* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download smokers - West High School
Cre-Lox recombination wikipedia , lookup
Copy-number variation wikipedia , lookup
Transposable element wikipedia , lookup
Epigenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Protein moonlighting wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Genome evolution wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Oncogenomics wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Genome (book) wikipedia , lookup
Point mutation wikipedia , lookup
Gene desert wikipedia , lookup
Genome editing wikipedia , lookup
Gene expression programming wikipedia , lookup
History of genetic engineering wikipedia , lookup
Gene therapy wikipedia , lookup
Gene expression profiling wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Gene nomenclature wikipedia , lookup
Helitron (biology) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
DNA Chip Scanning •DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. •Only those probe spots where target cDNA hybridized will fluoresce. GENE EXPRESSION CENTER Scanner - DNA chip goes in here Image on screen as chip is scanned Smoker vs. Former Smoker Smoker vs. Non-Smoker Probe DNA (each grid) 1 2 3 4 5 6 7 8 9 10 11 DNA CHIP before hybridization with target DNA (after spotting Probe DNA) Sometimes the SDS used in the wash solutions will fluoresce. This is all background signal. A Real DNA Chip Each spot is a different gene Example: Green Smoker Red Non-smoker Yellow Both tissues express the gene Bioinformatics - It’s a BLAST BLAST: “Basic Local Alignment Search Tool” Sequences at each spot on the chip are provided on kit CD Probe Gene Sequences - Cancer / Smoking Chip GENE 1 - CTCATCAGTAATGGTCAGAGCAT GENE 2 – GAACAGCTGTTCAGTCTGCAAGT GENE 3 – CTGGGGTTAGTGCTGGCGATCCT GENE 4 – CCAGGAGCCCCAGTTACCGGGAG GENE 5 – GGAGAAGGTAGATTTCAATACGT GENE 6 – CATGATAAGGCTCTTACCCCCTT GENE 7 – GTCATGGCGACTGTCCAGCTTTG GENE 8 – TTGTTTTTGAGACAGAACCTTGC GENE 9 – ATCCTCCAGGTGCACAAGCTCCA GENE 10 – ACCATGGATGATGATATCGCCGC GENE 11 – TGAACGCATTCATCGTGTGGTCT Gene Ontology Describes three features about a gene: Where its protein product is located in the cell (cellular compartment) What process its protein product is part of (cellular process) The function of that protein product (molecular function) What do these Genes Do? The genes on this chip are not intended to give a complete model of lung cancer, but they can be used to illustrate several important biological principles. http://www.madison.k12.wi.us/west/science/biotech/at-genes.htm Biological Principles: Gene Expression - Tumor suppressors; oncogenes Developmental stage-dependent genes Genetic Polymorphism – Aldehyde dehydrogenase has several different versions (alleles) among human populations Biochemical reaction catalysis – Aldehyde dehydrogenase, Glutathione Peroxidase, Cytochrome P450 metabolize a variety of substances Evolutionary Conservation of Protein Structure – Actin and Slit homolog code for similar proteins in several other species Smoking increases expression (Up-regulates) these genes: Gene 1 - CYP1A1 cytochrome P450 superfamily of enzymes • involved in drug metabolism • located in the endoplasmic reticulum. • induced in the lung up to 100-fold because of tobacco smoking. Gene 4 - ALDH3A1 - aldehyde dehydrogenase • detoxification • located in the cytosol. • 16 different alleles exists, one predisposes cancer Gene 5 - GPX2 - Glutathione peroxidase • detoxification and antioxidant functions. • located in the cytoplasm. • highly expressed in squamous carcinomas of the lung Quitting smoking is worth it! Off in smokers; On in non- and former smokers Gene 3 - SLIT2 (Slit Homologue) * Involved in cell adhesion * silenced in many cancers (including lung) * may be a tumor suppressor Gene 7 TP53 - p53 tumor suppressor * guardian of the genome: central role in cell cycle * loss of p53 function allows pre-malignant cells to continue proliferating * found in very low levels in normal cells * located in the mitochondrion and in the nucleolus It’s better to NEVER START smoking! UP-Regulated (ON) in smokers and former smokers: Gene 6 - CEACAM6 Human Carcinoembryonic Antigen • an oncogene • involved in adhesion between cells • extracellular matrix • Over-expression inhibits cell differentiation and disrupts how cells are organized in lung tissue. DOWN - Regulated (OFF) in smokers and former smokers: Gene 9 - CX3CL1 - chemokine ligand • tumor suppressor • involved in cell adhesion and in inflammation. • located on the cell surface, membrane & extracellular compartment. UP-Regulated (ON) in smokers and former smokers: Gene 2 - GPC3 Glypican • controls cellular response to damage from external substances • may control cell growth and cell death (apoptosis) • Decreased expression may represent an early step in cigarette smoke–associated lung carcinogenesis • located in the plasma membrane and extracellular matrix. On in smokers and former smokers, OFF in non smokers Gene 8 - CLDN10 – claudin • Involved in cell adhesion and inflammation • located in the plasma membrane