tube onto your
LB agar plate and 0.15 ml onto your LB agar + ampicillin plate.
8. Spread the solutions on the plates using a sterile Q-tip. Be careful not to stab the agar.
9. Put your plates in a 37°C incubator for 24 hours. Why 37°C?
Challenge for Day 2: What is ampicillin and why do you think we used it in some of the
plates?
What do you expect to grow on each of the plates?
LB agar
LB agar + ampicillin
(3 black stripes)
Do you expect to see any difference
in bacterial growth on the two
plates?
bacteria +
DNA
What do you think would have grown on these plates if no DNA had been added to these
bacteria?
LB agar
LB agar + ampicillin
(3 black stripes)
Do you expect to see any difference
in bacterial growth on the two
plates?
bacteria
(without
DNA)
Day 2:
What do you see on your plates?
Now look at your plates with UV light. What do you see?
Fill in the table with your data and the class datawhat does each group (#1 and 2) see on each type of plate?
Mystery
DNA
(number)
#1
LB agar
LB agar +
ampicillin
(3 black stripes)
Based on the phenotype,
what is the DNA?
#2
What does each DNA type (1 and 2) allow the bacteria to do?
From University of Arizona BIOTECH Project
http://biotech.biology.arizona.edu/labs/transformation.html
Critical Review and Analysis of Articles
Student:_______________________________
Article Title:
Website Address:
Date:_____________
Questions:
Questions
Perspective
Assumptions
Information
Concepts
Inferences
Implications
Town Hall Meeting Prompt
Introduction: Now that we have learned about the definition of a GMO and have
identified the prominent stakeholder’s roles in the GMO debate, you will
now be asked to present this information in the setting of a Town Hall
meeting
Assignment: You will be assigned a stakeholder role or as a mediator of the Town Hall
Meeting.
You will have two days to research your stakeholder position, not your
own position, with the idea that you will be a speaker at the Town Hall
Meeting
After all stakeholders have testified, their will be a discussion with the
townspeople.
Assessment: You will be assessed using the provided rubric.
Senate Hearing Prompt
Introduction: Now that we have learned about the definition of a GMO and have
identified the prominent stakeholder’s roles in the GMO debate, you will
now be asked to present this information in a mock Senate Committee
Hearing.
Assignment: You will be assigned a stakeholder role or as a member of the Senate
Committee representing a state.
You will have two days to research your stakeholder position, not your
own position, with the idea that you will be a witness in a Senate Hearing
on GMOs.
If you are a senator, you will have to research your state’s major
constituents’ position on GMOs. You will have to accurately represent
those constituents during the hearing.
After all stakeholders have testified, their will be a discussion with the end
result being a written suggested policy that the U.S. should take regarding
GMOs.
Assessment: You will be assessed using the provided rubric.
Presentation Rubric for Senate Hearing or Town Hall meeting
5 - Excellent
4 - Strong
3 - Proficient
2 - Developing
1 - Incomplete
Content
5
4
3
2
1
Position clearly made
3 arguments show
thought and support
to position
 Evidence is
substantial in
relating/supporting
arguments
 Answers to questions
complete and
accurate (as
possible)
Audience
5
4
3
2
1




Language,
organization, and
attitude appropriate
for hearing
Appropriately
responds to
questions
Organization
5
4
3



2
Position and
stakeholder
identified in
beginning of
testimony
3 supporting
arguments follow a
logical progression
Supporting details
clearly support the
arguments
Speech Mechanics
5
4
3
2




1
1
Voice is clear
Wording is concise
and accurate
Eye contact
maintained with
audience and/or
subcommittee
members
Shows enthusiasm
for position
Representation of Stakeholder
5
4
3
2
1




Position accurately
represents stakeholder
position
Position and supporting
details indicates
understanding of
stakeholder position
No evidence of personal
bias or personal opinion
Answers to questions
aligned with stakeholder
position.
Ethical Decision-Making Model (based on the Hastings Center Model)
I. What is the ethical question?
II a. What relevant information do I already know about this issue?
II b. What other information do I need to find out?
III. Who has a stake in this decision, and why?
IV a. What are my possible options?
IVb. Evaluation of the options (pros and cons, ethical principles supported by each)
V. What is my decision, and how do I justify it?
VI. How should I act on my decision?
Assignment—Position Paper
Now that you have had a chance to learn about genetically modified crops and to hear
many viewpoints about their potential uses, dangers, and values, it is time for you to
answer the ethical question, “Should we grow genetically modified crops?”
Answer this question in a thoughtful essay. The essay should include a clear statement of
your personal position on this issue and a justification of your decision. When you go
through the reasons that support your decision, you should anchor them in the ethical
principles and theories we have discussed. You should also discuss other possible
positions you considered, and explain why you think those positions are not a good as the
one you chose.
Grammar, spelling, and presentation (neatness) will be a part of your grade.
Look at the rubric for more specific information on how your essay will be evaluated.
This assignment is due at the beginning of class on ____________________________.
Scoring Rubric—Position Paper
Quality of Writing (10 points possible)
Writing conventions (grammar, punctuation, spelling, etc)
Clarity of thought (organization and reasoning)
Eloquence (style and voice)
0 1 2 3
0 1 2 3 4 5
0 1 2
Required Elements (15 points possible)
Statement of position (thesis statement)
At least three supporting arguments
Supporting arguments tied to ethical theories
Alternate choice(s) discussed
Reasons for not selecting alternates explained
Reasons for not selecting alternates tied to ethical theories
0
0
0
0
0
0
1
1
1
1
1
1
2
2
2
2
2
3
3
3
3
Position Paper Rubric
(Elise will send in writing rubric used at her school)
Internet Resources for Teachers
(Compiled July 2003)
GMOs: The significance of gene flow through pollen transfer
http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www
.pdf
Genetically Modified Foods: Harmful or Helpful?
http://www.csa.com/hottopics/gmfood/overview.html
Controversies Surrounding the Risks and Benefits of Genetically Modified Food
http://scope.educ.washington.edu/gmfood/
New Scientist: Latest Articles GM Foods
http://www.newscientist.com/hottopics/gm/
European GMO Campaign
http://www.foeeurope.org/GMOs/Index.htm
How stuff works: What are genetically modified (GM) foods?
http://www.howstuffworks.com/question148.htm
Human Genome Project Information: Genetically Modified Foods and Organisms
http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html
GMO Food News
http://www.connectotel.com/gmfood
Transgenic Crops: An Introduction and Resource Guide
http://www.colostate.edu/programs/lifesciences/TransgenicCrops/
Pew Initiative on Food and Biotechnology
http://pewagbiotech.org/
Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs)
http://www.esi-topics.com/gmc/papers/a1.html
American Society of Plant Biologists: Publications (Articles from the publication
“Genetically Modified Crops: What Do the Scientists Say?”)
http://www.aspb.org/publications/plantphys/gmcpub.cfm
Internet Resources for Teachers
(Compiled July 2003)
GMOs: The significance of gene flow through pollen transfer
http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www
.pdf
Genetically Modified Foods: Harmful or Helpful?
http://www.csa.com/hottopics/gmfood/overview.html
Controversies Surrounding the Risks and Benefits of Genetically Modified Food
http://scope.educ.washington.edu/gmfood/
New Scientist: Latest Articles GM Foods
http://www.newscientist.com/hottopics/gm/
European GMO Campaign
http://www.foeeurope.org/GMOs/Index.htm
How stuff works: What are genetically modified (GM) foods?
http://www.howstuffworks.com/question148.htm
Human Genome Project Information: Genetically Modified Foods and Organisms
http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html
GMO Food News
http://www.connectotel.com/gmfood
Transgenic Crops: An Introduction and Resource Guide
http://www.colostate.edu/programs/lifesciences/TransgenicCrops/
Pew Initiative on Food and Biotechnology
http://pewagbiotech.org/
Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs)
http://www.esi-topics.com/gmc/papers/a1.html
American Society of Plant Biologists: Publications (Articles from the publication
“Genetically Modified Crops: What Do the Scientists Say?”)
http://www.aspb.org/publications/plantphys/gmcpub.cfm
Internet Resources for Teachers
(Compiled July 2003)
GMOs: The significance of gene flow through pollen transfer
http://reports.eea.eu.int/environmental_issue_report_2002_28/en/GMOs%20for%20www
.pdf
Genetically Modified Foods: Harmful or Helpful?
http://www.csa.com/hottopics/gmfood/overview.html
Controversies Surrounding the Risks and Benefits of Genetically Modified Food
http://scope.educ.washington.edu/gmfood/
New Scientist: Latest Articles GM Foods
http://www.newscientist.com/hottopics/gm/
European GMO Campaign
http://www.foeeurope.org/GMOs/Index.htm
How stuff works: What are genetically modified (GM) foods?
http://www.howstuffworks.com/question148.htm
Human Genome Project Information: Genetically Modified Foods and Organisms
http://www.ornl.gov/TechResources/Human_Genome/elsi/gmfood.html
GMO Food News
http://www.connectotel.com/gmfood
Transgenic Crops: An Introduction and Resource Guide
http://www.colostate.edu/programs/lifesciences/TransgenicCrops/
Pew Initiative on Food and Biotechnology
http://pewagbiotech.org/
Essential Science Indicators: Special Topics (Data base of scientific papers about GMOs)
http://www.esi-topics.com/gmc/papers/a1.html
American Society of Plant Biologists: Publications (Articles from the publication
“Genetically Modified Crops: What Do the Scientists Say?”)
http://www.aspb.org/publications/plantphys/gmcpub.cfm
From University of Arizona BIOTECH Project
http://biotech.biology.arizona.edu/labs/bt_cottonSG.html
Ecological and Evolutionary implication of Bt cotton.
Measurement of a single gene difference in two cotton
plants by PCR
BIG IDEA Genetic Engineering has allowed agriculture to move into a new dimension of
artificial selection of desirable traits for crops. Since the beginning of agriculture, humans
have selected for desirable traits in their crops, these traits tend to not be good for the
survival of the plants, hence artificial and not natural selection. The new ability to add
and remove genes from plants, agriculture now does not need to wait for the plant to
evolve the gene during random mutagenesis of its own genome. Plants might not be able
to evolve some traits due to limitation of its DNA sequences. For example, we may be
able to grow a tail because it is in our genetics, with a simple mutation we may grow a
tail, but we do not have the genetics or the ability to evolve suction cups on the bottom of
our feet, such as insects have. Never the less, Spiderman is still an amusing fantasy.
This activity will allow you to investigate the single gene difference of a genetically
modified organism, Bt cotton. You will discuss the ecological and evolutionary
implications of having cotton produce Bt toxin. Bt toxin is a chemical made by a gene
found in a bacteria that lives in the soil, Bacillus thuriniensis. The chemical is toxic to
some insects that happen to devour agricultural crops. Insertion of Bt gene into these
crops has resulted in a dramatic decrease in the amount of pesticides used to grow these
crops.
Let us look at two cotton plants,do they look different from each other? If so how and
what implications can you make from these observations? You will analyze the DNA of
these two plants and determine which one has the gene for Bt cotton. Keeping in mind
what a cell does when it replicates DNA, make a list of steps that you think would be
necessary for the replication of a single gene by Polymerase Chain Reaction.
Do you think that cotton could evolve the ability to produce the Bt toxin on its own? Why
or why not?
DNA extraction from cotton leaf
Materials/Equipment Needed
For the class
- Heating Block
- Pipetman
- Pipet tips
- Sigma XNAP Extract N Amp for Plants Kit
- Bt and nonBt cotton
- 1.5 ml tubes
- 70% Ethanol
- Hole punch
- Forceps
- Vortex
1. Rinse the paper punch and forceps in 70% ethanol prior to use and between handling
different samples.
2. Punch a 0.5 to 0.7 cm disk of leaf tissue into a 1.5 ml tube using a hole paper punch. If
frozen plant tissue is used, keep the leaves on ice while punching disks.
3. Add 100 µl of Extraction Solution to the collection tube. Close the tube and vortex
briefly. Make sure the disk is covered by the Extraction Solution.
4. Incubate at 95 °C for 10 minutes. Note that leaf tissues usually do not appear to be
degraded after this treatment.
5. Add 100 µl of Dilution Solution and vortex to mix.
6. Store the diluted leaf extract in the refrigerator. It is not necessary to remove the leaf
disk before storage.
PCR amplification
Materials/Equipment Needed
For the class
- Thermocycler
- Micropipet and tips
- 0.2 ml PCR microcentrifuge tube
- Forward and reverse Bt primers
- Extract-N-Amp PCR ReadyMix
For each reaction add the following reagents to a thin-walled 0.2 ml PCR microcentrifuge
tube:
Water, PCR reagent 3µl
Forward primer 1 µl
Reverse primer 1 µl (these 5 µl of primer mixture are already added to the 0.2 ml PCR
tube)
Leaf disk extract 5µl
Extract-N-Amp PCR ReadyMix 10 µl
Total volume 20 µl
Mix gently by pipetting
Place tubes into thermocycler and select the BT1 program which has the following
parameters:
- Initial Denaturation 94 °C 5 minutes
- Denaturation 94 °C 30 seconds
- Annealing 44°C 1minutes
- Extension 72 °C 1minutes
- Final Extension 72 °C 5 minutes
- Hold 4 °C 24 hours
The amplified DNA is ready for analysis by gel electrophoresis.
Electrophoresis of your PCR reactions
Materials/Equipment Needed
- Electrophoresis apparatuses, electrodes, and power supplies
- Micropipet
- Micropipet tips
- Loading dye
- 0.8% agarose gel
- Molecular weight markers o Water bath at 55°C or hot plate
-Thermometer for water bath
- TAE buffer
- 0.025% Methylene Blue
- Staining tray
- light box
Procedure
Pouring an agarose gel
1. Get your electrophoresis apparatus and seal both ends of the gel tray with stoppers.
2. Make sure one comb is in place at the negative electrode (black end of the gel).
3. Pour melted agarose into the gel space until the gel is about 5 mm deep. Let the
agarose harden, which should take 5-10 minutes. Don’t touch/move your gel until it’s
hard. In the meantime, prepare your PCR reactions for electrophoresis.
Electrophoresis of your PCR reactions
1. Using the micropipet with a clean tip, pipet 4 µl gel loading solution into your PCR
reaction tube.
You will load both your PCR reactions and standard DNA markers sample into the gel. A
standard DNA marker has a bunch of different sized pieces of DNA so you can compare
it to the DNA from your PCR reaction to figure out what size piece it is.
2. Draw a pictureof your gel and label in which wells you will load which samples (PCR
reaction(s), DNA marker).
3. When your gel has hardened, remove the stoppers.
4. Load 20 ml of your PCR sample into a well - be sure you keep track of which samples
you're loading in which wells. Load 10 ml of DNA marker into a well.
5. Pour TAE buffer carefully so it fills the electrophoresis apparatus and just covers the
gel.
6. Run that gel! Plug the electrodes into your electrophoresis apparatus (red to red, black
to black),
being careful not to bump your gel too much.
7. Plug the power source into an outlet and set the voltage to about 100 V (max = 120 V).
8. Let the gel run until the dye migrates about 1/2 through the gel (about 20-25 minutes).
9. Turn off the power supply, disconnect the electrodes, and remove the top of the
electrophoresis
apparatus.
10. Carefully remove the gel. The gel can be wrapped in plastic wrap and stored in the
refrigerator or
placed it in the staining tray for DNA staining.
Staining gels to examine PCR reactions
1. Place gel in staining tray
2. Add Methylene Blue
3. Stain for about 20 minutes.
4. Carefully place the gel on the mini light view your gel.
5.Draw a picture of your gel.
Analysis
What do you see on your gel? Is the DNA the same in the two plants? What do you think
the sequence of this DNA would be if you were to sequence it? Because a genetic change
in an organism is a relatively permanent change, how do you think this would affect the
development of insect resistance compared the more conventional method of spraying
against insects? As with all technology in our society, there are good and bad points, as
an individual in this world you need to be able to weigh the good versus the bad. Make a
list of the good and bad parts of Genetically Engineered crops, and weigh the dangers
versus the benefits (feel free to include food stuff in this section).
Based on what you know about random mutation of genes, speculate what will happen to
a large group of insects trying to survive in the presence of plants producing Bt toxin.