* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Document
Gene expression profiling wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Genome evolution wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genomic library wikipedia , lookup
Protein moonlighting wikipedia , lookup
Genome (book) wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Frameshift mutation wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Expanded genetic code wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Primary transcript wikipedia , lookup
Genome editing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genetic code wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microevolution wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Helitron (biology) wikipedia , lookup
Mendel’s Peas Part II Testcross and Backcross x Parents WW ww F1 x ww w w Ww ww w Ww ww Ww Testcross Progeny ww W Ww Mendel and two genes Round Yellow Wrinkled Green x All F1 Round, Yellow Round Yellow 315 Round Green 108 Wrinkled Yellow 101 Wrinkled Green 32 Mendel and two genes Round Yellow 315 Round Green 108 Wrinkled Yellow 101 Round = 423 Wrinkled = 133 Each gene has a 3 : 1 ratio. Wrinkled Green 32 Yellow = 416 Green = 140 Punnett Square Yellow ¾ Green ¼ Round ¾ Round, Yellow ¾ x ¾ = 9/16 Round, Green ¾ x ¼ = 3/16 Wrinkled ¼ Wrinkled, Yellow ¼ x ¾ = 3/16 Wrinkled, Green ¼ x ¼ = 1/16 Ratio for a cross with 2 genes Crosses with two genes are called dihybrid. Dihybrid crosses have genetic ratios of 9:3:3:1. Principle of Independent Assortment F1 Gametes & WG Frequencies ¼ Ww Gg Wg ¼ wG ¼ wg ¼ If a gamete contains W the probability that it contains G is equal to the probability that it contains g. ¼ WG ¼ WG WW GG 1/16 ¼ Wg WWGg 1/16 ¼ wG WwGG 1/16 ¼ wg WwGg 1/16 ¼ Wg ¼ wG ¼ wg WW Gg 1/16 WWgg 1/16 WwGg 1/16 Wwgg 1/16 WwGG 1/16 WwGg 1/16 wwGG 1/16 wwGg 1/16 WwGg 1/16 Wwgg 1/16 wwGg 1/16 wwgg 1/16 Phenotypes W = Round w = Wrinkled W is dominant to w. G = Yellow g = Green G is dominant to g. F2 Progeny Genotype Phenotype 1/16 WWGG + 2/16 WWGg + 2/16 WwGG + 4/16 WwGg 9/16 Round Yellow 1/16 wwGG + 2/16 wwGg 3/16 Wrinkled Yellow 1/16 WWgg + 2/16 Wwgg 3/16 Round Green 1/16 wwgg 1/16 Wrinkled Green Principle of Independent Assortment Segregation of the members of any pair of alleles is independent of the segregation of other pairs in the formation of reproductive cells. Summary of Mendel Inherited traits are controlled by the alleles present in the reproductive cells that fuse to form the embryo. In a diploid, progeny inherit one allele from the mother and one from the father. Differences in the DNA sequence of two alleles for a gene may result in different phenotypes. Summary The phenotype is the same if the gene is inherited from the mother or from the father. One allele from the diploid is inherited in each reproductive cell. DNA Hereditary material. Contains all information to make proteins. Linear polymer of nucleotide. Each one has sugar, phosphate and a base. Four Bases A=Adenine T=Thymine C=Cytosine G=Guanine How Does DNA Carry Information? To answer this question we must take a closer look at DNA. DNA is a biopolymer •Polymers are molecules made of repeating units or building blocks •DNA has four chemical building blocks symbolized by the letters A,G,C,& T •The letters of your DNA are in a specific order that carries information about you!! So, a DNA polymer can be represented as a string of letters: AG C T TAG G G TAAAC C CATATA DNA Carries Information in the Sequence of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene • A gene is a length of DNA letters that contain an instruction for a cell to follow. • The cell uses specially designed protein machines to read the information in genes. The Order of DNA Letters Encodes the Genetic Information The order or sequence of the A, G, C and T letters in the DNA polymer encodes the actual genetic information Example of the DNA letters in a gene: AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT The specific order of the DNA letters carries the information. • Changing the order of the DNA letters will change the information carried by the gene. • We will talk about how this happens later! AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG Genes Contain Instructions for Building Proteins Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” Proteins, like DNA, are polymers • Protein building blocks are called amino acids • Amino acids are strung together into long, linear polymers by following the instructions in genes • In general, a gene encodes the instructions for one protein When a gene is “misspelled,” the protein made from it • may be made with an incorrect amino acid • may not work properly Review of Gene Expression Pathway in Cells GENE DNA mRNA copy of gene mRNA goes to cytoplasm Focus on the Genetic Code! Ribosomes translate genetic information encoded in the mRNA into protein building blocks (chains of amino acids) Protein folds into 3D active structure Protein functions in cell Genetic Code is Written in 3-Letter DNA Words (Codons) -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters CODON MEANINGS: into the correct •A “START PROTEIN” SIGNAL: AUG amino acid building •A “STOP PROTEIN” SIGNAL: UAA, UGA, UAG blocks in the protein •An amino acid building block of a protein •Codons identified in the Genetic Code Table chain. The Universal Genetic Code Table Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html STOP Codons: UAA UAG UGA Genetic Code is Written in 3-Letter DNA Words -TACCTCATGATTATACA- DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA mRNA code is “read” in TANDEM CODONS 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA Met-Glu-Tyr-STOP N Met Glu Tyr C A SHORT PROTEIN IS A PEPTIDE CODON MEANINGS: •“START PROTEIN HERE”: AUG (START) Methionine (Met) •“STOP PROTEIN HERE”: UAA, UGA, UAG •Amino acid building blocks: N-Met-Glu-Tyr-C •Codons are identified in the Genetic Code Table One Gene-One Protein Archibald Garrod (1902) described alkaptonuria, a hereditary disorder as an “inborn error of metabolism”. Proposed that mutations cause specific biochemical defects. Alkaptonuria defect is dark urine. A DNA Spelling Mistake Can Alter the Protein Chain START ADD ADD ADD ADD ADD ADD ADD STOP ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT Spelling Mistake The DNA “word” TTC is changed to TTT ATG TTT AGG CCA AAT TTT GTC GCG TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain A Mutation is a DNA “Spelling Mistake” Mutant Genes Encode Defective Proteins: (1) WILDTYPE Example: AAA GCT ACC TAT TTT CGA TGG ATA Phe Arg Trp Ile PROTEIN: WT FUNCTION (2) MUTANT AAA GCT ATC TAT TTT CGA TAG ATA Phe Arg Stop UAG NO FUNCTION (1) Normal DNA and amino acid sequence makes a wild-type protein. (2) Mutation in DNA changes Trp to Stop to make a short, mutant protein. Mutations in DNA can be Caused by: • Mistakes made when the DNA is replicated (wrong base inserted) • Ultra violet (UV) light and ionizing radiation (X-rays) damage DNA • Environmental chemical carcinogens can damage DNA • Other factors DNA Technology: The Awesome Skill, I E Alcamo, Harcourt Academic Press, 2001 Misspelled Genes: 3 Possible Outcomes DNA A misspelled gene Cell may not be able to follow damaged instruction Cell does not make the protein OR X X Damaged protein is made Damaged protein may or may not be able to function in the cell. OR Spelling error may be harmless Functional protein made by the cell Mutants across organisms Sometimes mutations in the same gene in different organisms have similar phenotype. This allows researchers to choose the organism with the best genetic resources to study the normal function of that gene. Xeroderma pigmentosa Autosomal recessive UV exposure damages DNA Defect in DNA damage repair Risks include caner, telangiectasia, disfigurement Can be diagnosed before birth Treatment is total protection from sun/flourescent light. UV damages tissue that contains molecules that can absorb light. Mechanisms of UV damage Molecular fragmentation—proteins, enzymes, and nucleic acids contain double bonds that can be ruptured by UV. Free radical generation—molecules of susceptible tissues absorb UV and eject an electron which is taken up by oxygen, then termed super oxide, a free-radical. Free radicals Are scavanged by superoxide dismutase, vitamin C, vitamin E, glutathione peroxidase, carotene Xeroderma pigmentosa Lesion mutant in maize