Download Linking Cognitive Neuroscience and Molecular Genetics: New Perspectives from Williams... Ursula Bellugi and Marie St. George (Eds.)

Linking Cognitive Neuroscience and Molecular Genetics: New Perspectives from Williams Syndrome
Ursula Bellugi and Marie St. George (Eds.)
VI. Genome Structure and Cognitive Map of
Williams Syndrome
Julie R. Korenberg, Xiao-Ning Chen, and Hamao Hirota
Cedars-Sinai Medical Center and University of California, Los Angeles
Zona Lai and Ursula Bellugi
The Salk Institute for Biological Studies
Dennis Burian and Bruce Roe
University of Oklahoma
Rumiko Matsuoka
Tokyo Women’s Medical University
Abstract
& Williams syndrome (WMS) is a most compelling model of
human cognition, of human genome organization, and of
evolution. Due to a deletion in chromosome band 7q11.23,
subjects have cardiovascular, connective tissue, and neurodevelopmental deficits. Given the striking peaks and valleys in
neurocognition including deficits in visual–spatial and global
processing, preserved language and face processing, hypersociability, and heightened affect, the goal of this work has
been to identify the genes that are responsible, the cause of
the deletion, and its origin in primate evolution. To do this, we
have generated an integrated physical, genetic, and transcriptional map of the WMS and flanking regions using multicolor
metaphase and interphase fluorescence in situ hybridization
(FISH) of bacterial artificial chromosomes (BACs) and P1
artificial chromosomes (PACs), BAC end sequencing, PCR gene
marker and microsatellite, large-scale sequencing, cDNA
library, and database analyses. The results indicate the
genomic organization of the WMS region as two nested
INTRODUCTION
Williams syndrome (WMS) is one of the most compelling
models of human cognition. Given the emerging grasp
of the human genome, study of subjects with WMS
provides the opportunity to elucidate the pathways that
lead from genes to behavior in the cognitive neurosciences. This understanding may ultimately help to shed
light on our evolutionary origins and to elucidate a part
of what makes us human.
© 2000 Massachusetts Institute of Technology
duplicated regions flanking a largely single-copy region. There
are at least two common deletion breakpoints, one in the
centromeric and at least two in the telomeric repeated
regions. Clones anchoring the unique to the repeated regions
are defined along with three new pseudogene families.
Primate studies indicate an evolutionary hot spot for
chromosomal inversion in the WMS region. A cognitive
phenotypic map of WMS is presented, which combines
previous data with five further WMS subjects and three
atypical WMS subjects with deletions; two larger (deleted for
D7S489L) and one smaller, deleted for genes telomeric to
FZD9, through LIMK1, but not WSCR1 or telomeric. The results
establish regions and consequent gene candidates for WMS
features including mental retardation, hypersociability, and
facial features. The approach provides the basis for defining
pathways linking genetic underpinnings with the neuroanatomical, functional, and behavioral consequences that result in
human cognition. &
WMS is a particularly powerful model, because it is
characterized by specific deficits coupled with remarkably preserved abilities. It provides the opportunity to
probe neurocognitive pathways in humans across different levels, including the cellular, physiological, anatomic, functional, and cognitive, with each of these
ultimately related to the underlying changes in gene
expression. Armed with this information, one can then
begin to infer the interconnections and to understand
Journal of Cognitive Neuroscience 12:Supplement, pp. 89–107
the molecular basis of human behavior. In this report,
the approach to defining the genetic, anatomic, and
neurocognitive basis of WMS will be presented along
with a physical map and the genomic structure of WMS
region. These data will be used to generate a phenotypic map of WMS and to define subsets of genes
responsible for a part of the facial features and mental
retardation.
Physical Features and Neurocognition in WMS
WMS is a rare genetic disorder that occurs in about one
in 20,000 births and is characterized by mental retardation, a hoarse voice, transient neonatal hypercalcemia,
and a set of facial and physical features that includes
cardiovascular defects, typically congenital supravalvular
aortic stenosis (Table 1; Morris, Leonard, & Dilates,
1988; Morris, Loker, Ensing, & Stock, 1993). However,
what is most striking about individuals with WMS is their
unique cognitive profile. The power of WMS as a model
for dissecting cognition lies in the distinct pattern of
abilities and deficits. Individuals with WMS perform
relatively well on tasks involving language and face
processing, but show extreme difficulties on other
aspects of spatial processing and auditory processing,
particularly at the level of global organization (Bellugi,
Wang, & Jernigan, 1994; Bellugi, Klima, & Wang, 1996;
Bellugi, Lichtenberger, Mills, Galaburda, & Korenberg,
1999a; Bellugi, Mills, Jernigan, Hickok, & Galaburda,
1999b; Bellugi, Lichtenberger, Jones, Lai, & St. George,
this volume). WMS is also associated with hyperacusis,
an abnormal sensitivity to sound (Neville et al., 1994),
although this is not linked to abnormalities in the
peripheral auditory system. Finally, the prime characteristic of WMS individuals is a strong impulse toward
social contact and affective expression (Jones et al., this
volume; Bellugi & Wang, 1998; Bellugi, Losh, Reilly, &
Anderson, 1998; Bellugi et al., 1999a; Reilly, Klima, &
Bellugi, 1990) as well as a heightened sensitivity to
music (Levitin & Bellugi, 1998).
The neurobiological profile of WMS is being revealed
through the studies of brain function, structure, and
cytoarchitechtonics. In these domains, specific eventrelated potentials (ERPs) have been defined as markers
for aspects of face and language processing in WMS
(Mills et al., this volume; Bellugi et al., 1999b; Neville,
Mills, & Bellugi, 1994). Neuroanatomical studies employing MRI and histomorphometric approaches have
revealed consistent morphological features of decreased overall cerebral cortical volume; spared limbic
structures of the temporal lobe including the amygdala,
hippocampus, and parahippocampal gyrus; larger neocerebellar vs. paleocerebellar lobules (Jernigan & Bellugi, 1994); and preservation in volume of Heschl’s
gyrus, an area in the primary auditory cortex (Reiss et
al., this volume; Bellugi et al., 1999b; Galaburda, Wang,
Table 1. Summary of Major WMS Phenotypic Features
Neurological
Neurocognitive
Facies
. Average IQ 55 (range 40- 80)
. F riendly, loquacious personality
. M edial eyebrow flare
. M ild neurological dysfunction
- Tight heel cords
- Poor coordination
. Enhanced musical ability
. Short nasal palpebral fissures;
epicanthal folds
. Hyperacussis
. Harsh, brassy or hoarse voice
. R elatively spared langua ge
development, enhanced
vocabulary, and social use of
language compared to
visual- spatial perception
. F lat nasal bridge
. Stellate iris
. Long philtrum
. Prominent lips with open mouth
Cardiovascular
Musculoskeletal
. Supr avalvular aortic stenosis
. Joint limitations
. Peripheral pulmonary artery stenosis
. K yphoscoliosis
. Pulmonic valvular stenosis
. H allux valgus
. Ventricular/atrial septal defects
. H ypopla stic nails
Genitourinary
Endocrine
. Nephrocalcinosis
. Transient infantile hypercalcemia
. Small, solitary, and/or pelvic kidneys
. Vesicouretal reflux
90
Journal of Cognitive Neuroscience
Volume 12, Supplement
Bellugi, & Rossen, 1994; Galaburda & Bellugi, this
volume). These features have been related to both
the functional abnormalities and their possible embryological origins. Using the approach described, it is
these neurocognitive and neurobiological features that
will ultimately be combined with the genetic structure
of WMS individuals to define the genes and pathways
responsible.
Genetics of WMS
WMS is generally associated with a 1–2 Mb deletion of
chromosome band 7q11.23 that includes the genes for
elastin (Robinson et al., 1996; Gilbert-Dussardier et al.,
1995; Nickerson, Greenberg, Keating, McCaskill, &
Schaffer, 1995; Ewart et al., 1993), which is responsible
for the congenital heart disease (Ewart, Jin, Atkinson,
Morris, & Keating, 1994; Curran et al., 1993), LIM-kinase
1, which may contribute in part to the spatial deficit
(Frangiskakis et al., 1996), and a growing number of
other genes mapping in the region (illustrated in Figure
5). However, although WMS is clearly caused by the
direct and downstream effects of genes located within
the commonly deleted region, specific genes responsible for the major neurocognitive and physical features
of WMS remain unknown. Gene candidates and transcripts mapping in the region include: WSCR1–5
(Osborne et al., 1996); RFC2, the replication factor
C subunit 2 (Peoples, Perez-Jurado, Wang, Kaplan, &
Francke, 1996); FZD9, the human frizzled homolog of
the Drosophila wnt receptor (Wang et al., 1997); STX1A,
the syntaxin 1A gene (Osborne et al., 1997b); GTF2I,
general transcription factor 2I (Perez-Jurado et al., 1998);
WS-b TRP (WS-beta transducin repeats protein, ubiquitously expressed); WS-bHLH (a novel gene of the basic
helix–loop–helix leucine zipper family of transcription
factors that bind to E boxes, predominantly expressed in
liver and kidney); BCL7B, a novel ubiquitously expressed
gene (Meng et al., 1998); WSTF, WMS transcription
factor (Lu, Meng, Morris, & Keating, 1998); FKBP6 (FK506 binding protein, ubiquitously expressed); CYLN2
(cytoplasmic linker-2 gene encoding the protein CLIP115) (Hoogenraad et al., 1998); CPE-R (Clostridium
perfringens enterotoxin receptor); and RVP1 (rat ventral
prostate protein 1) (Paperna, Peoples, Wang, & Francke,
1998). In addition, the gene for NCF1 (neutrophil
cytosolic factor 1) is located close to but is not deleted
in WMS (Francke et al., 1990). It is not known which of
these genes contributes to the phenotypic features of
WMS. Using analyses of WMS subjects with atypical
deletions, this report will illustrate the assignment of
parts of the cognitive phenotype to the subsets of these
genes.
Of importance for understanding both the cause and
the phenotypic variability of WMS is the existence of
genomic duplications that flank the largely unique
region containing the genes described above. Both
expressed genes and pseudogenes, as well as the
breakpoints in the common WMS deletion, are thought
to be located in these duplicated regions (Meng et al.,
1998; Perez-Jurado et al., 1998; Osborne et al., 1997a;
Korenberg et al., 1996; Robinson et al., 1996). However, the number of expressed genes in these duplicated regions and their contribution to the WMS
phenotype is unknown. The current report will illustrate the structure of the flanking duplications and
suggest a possible relationship to the WMS breakpoints.
In the current work, we will describe the construction of a working physical map of the WMS region
including the flanking duplications. Combining data
from fluorescence in situ hybridization (FISH), BAC
end sequencing and large-scale sequence analyses, we
will illustrate that the genomic organization of the WMS
region includes two nested sets of duplications, the
inner of which is involved in generating the common
WMS deletion. A second gene for NCF1 will be shown
to exist within the region deleted in some subjects with
WMS. The genes for CPE-R and RVP1 have been assigned to single BACs. Three further gene fragments
will be described and used to define the structure of
the duplicated regions: ATRA (autoimmune thyroid
antigen), a pseudogene for prohibitin that is located
within an intron of the gene for GTF2I, and a novel
gene that is duplicated but not deleted in WMS. Finally,
using FISH and polymorphic marker analyses, we will
describe the breakpoints in 78 individuals with WMS,
two with larger deletions and one with a smaller
deletion, and use this information to generate a phenotypic map of WMS, defining regions and genes likely
to contribute independently to the mental retardation
and to the facial features.
Data that describe progress in four areas will be
presented below:
(a) The development of a physical map of the WMS
region.
(b) Chromosomal breakpoints in WMS deletions.
(c) Evolution and human variation in the WMS
region.
(d) The development of a phenotypic cognitive map
of WMS.
RESULTS
The Development of a Physical Map of the WMS
Region: Chromosome Band 7q11.23
Using an approach that is independent of previous
maps, we have generated an array of bacterial artificial
chromosomes (BACs) (Korenberg et al., 1996, 1999a,
Korenberg, Lai, & Bellugi, 1999b; http://www.csmc.edu/
genetics/korenberg/korenberg.html) covering the human genome at random, each mapped at 2–6 Mb
resolution by using FISH (Korenberg & Chen, 1995;
Korenberg et al.
91
Figure 1. The region of chromosome 7, band 7q11.23, that is commonly deleted in WMS is represented by the red box in the ideogram. This
region is expanded at the right to illustrate its genomic organization, a region of largely single-copy genes flanked by a series of genomic
duplications (as indicated by bars) containing genes (e.g., GTF2i), pseudogenes (e.g., GTF2i, PMS2P), and duplicate markers (e.g., D7S489). The
regions used in the common breakpoints are indicated by red bars. The map positions of independent BACs used in part for this analysis are shown
as green dots to the left of the ideogram.
Korenberg, Chen, Adams, & Venter, 1995). A subset of
these was used to construct a BAC array with which to
investigate the WMS region of chromosome 7 (see
Figure 1) because yeast artificial chromosome (YAC)
arrays of this region were highly rearranged and deleted ( http://www.genet.sickkids.on.ca/chromosome7).
Forty-five of the initial 233 BACs mapping to chromosome 7 were located on band 7q11.2, of which 30
generated single and 15 generated large or clearly
double signals along each of the sister chromatids
within band 7q11.23, suggesting a local duplication
within this band (Korenberg et al., 1996). A subset of
these duplicated BACs also generated signals in band
7q22, suggesting the existence of sequences in 7q22
that were homologous to those in 7q11.23, extending
previous reports of multiple pseudogene family members located in these bands (Nicolaides et al., 1995).
PCR analyses revealed that BAC 592D8 carried the gene
for elastin. To further establish the genomic organization of the region with respect to the elastin deletion
associated with WMS, a series of three- and four-color
FISH experiments was conducted on normal and WMS
chromosome preparations. These experiments employed pairs of duplicated BACs that were hybridized
simultaneously with single-copy BACs previously
known to map within band 7q11.23. The results illu92
Journal of Cognitive Neuroscience
strated in Figure 1 indicated that BACs containing
elastin (592D8 and 1148G3), and two further randomly
defined BACs (155B1 and 363B4), defined a single-copy
region that was flanked by two nested duplicated
regions. The inner duplicated region was defined by
sequences related to BAC 239C10 and more closely
flanked elastin (Figure 2a and b). The outer duplicated
region was defined by signals generated by BAC 611E3
(Figure 2c), that flanked the signals generated by BAC
239C10. This is shown in Figure 2d in which four-color
interphase FISH analysis reveals BAC 592D8 surrounded by duplicate signals from BAC 239C10 that
are in turn, flanked by duplicate signals generated by
BAC 611E3. The interphase analyses of WMS subjects’
chromosomes shown in Figure 2a, b, and d, revealed
that the signals from the inner duplicated region
appeared to fuse on the deleted chromosome (2b),
whereas the outer layer of signals was not affected
(2d). This suggested that the sequences identified by
BAC 239C10 were close to or included in a common
breakpoint responsible for the WMS deletion and is
further discussed below.
The resulting model of layered duplications flanking a largely single-copy genomic region containing
elastin is shown in Figures 1 and 3. It was inferred
that this duplicated structure was likely predisposed
Volume 12, Supplement
Figure 2. (a and b) BAC* indicates genomic sequences detected by and therefore presumed homologous to a given BAC. BAC* 239C10 (red) is
duplicated within chromosome bands 7q11.23 as reflected by the large size of the signal on metaphase chromosomes (a), and signals are also seen
in 7q22. As shown in the more extended DNA of interphase cells (b), BAC* 239C10 signals (red) flank the signals from BAC 592D8 (green) that
carries the gene encoding elastin. (c) BAC* 611E3 (green) yields two clear signals within chromosome band 7q11.23, representing duplicated
regions. The duplicated signals flank the single signal from BAC 592D8 (ELN) (red) as shown in metaphase chromosomes. (d) The duplicated
signals from BAC 611E3 (red) surround those from BAC 239C10 (green) reflecting a nested duplication structure. Both signal sets flank the signal
from BAC 592D8 (blue) as illustrated in these interphase cells. (e) BAC 1184P14 (green) carries the 50 region of the gene encoding GTF2I and is
shown to be deleted in subjects with the common WMS deletion. BAC 1008H17 (red) carries the gene encoding FZD9 and generates a small signal
indicating partial deletion in subjects with the common WMS deletion. (f1 and f2) Two cosmids detect different deletion patterns in WMS subject
RM1199 with a smaller deletion. Cosmid 128D2 detects no deletion (f1), whereas cosmid 152A8 detects deletion (f2).
Korenberg et al.
93
Figure 3. A physical and transcript map of the WMS region. Genes and pseudogenes mapping in this region are represented by black boxes (names
reading vertically). BAC, PAC, and cosmid clones spanning this region are indicated below the genes and described in the Methods. The clones
hybridized by using cDNA BAP135 are indicated by *, the clones hybridized by using cDNA PMS2 are indicated by +, and the clones of uncertain
map position are indicated by }. The relative locations of genes, microsatellite markers, and clones was confirmed by using PCR analysis. The
location of BAC 611E3 is indicated by the patterned box and is not linked to the remaining contiguous clones. The open box for CYLN2 indicates
unknown location of the 30 end.
to the deletion responsible for WMS by meiotic
mispairing.
STS and Southern Analyses Order the Duplicated
Regions and Identify Clones that Anchor the Unique to
the Repeated Regions at the Inner Borders of the
Duplications
The model and organization of the two duplicated
regions was further investigated by the analysis of BACs
recognizing duplicated regions. This employed BAC to
BAC Southern blots; sizing by pulsed field gel analyses;
PCR (see Methods for table) and Southern analyses of
ordered polymorphic and STS linked markers and the
products of cDNA selection; sequencing and analysis of
BAC ends; and analysis of expressed sequence tags
(ESTs) developed from sequencing BAC 239C10. Details
of STS analyses including end sequences will be presented elsewhere. BAC to BAC Southern blots employed
the 45 BAC DNAs mapping in 7q11.2 digested with EcoRI
probed with whole BAC DNAs (BAC to BAC Southerns).
These revealed cohybridization of BACs in the duplicated regions that confirmed the BAC groupings
(239C10 related, 611E3 related, and closer relatedness
of 607E3 with 731C6), than of all other BACs carrying the
marker D7S489M, including 581A8, 1106N4, and 1049I5.
BAC to BAC Southerns also indicated the overlap of
BACs 363B4 and 155B1 in the single-copy region, the
overlap of single-copy BAC 697G1 with duplicated BACs
611 E3. PCR analyses with single-site polymorphic markers shown on the map D7S489L(A), D7S489U(B),
D7S489M(C) (Perez-Jurado et al., 1998; Osborne et
al., 1996, 1997a; Robinson et al., 1996), permitted
the assignment of BACs from the duplicated regions to
94
Journal of Cognitive Neuroscience
the centromeric or telomeric side of the single-copy
region as illustrated (Figure 3), with 239C10 location
later confirmed by continuity of DNA sequence from
telomeric markers and large-scale sequence of BAC
350L10. As a way of determining the correct overlap in
such highly related regions, the sequencing of BAC ends
was used to exclude or to confirm overlap but, because
of the extensive sequence duplication and conservation
within the duplicated region, was rarely useful for
definitive overlap. Given the high sequence homology
determined from initial BAC end sequencing, the overlap of BACs without anchored markers was determined
by best fit of all analyses. BACs that are highly duplicated
and without anchoring polymorphic markers remain
without definitive map assignment and are indicated in
the map by diamonds. For example, although STS
analyses for BACs 1171H6, 607E3, and 247G3 were
compatible with both centromeric and telomeric locations, BAC to BAC Southerns suggested location as
shown in Figure 3. In summary, from FISH, DNA sequence, and genomic Southern data, the duplications
flanking the WMS region appeared to consist of multiple
regions of highly homologous DNA sequences.
Anchor clones were defined in a manner that
linked the single-copy region to the flanking centromeric and telomeric duplicated regions. These were
1008H17 (centromeric), that was initially identified at
random and by PCR, was then found to carry both
duplicated D7489U(B) and single-copy sequences of
FZD9, both of which are deleted in the common
WMS deletion (Wang et al., 1997). Therefore, it was
clear that both single-copy and duplicated sequences
were deleted in the common deletion. Moreover, this
established the clone (1008H17) as carrying sequences
Volume 12, Supplement
that included the border of the single-copy and
duplicated regions. FISH using this clone (1008H17
with FZD9) indicated that most individuals with WMS
were partially deleted (Figure 2e). Further evidence
supported this clone or the overlapping P1 artificial
chromosome (PAC) 3J20 as containing the common
breakpoint for the WMS deletion. This was suggested
because PAC 3J20 carried both the commonly deleted
marker D7489U and the nondeleted marker, GTF2IP,
a pseudogene for the true gene, GTF2I, which is
located at the telomeric end of the WMS common
deletion (Perez-Jurado et al., 1998). Therefore, clones
1008H17 or 3J20 must contain the common centromeric breakpoint for WMS.
BAC clones anchoring the telomeric end of the singlecopy region to the duplicated region, 1184P14 and
1156F20, were identified by screening for the unique
marker D7S1870. These were found by BAC Southern
analyses to carry a duplicated gene, initially called
BAP135 (data not shown), and then were confirmed to
carry the 50 STSs of the expressed form of the gene
recently identified as GTF2I that is deleted in WMS
(Perez-Jurado et al., 1998). This clone is deleted in all
subjects with the common WMS deletion (Figure 2e),
providing a reagent with which to define the telomeric
end of the common WMS deletion.
Clone 611E3 May Anchor the Telomeric Duplicated
Region to the Flanking Unique Region Located at the
Border of Bands 7q11.23 and 7q21.1
The border between the telomeric duplicated region
and the flanking single-copy region may be located close
to or within BACs 611E3 or 697G1 since both carry the
single-copy STS marker D7S2323, that is located telomeric to D7S489L, located in the telomeric duplication.
BAC 697G1 is single copy (by FISH criteria) and maps by
FISH to the border of bands 7q11.23-21. However, given
the highly reduplicated nature of the entire region, the
possibility remains that there are further duplicated
regions flanking that defined by BAC611E3. Moreover,
even the putatively single-copy STS, D7S2323, may itself
be duplicated, and another copy of it located on the
centromeric side of the WMS deleted region or in band
7q22. Nonetheless, these data suggest that there are
regions in 7q11.23 that have been duplicated but are not
involved in generating the WMS deletion.
Duplications Flanking the Elastin Region Contain
Highly Conserved Gene Duplications and Processed
Pseudogenes Originating from Many Chromosomes:
Gene Sequences for NCF1, ATRA and Prohibitin are
Duplicated in the Centromeric and Telomeric Regions
Flanking the WMS Deletion
To further investigate duplicated genes and to establish
their potential relationship to the WMS deletion and
phenotype, BAC 239C10 was partially sequenced and,
along with BAC end sequences, was analyzed by database comparisons using BLAST searches (Altschul et al.,
1997). Previously known genes located in the singlecopy deleted region (ELN, LIMK1, WSCR1, RFC2, STX1A,
FZD9), in the putatively nondeleted (NCF1 or neutrophil
cytosolic factor 1), and in the duplicated regions (PMS2)
were used to analyze all single and duplicated BACs by
PCR, BAC Southern blots and sequence analyses of BAC
239C10. The gene for NCF1, previously mapped to
7q11.23 (Francke et al., 1990), but not thought deleted,
was revealed to have at least three copies in the duplicated regions, two centromeric and one telomeric, by
using a cDNA hybridized to BAC Southerns (data not
shown). BAC 239C10 sequence analysis revealed a complete copy of the gene with a one-hundred-percent
match to the published cDNA, and conservation of the
appropriate intron/exon boundary sequences, located
about 13 kb telomeric to the 3 0 end of GTF2I and
transcribed centromere to telomere. However, comparison of the genomic sequence containing this NCF1
gene, with the genomic sequence of NCF1 that had
been previously determined (Gorlach et al., 1997), revealed numerous changes within the introns. Therefore,
this new copy of the NCF1 gene, located in BAC 239C10,
was considered to be an NCF1 gene duplication and
possibly expressed. The previously described copy of
NCF1 was inferred to be likely located in the centromeric
duplication, defined by the previous genomic sequence
(Gorlach et al., 1997). Nonetheless, differences within
introns or in more extended regions at intron/exon
boundaries may alter the likelihood of expression. No
further sequences matching NCF1 were found in BAC
239C10 or in the overlapping BAC 350L11. In summary,
as begun above, further analyses of the regions flanking
the common WMS deletion indicate long stretches of
conserved and highly homologous DNA.
Sequence analysis of BAC 239C10 also revealed
further genes or fragments located within the duplicated
regions. For example, a one-hundred-percent match to
all but the 50 end of the gene BAP135 (GTF2I) was found
within the centromeric 9 kb, along with matches to
other exons located in an unlinked 34 kb contig. It
was shown to be duplicated by Southerns in at least
one further copy on the centromeric duplication. Recent
work (Perez-Jurado et al., 1998) has confirmed the
locations of this gene, now renamed GTF2I, and its
centromeric pseudogene, along with the intron/exon
structure. STSs from these cDNAs, conserved at close
to one hundred percent for all but the unique 50 regions,
were then used in the present analysis and are summarized in Figure 3. Further BAC 239C10 sequence analyses
revealed the presence of a processed pseudogene for
the prohibitin gene, containing numerous stop codons,
and located at the centromeric end within intron 18 of
GTF2I but transcribed in the opposite direction. The
parent gene is located on chromosome 17q but PCR
Korenberg et al.
95
analyses revealed that sequences related to this gene
were duplicated on all BACs containing GTF2I. This
suggests that the insertion of the prohibitin pseudogene
predated the formation of the duplications flanking the
WMS region, and the degree of sequence drift separating
the functional and the pseudogenes might be used as a
molecular clock to estimate the time since and evolutionary origin of the duplicated regions. Finally, the
marker D7S489L was also confirmed to exist on BAC
239C10, as were pseudogenes for PMS2. Members of the
PMS2 family of pseudogenes were previously known to
be located in bands 7q11.2, 7p22, 7p13, and 7q22
(Nicolaides et al., 1995). The number of pseudogenes
determined by PCR may underestimate the copy number determined by hybridization because of gene rearrangements or sequence drift. Nonetheless, because of
their distribution (Korenberg, unpublished) the PMS2
pseudogene family may provide an even more ancient
tag than prohibitin for sequences that are ultimately
responsible for the duplications flanking WMS.
Further gene fragments mapping in the duplicated
regions were determined by end sequencing. For example, BAC 581A8 end sequence matched a gene fragment
for ATRA (autoimmune thyroid disease-related antigen;
M28639, Hirayu, Seto, Magnusson, Filetti, & Rapoport,
1987). Southern analyses revealed duplication as shown
in Figure 2. Screening a brain cDNA library for the
complete cDNA revealed an expressed pseudogene
containing ATRA fused to a fragment from a novel gene
isolated from a brain library (BBG in Figure 3) (Ishikawa
et al., 1998) with both fragments located in multiple
copies in the duplicated region. Further details will be
reported elsewhere.
In order to determine the degree of homology and
structure of the duplicated regions, Southern analyses
were followed with sequencing of PCR fragments templated on BACs in the duplicated regions because, in
most cases, identical fragment sizes were obtained from
the Southern analyses. However, sequence analyses
revealed a ninety-seven- to one-hundred-percent homology of sequences from BACs located on the two sides of
the duplicated regions. The exceedingly high homology
of some sequences flanking the WMS deleted region
suggested either recent origin or a mechanism that
selectively maintained homology; in either case, the
high homology provides challenges to the genomic
analysis and may predispose to mispairing at meiosis,
thereby increasing variability genetic variability in this
region.
Genes in the Single-Copy Region
To cover the single-copy region, PCR fragments from
BAC end sequences (155B1, 363B4, 1184G3, 1008H17),
mapped markers (D7S1870), and cDNA sequences
(LIMK1, elastin) were used to screen the BAC library
(Research Genetics, Huntsville, AL), followed by confir96
Journal of Cognitive Neuroscience
mation of overlap by PCR. The map of the single-copy
region was further confirmed by PCR of genes and
markers indicated on the map and was linked to other
ordered clone sets (Meng et al., 1998a; Meng, Lu, Morris,
& Keating, 1998b; Paperna et al., 1998; Osborne et al.,
1997a, 1997b) by PCR and Southern analyses. The genes
for CPE-R (Clostridium perfringens enterotoxin receptor) and RVP-1 (rat ventral prostate 1 protein), both
recently mapped to the region between STX1A and
FZD9 (Paperna et al., 1998), were mapped to PAC
391G2 by PCR. All putatively single-copy genes were
evaluated for possible duplication by PCR and hybridization to BACs from the duplicated regions. Further
cosmids and PACs obtained as indicated from other
groups, were confirmed by PCR and Southerns to overlap as shown on the map in Figure 3.
The conclusion from these experiments was that the
WMS region of band 7q11.2 was composed of a largely
single-copy region of about 1.5 Mb containing at least 19
known genes. This region is flanked by duplications
containing highly conserved processed and unprocessed
pseudogenes, some of which are transcribed and many
with homologies of ninety-nine percent. The next critical
questions were to determine which of the single copy
and which of the duplicated genes and pseudogenes
were deleted in subjects with WMS and of these, which
were important for determining the phenotype. To do
this, the map reagents and information were then used
to determine the regions and genes deleted in subjects
diagnosed with WMS.
Chromosomal Breakpoints in WMS Deletions
The Inner Duplication is Involved in the WMS Common
Deletion
Next, the BAC map reagents were used to determine the
regions deleted in WMS subjects, to estimate the size of
the deletion, and to define closely flanking markers. To
do this, each of the 40 initial BACs randomly mapping in
7q11.2 was tested singly on metaphase and interphase
chromosomes from six WMS subjects and evaluated with
respect to the deleted chromosome using simultaneous
hybridization of a control BAC located in band 7q22. The
results illustrated in Figure 2 for BAC 239C10, clearly
showed that the signals from BACs 239C10 and 731C6
that flanked elastin, were now joined in a single, smaller
signal on the chromosome carrying the deletion
whereas the duplicated signals from BAC 611E3, that
flanked the 239C10 duplicated region now moved closer
on the deleted chromosome but were not joined, as
shown in Figure 2. BAC 731C6 generated smaller, more
defined signals on interphase analyses. A third pattern
was seen by BAC 204H6, which generated duplicated
signals that were more diffuse and more closely surrounding the single-copy region (data not shown).
These results suggested that the deletion breakpoints
were located within or very close to the sequences
Volume 12, Supplement
recognized by BAC 239C10 and that part of the duplicated region was itself deleted.
WMS Chromosomes Delete Parts of the Clones that
Anchor the Unique and Duplicated Regions
To determine the regions commonly deleted in WMS, 74
subjects with clinically diagnosed WMS were tested as
above. Chromosome preparations from subjects and 20
parents were analyzed by simultaneous FISH for BACs
carrying elastin (592D8, 1051J22, 1148G3), the telomeric
anchor clone that contained the gene for GTF2I,
1184P14; 239C10, and for 28 cases, the centromeric
anchor BAC, 1008H17 (carrying the gene FZD9). The
results summarized in Table 2, indicate that 73 of 74
subjects, but none of the parents (data not shown), were
deleted for all single-copy BACs including the distal
anchor marker. The common WMS deletion and the
genes consequently deleted are shown in Figure 5. All
save one were also partially deleted for the centromeric
flanking marker 1008H17 and for BACs marking the
flanking duplications (e.g., 239C10). The single case
without a deletion was felt, on review, not to be typical,
but, nonetheless, requires further study. This suggested
that anchor BAC 1008H17 contained the centromeric
breakpoint and that BAC 239C10 contained the telomeric breakpoint. Interphase analyses indicated that
Table 2. Summary: Analysis of Deletion in WMS Subjects
Using FISH and Polymorphic Markers in Parents and Probands
Markers
No. Deleted/
No. Subjects
Tested
No. Deleted/
No. Informativea
(n= 112)
Deleted
(%)
FISH with BACs
FZD9
(B1008H17)
27/28
96.4
ELN+LIMK1
(B592D8)
73/74
98.6
RFC2
(B155B1)
8/8
GTF2I
(B1184P14)
100
58/59
98.3
Microsatellites
a
D7S653
34
0/25
D7S489U
36
9/9
100
D7S1870
39
26/26
100
D7S489L
34
2/11
18.2
D7S849
39
2/16
2.5
D7S675
38
0/25
0
From ABI analysis.
0
PAC 3J20 mapped on top of 1008H17, supporting it as
the anchor and proximal breakpoint marker. The conclusion from this analysis was that the breakpoints of the
common WMS deletion were not grossly variable but
were rather clustered in a small region close to the
centromeric and telomeric borders between the unique
and repeated regions. This suggested that most subjects
with WMS were deleted for roughly the same regions,
and, therefore, variability in neurocognitive phenotype
was not likely determined by large differences in gene
content. It remained possible that genes at or near the
breakpoints or within the duplicated regions, could
contribute disproportionately to the classical WMS features. This spurred the search for rare subjects with
smaller deletions.
WMS Subjects with Atypical Deletions
To further determine the extent of the deletions, particularly within the duplicated regions, microsatellite markers D7S489M, D7S489U, D7S1870, D7S489L, D7S849
(all except D7S489M, previously reported as deleted
with variable frequencies), and the flanking markers,
D7S675 and D7S653, were analyzed in parents and
probands from 40 families. This revealed that 11 of the
40 probands were informative for D7S489L, and two of
these 11 were deleted. All of the 26 informative probands were deleted for D7S1870, but not for the flanking
markers (D7S675 and D7S653). A subset of phenotypic
features for the two subjects with the atypical larger
deletions are shown in Table 3 and the molecular data
are shown in Figure 5. Both revealed typical WMS
features. In addition, a further subject (data not shown),
also carried a larger deletion and exhibited hyperlexia
(ability to phonologically decode written words without
necessarily comprehending them). Full neurocognitive
analyses will be reported elsewhere (Korenberg et al.,
1999a). In summary, the phenotypic features of WMS
subjects with the common deletion or with the larger
deletion are similar but may possess subtle neurocognitive differences that merit further study.
WMS subjects with smaller deletions were first identified by screening using FISH with the anchor BAC clones,
1184P14 and 1008H17, and BAC 592D8 (elastin) as
reported elsewhere for Italian subjects, (Botta et al.,
1999) and in a study of Japanese subjects. The clinical
features of these along with those in the literature are
shown in Table 3. One subject, RM1199, was found to be
deleted for BAC 592D8 but for neither of the anchoring
BACs. This 8-year-old girl had SVAS, a broad nasal tip, a
slightly thick lower lip, dental anomalies, mild mental
retardation, with a normal birth history. No further
clinical information was available and photographs were
not permitted. Further analyses employed the reagents
from the map (Figure 3) for FISH (BACs 239C10, 315H11,
1148G3, 363B4, 155B1, PACs P632N4, 391G2, 195h6,
953F13, 261A10, 267N24, cosmids 129F5, 82C2, 152a8,
Korenberg et al.
97
Table 3. Phenotypes of Eight Atypical WMS Subjects
Subject #
132
558
III1
III2
IV
V
VI
VII
Age at exam ( Y )
11
13.3
6
2
13
7.8
19
29/26
.
.
Sex
Male
.
Female
.
.
.
.
.
Growth
Weight %
95
7
97
3
40.5kg(46.0±7.6)
Height %
25
10
50
10
140.1cm(153.4±5.6)
HC %
10
25
10
Birth weight
3– 10
10
low
2.6Kg
2.7Kg
Physical features
Face
+
+
+
+
±
–
–
– /–
+/+
– /+
+/+
+
+
–
–
– /–
Lower lip thick
+
+
+
+/+
+
–
–
– /–
Malar flat
–
+
+
+
–
–
–
– /–
Periorbital fullness
–
+
+
+
–
–
–
– /–
Stellate iris
–
+
+
–
–
–
– /–
Epicanthal folds
+
+
+
–
–
–
– /–
±
–
–
– /–
+
+
+
+/+
–
–
–
– /–
Bulbous nasal tip/short
Dental anomalies
Hoarse voice
+
+
+
–
+
Heart
SVAS
+
PA stenosis
+
Renal anomalies
Hernia
–
–
+
–
–
–
+/+
Sloping shoulders
+
+
–
–
–
–
Long trunk
–
+
–
–
–
–
+
+
–
–
–
–
+
+
+
+(mild)
normal
normal
n/n
68
54(65/51)
normal
normal
N range
±
–
–
–
Bony malformations
Neurological
Abnormal gait
Cognitive
Retardation
Milestones retarded
+(mild)
IQ
Cognitive profile
Behavior
Hypersocial
98
+
±
Journal of Cognitive Neuroscience
+
–
Volume 12, Supplement
128d2, 15e3, 183e1, 209c11, and 82b11), and quantitative
Southern blot dosage analysis (data not shown) for the
gene FZD9. The results (shown in Figure 2f and later in
Figure 5) revealed the deletion of all contiguous clones
from B632N4 through cos152a8 but the presence of the
overlapping anchor clones, B1008H17 and 129f5, indicating no apparent deletion of FZD9 (confirmed by Southern analysis using gene-specific hybridization), but
deletion for the remainder of the region including the
genes telomeric to FZD9, viz., STX1A, CPE-R, RVP1, and
ELN, and likely also for the genes, carried on the deleted
BAC B632N 4. The telomeric breakpoint revealed deletion
of clones through LIMK1 but not for WSCR1 or for
sequences further telomeric. In summary, the analysis
of WMS subject RM1199 revealed an atypical smaller
deletion: Neither FZD9 nor GTF2I were deleted, but
the genes located telomeric to FZD9 through WBSCR1
were deleted.
The molecular data and subsets of the clinical and
cognitive information from the subjects was then combined with data from the larger deletions described
above, from other reports of individuals with SVAS and
other features accompanied by deletion (Botta et al.,
1999; Tassabehji et al., 1997, 1999; Frangiskakis et al.,
1996; Olson et al., 1995) or single-base mutation of elastin
(Li et al., 1997), and was used to generate a cognitive map
as shown in Figure 5. This revealed regions likely to
contain genes, which are in part responsible for the
mental retardation and facial features, and, possibly, for
a part of the hypersociability seen in WMS.
Evolution and Human Variation in the WMS
Region
The duplicated region surrounding the WMS deletion
can be traced through the evolution of primate chromosomes. This was investigated to better understand the
origin of the duplicated regions and because of the
possibility that changes in gene content and expression
in the WMS region could be in part responsible for
changes accompanying speciation in primates as well
as for variation in human cognition. To do this, the
chromosomal locations of BAC probes for the duplicated regions (239C10 and 611E3) and for the singlecopy region (elastin, 592D8) were evaluated in the
orangutan (Pongo pygmaeus), the gorilla (Gorilla gorilla), and the chimpanzee (Pan troglodytes). There have
been two inversions in the higher primate homologues
of human chromosome 7. The results, summarized in
Figure 4, revealed that the region of 7q11.2 deleted in
WMS has been involved in both of these evolutionary
breakage and inversion events. The probes for both the
duplicated and single-copy regions generated signals in
the chromosome bands involved in the region of the
Figure 4. The human chromosome 7 homologs from the orangutan (Pongo), gorilla (Gorilla), and chimpanzee (Pan) are illustrated. Horizontal
arrows indicate the approximate chromosome band of the major inversions that have accompanied their speciation. Experiments using BACs from
the closely flanking duplicated regions (BACs 239C10, 204, and 611E3) for FISH revealed duplicated sequences located at or close to all inversion
breakpoints, illustrated by the colored dots. The gene for elastin (ELN) mapped to the subtelomeric band of Pongo, and was close to the initial
inversion breakpoint as well as all subsequent inversions of chromosome 7 through primate evolution.
Korenberg et al.
99
inversions occurring between the orangutan and gorilla,
and then again between the gorilla and the chimpanzee.
It is of interest that the WMS region represented by BAC
239C10 was already partially duplicated in the orangutan, and appears to increase in signal with each inversion
event, transferring part to the new site and leaving part
of the duplicated region at the previous site, suggesting
partial duplications associated with the inversions. The
chimpanzee chromosome appears grossly similar in
hybridization pattern to the human using the current
probes but may vary for regions not yet tested. For all
species changes, only the molecular analysis will allow
an accurate understanding of the subtle rearrangements
and potential duplications of these regions. Nonetheless, although such inversion and duplication is uncommon, it characterizes speciation during primate
evolution. Therefore, we must ask to what extent these
regions have contributed to primate speciation. Moreover, we must also ask whether humans are variable for
these regions and for the expression of the genes within
them, and to what extent might the normal variation of
behavior in the cognitive domains we are looking at be
determined by variation in these regions.
would call into question its use in defining the usual
WMS breakpoint. Finally, the genomic duplication of
NCF1 found in BAC 239C10 is of interest because the
exon sequences are ninety-nine percent homologous
to the putative functional copy located in the centromeric duplication but the intronic regions vary, being
only ninety-seven percent homologous. This suggests
that the telomeric duplication represented by BAC
239C10 is of recent origin, likely after the chimpanzee,
or that the homology is maintained by some other
mechanism, possibly gene conversion. Further,
although this suggests that the gene for NCF1 was
expressed for some time after duplication and may
still be expressed by both the present telomeric and
previously reported presumptively centromeric copies,
this is made less likely by the observation of an
autosomal recessive form of CGD (chronic granulomatous disease) that is caused by deletion of a GT in
NCF1. The autosomal recessive inheritance implies
that both parental copies, and, by inference, both
centromeric and telomeric copies, would have to be
mutated. Further analyses may yield differences in
expressive potential due to promoter or intron/exon
junction sequences.
DISCUSSION
The physical map of the WMS region presented in this
report reveals that the commonly deleted region is
flanked by nested duplicated regions that are linked to
the STS maps (see Figure 3). The inner duplicated
region corresponds to the previously noted duplications that included PMS2, D7S489, and GTF2I (PerezJurado et al., 1998; Osborne et al., 1996). The current
report extends the understanding of this region and
suggests that the outer duplicated region appears
asymmetrically located with respect to the gene for
elastin. Moreover, the current analysis that is summarized in Figure 3 reveals that some subsections of the
region are oriented in part in parallel and others are
not. Further, the duplications themselves appear to be
scrambled, somewhat reminiscent of the duplications
found in chromosome band 5q13, in which deletion is
responsible for SMA1 (Campbell, Potter, Ignatius, Dubowitz, & Davies, 1997). Moreover, some duplicated
pseudogenes (ATRA, BBG, prohibitin) may also be
located in band 7q22 (data not shown). All of this
suggests that the formation of these regions included
numerous events that occurred over an extended time
period during primate or earlier evolution. Moreover,
until the structure is supported by sequence data, it is
still possible that the unit defined by D7489M is
located in or duplicated in the telomeric duplication,
and given the apparent multiple nature of the
D7S489M signals, it is possible that there are further
copies, and that the entire region is polymorphic in
the human population. If D7S489M is duplicated, and
at least one copy lies outside the deleted region, this
100
Journal of Cognitive Neuroscience
Deletion Breakpoints in WMS: One Centromeric
and At Least Two Telomeric
The definition of marker D7S849 as telomeric to
D7S489L and possibly deleted in at least two individuals suggests the existence of a second telomeric
breakpoint as indicated on the map in Figure 3.
Although both the centromeric break and the first
telomeric break appear to be common to most WMS
deletions, by the current report as well as by previous
analyses (Perez-Jurado et al., 1998; Robinson et al.,
1996), further work is necessary to determine if the
second break is also clustered. The second breakpoint
may be located close to the outer ring of duplicated
regions defined by BAC 611E3. It is of interest that we
have placed a third NCF1 copy close to the GTF2I
pseudogene in the centromeric break and that these
same genes appear to characterize the telomeric break,
suggesting that sequences at or beyond the GTFZI 30
and the 5 0 end of NCF1, may be involved in the
deletion as suggested (Perez-Jurado et al., 1998). It is
important to note that the cause of the deletion may
include a number of factors including the high frequency of Alu elements in the region and the high
degree of sequence conservation in the duplicated
regions. However, the limited localization of the breakpoints augers that particular sequences or chromatin
structures may be major contributors. Candidate sequences could include any number of elements associated with genome instability (e.g., mariner elements,
L1, HERV, THE1, etc.), although none of these have
been demonstrated as causative. Finally, it is of interest
Volume 12, Supplement
that BAC 611E3 may be located close to the 7q11.23q21 border which delineates points at which stable
replication forks must exist during DNA mitotic synthesis in that band q21 replicates late and band q11.23
earlier during the DNA synthetic period. The DNA
structures that underlie the regions of band borders
may themselves be unstable and may contribute to the
tendency to delete.
We have, therefore, proposed that the repeat sequences illustrated by the BAC analyses are either
responsible for or are caused by the same instabilities
that lead to the deletion in WMS (Korenberg et al.,
1997a, 1997b). In any event, it is likely that the meiotic
mispairing of subsets of these sequence families combined with crossing-over (Robinson et al., 1996) results
in a series of different chromosomal aberrations of the
deletion/duplication types. Although these have not yet
been described for the WMS region, similar duplicated
structures on other chromosomes are also associated
with deletions and rearrangements causing neurologic
disease (Lupski, 1998). One fascinating aspect of this
finding is the potential to define repeat sequence structures, and, therefore, other breakpoints and deletions
that may be characteristic of particular phenotypes,
adding another dimension to our understanding of
genome organization and cognition.
Genes Responsible for Neurocognition, Neuroanatomy,
and Behavior in WMS
The ultimate goal of this work was to understand the
pathways that bridge genes and behavior by elucidating
the genes deleted in different individuals with WMS, and
by linking across levels, the information on gene expression, neuroanatomy, physiology, and neurocognition. To
do this, we have presented the analysis of 74 subjects with
clinically diagnosed WMS, which, together with other
studies, has begun to show promise. The initial prospects
for linking genotype and phenotype in WMS, with the
traditional genetic approach, were grim since most all
cases appeared to be deleted for the same region and the
same genes (Perez-Jurado et al., 1998). Ideally, one would
like to have seen some variability in the deletions and to
link this with variations in cognitive behavior. Slowly, we
are beginning to build up a database of these individuals
who are partially deleted and show partial features of
WMS. It is by combining the data from these subjects with
other individuals carrying atypical deletions, that we have
now begun to assign neurocognitive features of WMS to
different regions with known genes.
The Development of a Phenotypic Cognitive Map
of WMS
The result of combining the current molecular and
cognitive data with the literature results in a suggestion
of both the regions and the genes within that are
ultimately involved in generating the phenotypic features of WMS. The current phenotypic map of WMS is
shown in Figure 5.
The map was constructed by using the clinical data
shown in Table 3 with the following rationale. In WMS,
there is ample room for justifiable speculation as to
which genes should be responsible for the cognitive
features of WMS. The gene for LIMK1 has been implicated (Frangiskakis et al., 1996) but not substantiated
(Tassabehji et al., 1999) as a cause of the visual–spatial
features of WMS, and the genes for STX1A and FZD9
have been implicated simply by their brain-specific gene
expression in the developing (FZD9) or adult (STX1A)
central nervous system. However, regardless of the
theoretical attraction of these molecules as mediators
of cognitive processes and their embryological substrata,
it is important to test their significance in causing the
phenotypes at hand when they are underexpressed by
fifty percent as is likely in the WMS brain. When this is
done, as illustrated in Figure 5, we see that deletion of
these genes is not associated with the significant effects
on overall cognition that are characteristic of WMS.
Therefore, we must now ask not only which genes are
likely to affect cognition, but simultaneously, which
regions and their genes have been demonstrated in
humans to be associated with changes in cognition
when deleted. First, it is now clear that deletion of
elastin is responsible for the cardiovascular defects of
WMS, based on the effects of both small deletions and
point mutations of elastin. It is also strongly suggested
that none of the other physical features is largely due to
deletion of elastin. This is based on the lack of these
features (e.g., facies, hoarse voice) in individuals with
elastin single-base mutations (Li et al. 1997). Second,
although a part of the visual–spatial deficit may be due
to deletion of LIMK1 (Frangiskakis et al., 1996), this is
unlikely to be the major gene responsible as the observation is not supported by three further cases that
delete this gene as well as others (Tassabehji et al., 1999;
Figure 4). The strength of this inference is emphasized
by one of the cases being an engineering student. Third,
from case RM1199 reported here, who is deleted for the
region from WSTF through WSCR1, and the case CS
(Tassabehji et al., 1999), who carries a deletion of the
region from FZD9 through RFC2, it appears unlikely that
the genes in this region can be largely responsible for
the characteristic WMS mental retardation, sociability,
visual–spatial or memory deficits, language preservation,
or facial features. This is because both of these individuals have heart disease with essentially normal range or
mildly impaired cognitive and physical features. Therefore, it is likely that the genes responsible for a major
part of the mental retardation and other features are
located in the region telomeric to RFC2 through GTF2I
at the telomeric border of the deletion. Nonetheless, the
mild cognitive deficits seen in RM1199 and in one of the
two subjects deleted for elastin and LIMK1 (Tassabehji
Korenberg et al.
101
Figure 5. Vertical lines on both figures indicate the regions deleted, and the number of subjects carrying the common WMS deletion associated
with some of the typical facial features, mental retardation, and heart disease, the larger deletion associated with similar features, or the smaller
deletions, that include subregions of Synaxin1A through RFC2, associated with only the typical heart disease Supravalvar Aortic Stenosis (SVAS) and
subtle cognitive deficits that fall within the normal range. Gene symbols are noted in the corresponding regions. Subject VIII has a subtle defect in
visual–spatial processing. * Indicates individuals with deletion or single base pair mutation of elastin, all associated only with SVAS and normal
cognition. Small vertical brackets indicate deleted regions that differ among subjects, and therefore provide the potential to assign specific WMS
features to single regions or genes. Some brackets indicate regions that, from the current data, are likely to contain a gene or genes that when
deleted contribute in some measure to the WMS features denoted. The significance of these data is that deletion of STXIA, ELN, LIMK1, WSCR1, and
RFC2 do not appear to be strongly associated with the characteristic facial or cognitive features seen in WMS, although they may contribute. In
contrast, deletion of the region telomeric to WSCR1 is associated with characteristic features of WMS cognition.
et al., 1999) suggest that decreased expression of genes
in the region from WSTF through LIMK1 are associated
with subtle defects in cognition. The contribution of
genes in the telomeric region to the facial features and
mental retardation is supported by the classical facial
features seen in individuals with deletions of STX1A
through GTF2I (Botta et al., 1999). Finally, it is important to note that, similar to subjects with the common
full WMS deletion, the cognitive deficits in individuals
with small deletions are variable and understanding the
range of consequences of single deleted genes requires
study of further individuals.
This exciting initial map of cognition is important in
setting out the approach for defining the other domains
of cognitive function and neuroanatomic structure as
described above. Moreover, it emphasizes that, with a
small number of subjects, however rare, significant
understanding can be gained. From the map it is appreciated that, even with the small number of subjects
currently reported, seven different regions could be
defined for cognitive phenotypes that were delineated
102
Journal of Cognitive Neuroscience
clearly. It is the development of sensitive measures and
their study in these and other rare individuals that will
ultimately provide clues to the critical steps in the
pathways of human cognition.
Caveats to the WMS Cognitive Map
It is important to note that the variable expression of
genes that are not deleted may also be affected and
contribute to phenotype. These may include the effects
of transcribed but not translated pseudogenes including
those for GTF2I. Further sources of phenotypic variability include interactions of genes in the deleted region
with others mapping both in and outside of the WMS
region as well as possible regional disturbances of
replication and transcription due to deletion and rearrangement. Such larger rearrangements that do not
result in deletion may yet be a cause of the WMS
phenotype by such a mechanism. Some rearrangements
may lead to the decreased expression of nondeleted
genes, and to the incorrect association of genes with
Volume 12, Supplement
cognitive function. Ideally, gene expression in the brain
both during fetal and adult life must be understood to
assess this. However, the present map is a good beginning.
Other potential sources of genetic effects on cognition include imprinting, or the phenomenon by which
the expression of a gene is differentially modified by
passing through the maternal or the paternal germline.
For WMS, this has been suggested for growth and head
circumference (Pankau, Partsch, Neblung, Gosch, &
Wessel, 1994; Francke, Yang-Feng, Brissenden, & Ulrich, 1986) and was recently investigated for a subset of
the neurocognitive phenotypes (Korenberg et al.,
1999). So far, it appears the parent of origin of the
deletion is not related to the neurocognitive performance on any of the measures so far tested. These
include overall intellectual ability, receptive and productive language, visual–spatial measures (with and
without motor), and facial identification. However,
other cognitive variables that have not yet been tested
may be affected by the parent of origin. These may
include memory (both verbal and visual, immediate,
and long-term), conservation ability, frontal executive
functions, friendliness and social behavior, and emotion
perception. Although preliminary results indicated no
significant difference, larger numbers of subjects and
the development of more sensitive and specific measures may be required to elucidate more subtle effects
of genetic imprinting on gene expression in WMS.
In summary, the data from studies of rare WMS
subjects with atypical deletions are the most informative in identifying gene candidates for human cognitive
features. Evidence suggests that mental retardation
may be largely determined by the centromeric and
telomeric regions and facial features determined at
least in part determined by the telomeric region defined above. The next essential step is to parse the
phenotype; to perform detailed cognitive, neuroanatomic, and physical studies of these individuals; and to
devise and apply sensitive tests of musicality and
sociability that probe the limits of these processes
and that are informative across variation in intellectual
function as seen in WMS. The multidimensional data
from well-studied individuals with atypical deletions
can thus be used to elucidate the many levels requiring
intersection in the neurosciences; the role of neuroanatomic structures in cognition and behavior; and the role
of gene expression in determining structure, cognition,
and possibly disease.
METHODS
Clinical Subjects, DNA Isolation and Chromosome
Preparation
Seventy-four WMS subjects used for this study were
evaluated by the Laboratory for Cognitive Neuroscience
at The Salk Institute for Biological Studies, La Jolla, CA.
The procedures and consent forms were approved by
The Salk Institute Institutional Review Board (IRB).
DNAs were isolated either directly from peripheral
blood or from lymphoblastoid cell lines using the
Puregene DNA isolation Kit (Gentra, Minneapolis,
MN) according to the manufacturer’s instruction.
Chromosome preparations were generated by a standard technique from peripheral blood samples (Korenberg & Chen, 1995) for both humans and other
primates. Primate bloods were obtained from the Yerkes
Laboratory Yerkes Primate Research Institute/Emory
University.
BAC to BAC Southerns
The BAC DNA preparations and the size of each clone
were performed according to the procedure described
by Hubert et al. (1997). Briefly, BAC DNAs were isolated
using miniprep or midiprep kits (Qiagen) with modifications. NotI digests excised the insert and provided a
convenient means of determining the sizes of clones.
Southern blots of NotI and EcoRI double-digests of
miniprep or midiprep DNA were used to show overlaps
between clones. To prepare probes from BACs, 50–100
ng of DNAs were labeled using random priming (Boehringer Manheim). The hybridization and wash conditions were as described previously (Korenberg et al.,
1995).
FISH and Chromosomal Analysis
The BAC clones were confirmed and mapped to chromosome 7q by using multicolor FISH as described
previously (Korenberg et al., 1995). One microgram of
miniprep BAC DNA was either indirectly labeled with
biotin-14-dUTP or digoxigenin-11-dUTP or directly labeled with Cy5-dUTP, Arcour-dUTP using nicktranslation
kits (GIBCO BRL; Amersham). FITC–avidin (Vector Lab)
and Rhodamine–antidigoxigenin (Boehringer Manheim)
were used for the detection of biotinylated and digoxigenin labeled probes, respectively. The directly labeled
probes were viewed immediately after the counterstaining with chromomycin A3 and distamycin A, which
generates a high-resolution reverse banded pattern.
The color images were captured by using the Photometrics cooled-CCD camera and BDS image analysis
software (ONCOR Imaging, Gaithersburg, MD).
To determine whether a given individual carried a
deletion, BAC probes for elastin (592D8) were hybridized simultaneously with one or both anchor BACs
(1184P14 carrying D7S1870 and 1008H17 carrying FZD9)
as well as BAC 239C10 recognizing the flanking duplications. More than 20 cells of high technical quality were
evaluated for each individual and scored for presence,
absence or intermediate signal from each probe on both
chromosomes. Deletions were scored only when all 20
cells revealed absent signals.
Korenberg et al.
103
PCR Table
PCR
fragment
sizes (bp)
Genes
Access
number/ref
NCF1
U57835
FKBP6 exon 9
Meng et al.,
1998
WSTF exon 20
Lu et al.,
1998
FZD9
U82169
TGTCAAGGTCAGGCAAGTGAG
CPE-R
AB000712
CTTCAGCCCAGGGCCCCTGG
GCACAGGTCCCATTTATTGT
224
RVP1
BA000714
GCATGGACTGTGAAACCTCA
GCTAAAACGAGAGGCTTTTA
170
STX1A
U87315
CCTGTTGTCTTGCGCTCTGGG
AGATACAAATGTTTATTCTAC
426
ELN exon 1
J02948
ATGGCGGGTCTGACGGCGGCG
GGATCCCGCTTCCCAGGGGTC
568
ELN exon 36
J02948
GGACTCACAGTGATGTGCACC
GGCGGCCATGACAGGTCAACC
828
LIMK1
U62292
CTTTGTGAAGCTGGAACACTGG
GTTCCTTGGACGTCACGGTTCC
1334
D7S613
G18333
WSCR1
AF045555
AGCACAGAGACCACGACTCC
CTGCGTCAGCGCCGCAGTCA
160
H23535
G25613
RFC2
AF045555
CCACTCGCCCACCCTCACGT
GCAGCTCACTAGGACATTCA
640
GTF2i-STS1,
STS2, STS3
Perez-Jurado
et al., 1998
D7S1870
Z51768
D7S489
z16646
WI-9539
G11821
50 Primer sequences
GGCCCCGCTCTCTGCCCGCA
PCR Analysis
All PCR primers were constructed as referenced or
designed manually as shown in the Table. PCR reactions
carried out in a PTC-100TM (MJ Research). PCRs were
performed in 25–l reaction mixtures containing 0.5–1 M
each primer and 0.5–1 U Taq in 10£ PCR buffer and 25
m m each of dATP, dCTP, dTTP, dGTP (GIBCO BRL) with
1.5 mM MgC12. After initial denaturation (948C for 2
min) and amplification for 30 cycles (948C for 45 sec,
578C for 60 sec, final extension 728C for 10 min),
products were resolved by gel electrophoresis on
1–3% ethidium brodide-stained NuSieve agarose gels.
Sequence Analysis
Sequencing the ends of BAC and PAC inserts directly:
Sequencing primers that immediately flank the insert
were designed from the SP6 and T7 RNA promoters and
other sites within the vectors and were used to sequence BAC and PAC ends directly without subcloning.
The primer sequences used were SP6, 50 gatttaggtgacactgtag 3 0, and T7, 50 taatacgactcactataggg 30. The
104
30 Primer sequences
Journal of Cognitive Neuroscience
GCAAGGGCCGAGACGCTAGC
CTCACCTCCTACCTTCCCCCTTCCCAGCCA
182
283
sequencing reactions were performed as described in
the dsDNA Cycle Sequencing System (BRL) using 6 g of
midiprep DNA for each SP6 and T7 reaction. Electrophoresis in 60-cm, six-percent denaturing polyacrylamide gels gave up to 350 bp of sequence at 55W.
The University of Oklahoma’s Advanced Center for
Genome Technology (ACGT) (http://www.genome.ou.edu/human.html, AC004166) produced the
large-scale sequencing of BAC clone 239C10. DNA
sequence for BAC 350L10 was obtained from the
Washington University Genome sequencing Center,
as a series of unlinked contigs available at http//
genome.wustl.edu/pub/gscl/sequence/st.louis/human/
preliminary/7. The sequence of ATRA (EST M28639)
and BBG were obtained by using BLAST search in
NCBI database with the end sequence of BAC 581A8
(http://www.ncbi.nih.gov).
Genes and Markers
Cosmids 129F5, 165B5, 82C2, 34B3, 128D2, 102F12,
135F3, 157F3, 237H1, 63F7, 82B11, 209C11, 47D1,
Volume 12, Supplement
183E1, 160G4, and 15E11 were a generous gift from LapChee Tsui (Osborne et al., 1997a, 1997b). The information for DNA markers of D7489M, D7489U, D7489L, STS1,
STS2, STS3, D7S2714, and D7S1870 were obtained either
from the literature or the MIT web site (Perez-Jurado et
al., 1998; Osborne et al., 1996; Gilbert-Dussardier et al.,
1995) (http://www-genome.wi.mit.edu/).
Polymorphic Marker Analyses
M icr osatellite ana lyses wer e conducted using
D7S489(A,B,C), D7S1870, D7S653, D7S675, D7S849,
D7S613, D7S2472, D7S2476. Primers were designed
from publicly available sequences and labeled with
one of the three following dyes: 6-Carboxyfluorescein,
6-car boxy-2 0,4 0,7 0,4,7-hexa chlor ofluorescein, and
N,N,N 0,N 0-tetramethyl-6-carboxyrhodamine. A fourth
dye 6-carboxy-X-rhodamine labeled the lambda phage
size standard. Multiplex PCR reactions were carried out
in solutions containing 10 mM Tris–HCl (pH 8.9), 50
mM KCl, 2.5 mM MgCl 2, 100 ng genomic DNA, 200 m M
from each subject.
Acknowledgments
This work was performed at Share’s Child Disability Center and
supported by grants from the Department of Energy (DEPG03-92ER-61402 and DE-FC03-96ER62294 to J. R. Korenberg)
and the National Institute of Child Health and Human
Development (HD33113, J. R. Korenberg). J. R. Korenberg
holds the Geri and Richard Brawerman Chair in Molecular
Genetics. The work was also supported partially by grant
NHGIN HG00313 to B. Roe and grants from The Oak Tree
Philanthropic Foundation, and Call Foundation to U. Bellugi,
and the James S. McDonnell Foundation to U. Bellugi and J. R.
Korenberg.
Reprint requests should be sent to J. R. Korenberg, Medical
Genetics, Cedars-Sinai Medical Center, 110 George Burns
Road, Davis Building, Suite 2069, Los Angeles, CA 90048-1869,
USA, or via e-mail: [email protected].
REFERENCES
Altschul, S. F., Madden, T., Schaffer, A., Zhang, J., Zhang, H.,
Miller, W., & Lipman, D. J. (1997). Gapped BLAST and PSIBLAST: A new generation of protein database search programs. Nucleic Acids Research, 25, 3389–3402.
Bellugi, U., Klima, E. S., & Wang, P. P. (1996). Cognitive and
neural development: Clues from genetically based syndromes. In D. Magnussen (Ed.), The life-span development
of individuals: Behavioral, neurobiological, and psychosocial perspectives (pp. 223–243). The Nobel Symposium.
New York: Cambridge University Press.
Bellugi, U., Lichtenberger, L., Jones, W., Lai, Z., & St.
George, M. (this volume). The neurocognitive profile of
Williams Syndrome: A complex pattern of strengths and
weaknesses.
Bellugi, U., Lichtenberger, L., Mills, D., Galaburda, A., & Korenberg, J. (1999a). Bridging cognition, brain and molecular
genetics: Evidence from Williams syndrome. Trends in
Neurosciences, 22, 197–207.
Bellugi, U., Losh, M., Reilly, J., & Anderson, D. (1998). Excessive use of linguistically encoded affect: Stories from
young children with Williams syndrome (Technical Report
CND-9801). University of California, San Diego, Center for
Research in Language, Project in Cognitive and Neural
Development.
Bellugi, U., Mills, D., Jernigan, T., Hickok, G., & Galaburda, A.
(1999b). Linking cognition, brain structure and brain function in Williams syndrome. In H. Tager-Flusberg (Ed.),
Neurodevelopmental disorders: Contributions to a new
framework from the cognitive neurosciences. (pp. 111–
136). Cambridge, MA: MIT Press.
Bellugi, U., & Wang, P. P. (1998). Williams syndrome: From
cognition to brain to gene. In G. Edelman & B.H. Smith
(Eds.), Encyclopedia of Neuroscience, CD-ROM version.
New York: Elsevier.
Bellugi, U., Wang, P. P., & Jernigan, T. L. (1994). Williams syndrome: An unusual neuropsychological profile. In S. Broman
& J. Grafman (Eds.), Atypical cognitive deficits in developmental disorders: Implications for brain function (pp. 23–
56). Hillsdale, NJ: Erlbaum.
Botta, A., Novelli, G., Mari, A., Novelli, A., Sabani, M., Korenberg, J. R., Osborne, L., Digilio, M. C., Giannotti, A., & Dallapiccola, B. (1999). Detection of an atypical 7q11.23
deletion in Williams syndrome patients which does not include the STX1A and FZD9 genes. Journal of Medical Genetics, 36, 478–480.
Campbell, L., Potter, A., Ignatius, J., Dubowitz, V., & Davies, K.
(1997). Genomic variation and gene conversion in spinal
muscular atrophy: Implications for disease process and
clinical phenotype. American Journal of Human Genetics,
61, 40–50.
Curran, M. E., Atkinson, D. L., Ewart, A. K., Morris, C. A., Leppert, M. F., & Keating M. T. (1993). The elastin gene is disrupted by a translocation associated with supravalvular
aortic stenosis. Cell, 73, 159–168.
Ewart, A. K., Jin, W., Atkinson, D. L., Morris, C. A., & Keating, M.
T. (1994). Supravalvular aortic stenosis associated with a
deletion disrupting the elastin gene. Journal of Clinical
Investigations, 83, 1071–1077.
Ewart, A. K., Morris, C. A., Atkinson, D., Jin, W., Sternes, K.,
Spallone, P., Stock, A. D., Leppert, M., & Keating, M. T. (1993).
Hemizygosity at the elastin locus in the developmental disorder, Williams syndrome. Nature Genetics, 5, 11–18.
Francke, U., Hsieh, C. L., Foellmer, B. E., Lomax, K. J., Malech,
H. L., & Leto, T. L. (1990). Genes for two autosomal recessive
forms of chronic granulomatous disease assigned to 1q25
(NCF2) and 7q11.23 (NCF1). American Journal of Human
Genetics, 47, 483–492.
Francke, U., Yang-Feng, T. L., Brissenden, J. E., & Ulrich, A.
(1986). Chromosomal mapping of genes involved in growth
control. Cold Spring Harbor Symposium on Quantitative
Biology, 51, 855–866.
Frangiskakis, J. M., Ewart, A. K., Morris, C. A., Mervis, C. B.,
Bertrand, J., Robinson, B. F., Klein, B. P., Ensing, G. J.,
Everett, L. A., Green, E. D., Proschel, C., Gutowski, N. J.,
Noble, M., Atkinson, D. L., Odelberg, S. J., & Keating, M. T.
(1996). LIM-kinase hemizygosity implicated in impaired visuospatial constructive cognition. Cell, 86, 59–69.
Galaburda, A., & Bellugi, U. (this volume). Multi-level analysis
of cortical neuroanatomy in Williams syndrome.
Galaburda, A. M., Wang, P. P., Bellugi, U., & Rossen, M. (1994).
Cytoarchitectonic findings in a genetically based disorder:
Williams syndrome. NeuroReport, 5, 758–787.
Gilbert-Dussardier, B., Bonneau, D., Gigaral, N., Le Merrer, M.,
Bonnet, D., Phillip, N., Serville, F., Verloes, A., Rossi, A.,
Ayme, S., Weissenbach, J., Mattei, M.-G., Lyonnet, S., &
Munnich, A. (1995). A novel microsatellite DNA marker at
Korenberg et al.
105
locus D7S1870 detects hemizygosity in 75% of patients with
Williams syndrome. American Journal of Human Genetics,
56, 542–543.
Gorlach, A., Lee, P. L., Roesler, J., Hopkins, P. J., Christensen,
B., Green, E. D., Chanock, S. J., & Curnutte, J. T. (1997). A
p47-phox pseudogene carries the most common mutation
causing p47-phox-deficient chronic granulomatous disease.
Journal of Clinical Investigations, 100, 1907–1918.
Hirayu, H., Seto, P., Magnusson, R. P., Filetti, S., & Rapoport, B.
(1987). Molecular cloning and partial characterization of a
new autoimmune thyroid disease-related antigen. Journal of
Clinical Endocrinology and Metabolism, 64, 578–584.
Hoogenraad, C. C., Eussen, B. H., Langeveld, A., Haperen, R.,
Winterberg, S., Wouters, C. H., Grosveld, F., De Zeeuw, C. L.,
& Galjart, N. (1998). The murine CYLN2 gene: Genomic
organization, chromosome localization and comparison to
the human gene that is located within the 7q11.23 Williams
syndrome critical region. Genomics, 53, 348–358.
Hubert, R. S., Mitchell, S., Chen, X.-N., Ekmekji, K., Gadomski,
C., Sun, Z., Noya, D., Kim, U.-J., Chen, C., Shizuya, H., Simon,
M., de Jong, P. J., & Korenberg, J. R. (1997). BAC and PAC
contigs covering 3.5 Mb of the Down syndrome congenital
heart disease region between D21S55 and MX1 on chromosome 21. Genomics, 41, 218–226.
Ishikawa, K., Nagase, T., Suyama, M., Tanaka, A., Kotani,
H., Nomura, N., & Ohara, O. (1998). Prediction of the
coding sequences of unidentified human genes: X. The
complete sequences of 100 new cDNA clones from brain
which can code for large proteins. DNA Research, 176,
169–176.
Jernigan, T. L., & Bellugi, U. (1994). Neuroanatomical distinctions between Williams and Down syndromes. In S. Broman
and J. Grafman (Eds.), Atypical cognitive deficits in developmental disorders: Implications in brain function (pp.
57–66). Hillsdale, NJ: Erlbaum.
Jones, W., Bellugi, U., Lai, Z., Chiles, M., Reilly, J., Lincoln, A.,
& Adolphs, R. (this volume). Hypersociability in Williams
syndrome.
Korenberg, J. R., & Chen, X.-N. (1995). Localization of human CREBBP (CREB Binding Protein) to 16p13.3 by
fluorescence in situ hybridization. Cytogenetics and Cell
Genetics, 71, 56–57.
Korenberg, J. R., Chen, X.-N., Adams, M.D., & Venter, J. C.
(1995). Towards a cDNA map of the human genome.
Genomics, 29, 364–370.
Korenberg, J. R., Chen, X.-N., Lai, Z., Yimlamai, D., Bisighini, R.,
& Bellugi, U. (1997a). Williams syndrome. The search for
genetic origins of cognition. American Journal of Human
Genetics, 61, A103, 579.
Korenberg, J. R., Chen, X.-N., Mitchell, S., Sun, Z.-G., Hubert,
R., Vataru, E. S., & Bellugi, U. (1996). The genomic organization of Williams syndrome. American Journal of Medical
Genetics Supplement, 59, A306, 1776.
Korenberg, J. R., Chen, X.-N., Mitchell, S., Sun, Z.-G., Hubert,
R., Vataru, E. S., & Bellugi, U. (1997b). The genomic organization of Williams syndrome. International Behavioral
Neuroscience Society Abstracts, 6, 59, P2-52.
Korenberg, J. R., Chen, X.-N., Sun, Z., Shi, Z.-Y., Ma, S., Vataru,
E., Yimlamai, D., Weissenbach, J. S., Shizuya, H., Simon, M. I.,
Gerety, S. S., Nguyen, H., Zemsteva, I. S., Hui, L., Silva, J., Wu,
X., Birren, B., & Hudson, T. J. (1999a). Human genome
anatomy: BACs integrating the genetic and cytogenetic maps
for bridging genome and biomedicine. Genome Research, 9
(in press).
Korenberg, J. R., Lai, Z., & Bellugi, U. (1999b). In preparation.
Levitin, D. J., & Bellugi, U. (1998). Musical abilities in individuals with Williams syndrome. Music Perception, 15,
357–389.
106
Journal of Cognitive Neuroscience
Li, D. Y, Toland, A. E., Boak, B. B., Atkinson, D. L., Ensing, G. J.,
Morris, C. A., Keating, M. T. (1997). Elastin point mutations
cause an obstructive vascular disease, supravalvular aortic
stenosis. Human Molecular Genetics, 6, 1021–1028.
Lu, X., Meng, X., Morris, C. A., & Keating, M. T. (1998). A novel
human gene, WSTF, is deleted in Williams syndrome.
Genomics, 54, 241–249.
Lupski, J. R. (1998). Genomic disorders: Structural features of
the genome can lead to DNA rearrangements and human
disease traits. Trends in Genetics, 10, 417–422.
Meng, X., Lu, X., Li, Z., Green, E. D., Massa, H., Trask, B. J.,
Morris, C. A., & Keating, M. T. (1998a). Complete physical
map of the common deletion region in Williams syndrome
and identification and characterization of three novel genes.
Human Genetics, 103, 590–599.
Meng, X., Lu, X., Morris, C. A., & Keating, M. T. (1998b). A novel
human gene FKPB6 is deleted in Williams syndrome. Genomics, 52, 130–137.
Mills, D., Alvarez, T., St. George, M., Appelbaum, L., Bellugi, U.,
& Neville, H. J. (this volume). Electrophysiological studies of
face processing in Williams syndrome.
Morris, C. A., Leonard, C. O., & Dilates, C. (1988). Natural
history of Williams syndrome: Physical characteristics. Journal of Pediatrics, 113, 318–325.
Morris, C. A., Loker, J., Ensing, G., & Stock, A. D. (1993). Supravalvular aortic stenosis cosegregates with familial 6; 7
translocation which disrupts the elastin gene. American
Journal of Medical Genetics, 46, 737–744.
Neville, H. J., Mills, D., & Bellugi, U. (1994). Effects of altered
auditory sensitivity and age of language acquisition on the
development of language-relevant neural systems: Preliminary studies of Williams syndrome. In S. Broman & J. Grafman
(Eds.), Atypical cognitive deficits in developmental disorders: Implications for brain function (pp. 67–83). Hillsdale,
NJ: Erlbaum.
Nickerson, E., Greenberg, F., Keating, M. T., McCaskill, C., &
Shaffer, L. G. (1995). Deletions of the elastin gene at
7q11.23 occur in approximately 90% of patients with Williams syndrome. American Journal of Human Genetics, 56,
1156–1161.
Nicolaides, N. C., Carter, K., Shell, B. K., Papadopoulos, N.,
Vogelstein, B., & Kinzler, K. W. (1995). Genomic organization of the human PMS2 gene family. Genomics, 30,
195–206.
Olson, T. M., Michels, V. V., Urban, Z., Csiszar, K., Christiano, A.
M., Driscoll, D. J., Feldt, R. H., Boyd, C. D., Thibodeau, S. N.
(1995). A 30 kb deletion within the elastin gene results in
familial supravalvular aortic stenosis. Human Molecular
Genetics, 4, 1677–1679.
Osborne, L. R., Herbrick, J. A., Greavette, T., Heng, H. H., Tsui,
L.-C., & Scherer, S.W. (1997a). PMS2-related genes flank the
rearrangement breakpoints associated with Williams syndrome and other diseases on human chromosome 7.
Genomics, 45, 402–406.
Osborne, L. R., Martindale, D., Scherer, S. W., Shi, X. M., Huizenga, J., Heng, H. H. Q., Costa, T., Pober, B., Lew, L.,
Brinkman, J., Rommens, J., Koop, B., & Tsui, L.-C. (1996).
Identification of genes from a 500-kb region at 7q11.23 that
is commonly deleted in Williams syndrome patients. Genomics, 36, 328–336.
Osborne, L. R., Sodar, S., Shi, X.-M., Pober, B., Costa, T.,
Scherer, S. W., & Tsui, L.-C. (1997b). Hemizygous deletion of
the syntaxin 1A gene in individuals with Williams syndrome.
American Journal of Human Genetics, 61, 449–452.
Pankau, R., Partsch, D. J., Neblung, A., Gosch, A., & Wessel, A.
(1994). Head circumference of chidren with Williams–Beuren Syndrome. American Journal of Medical Genetics, 52,
285 –290.
Volume 12, Supplement
Paperna, T., Peoples, R., Wang, Y. K., & Francke, U. (1998).
Genes for the CPE receptor (CPETR1) and the human
homolog of RUP1 (CPETR2) are localized within the Williams–Beuren Syndrome deletion. American Journal of
Human Genetics, 54, 453–459.
Peoples, R., Perez-Jurado, L., Wang, Y. K., Kaplan, P., &
Francke, U. (1996). The gene for replication factor C subunit
2 (RFC2) is within the 7q11.23 Williams syndrome deletion.
American Journal of Human Genetics, 58, 1370–1373.
Perez-Jurado, L. A., Wang, Y. K., Peoples, R., Coloma, A.,
Cruces, J., & Francke, U. (1998). A duplicated gene in the
breakpoint regions of the 7q11.23 Williams–Beuren syndrome deletion encodes the initiator binding protein
TFII-I and BAP-135, a phosphorylation target of BTK.
Human Molecular Genetics, 7, 325–334.
Reilly, J. S., Klima, E. S., & Bellugi, U. (1990). Once more with
feeling: Affect and language in atypical populations. Development and Psychopathology, 2, 367–391.
Reiss, A. L., Eliez, S., Schmitt, E. J., Strauss, E., Lai, Z., Jones, W.
L., & Bellugi, U. (this volume). Neuroanatomy of Williams
syndrome: A high-resolution MRI study.
Robinson, W. P., Waslynka, J., Bernasconi, F., Wang, M.,
Clark, S., Kotzot, D., & Schinzel, A. (1996). Delineation of
7q11.2 deletions associated with Williams–Beuren syndrome and mapping of a repetitive sequence to within
and to either side of the common deletion. Genomics, 34,
17–23.
Tassabehji, M., Metcalfe, K., Donnai, D., Hurst, J., Reardon,
W., Burch, M., & Read, A. P. (1997). Elastin: Genomic
structure and point mutations in patients with supravalvular aortic stenosis. Human Molecular Genetics, 7,
1029–1036.
Tassabehji, M., Metcalfe, K., Karmiloff-Smith, A., Carette, M. J.,
Grant, J., Dennis, N., Reardon, W., Splitt, M., Read, A., &
Donnai, D. (1999). Williams syndrome: Use of chromosomal
microdeletions as a tool to dissect cognitive and physical
phenotypes. American Journal of Human Genetics, 64,
118–125.
Wang, Y. K., Samos, C. H., Peoples, R., Perez-Jurado, L. A.,
Nusse, R., & Francke, U. (1997). A novel human homologue
of the Drosophila frizzled wnt receptor gene binds wingless
protein and is in the Williams syndrome deletion at 7q11.23.
New Gene called F1/27/1993. Human Molecular Genetics, 6,
465–472.
Korenberg et al.
107